Next Article in Journal
Hematopoietic Rejuvenation via Natural Senolytic NSPCC1 Delays Inflammatory Aging
Previous Article in Journal
Study on the Antifungal Activity and Molecular Docking of Polyester Metabolites from Talaromyces striatoconidius
Previous Article in Special Issue
Prevalence of Gastrointestinal Parasites in Wild Asian Elephants (Elephas maximus) at a National Park in Eastern Thailand
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 15
Issue 12
10.3390/biology15120921
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Multiplex PCR Assay for Selected Escherichia coli Virulence Genes, Clostridium perfringens cpa and Cryptosporidium 18S rRNA in Faecal Samples from Diarrheic Dairy Calves

by
Jian-Jun Hou
†,
Jia-Qi Zhao
†,
Ying-Ying Fan
,
Ming-Yi Zhang
,
Jun-Ke Song
,
Xin Yang
* and
Guang-Hui Zhao
*
College of Veterinary Medicine, Northwest A&F University, Xianyang 712000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biology 2026, 15(12), 921; https://doi.org/10.3390/biology15120921 (registering DOI)
Submission received: 21 May 2026 / Revised: 10 June 2026 / Accepted: 10 June 2026 / Published: 12 June 2026
(This article belongs to the Special Issue Detection of Parasites and Parasitic Diseases in Animals)
Browse Figures
Versions Notes

Simple Summary

Diarrhea is a significant disease in dairy calves, with pathogen infection being one of the primary causes. Our previous study found the frequent occurrence of Escherichia coli virulence genes (eaeA, stx1 and stx2), Clostridium perfringens cpa and Cryptosporidium in diarrheic dairy calves in Ningxia Hui Autonomous Region, China. The present study aimed to develop a multiplex PCR assay for the simultaneous detection of selected E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA in diarrheic dairy calves, which could contribute to the prevention and control of diarrheic diseases in dairy calves.

Abstract

Escherichia coli, Clostridium perfringens and Cryptosporidium are common diarrhea-related pathogens in dairy calves, posing considerable economic losses to animal husbandry and threatening public health. A previous study in our lab found the frequent occurrence of Escherichia coli virulence genes (eaeA, stx1 and stx2), Clostridium perfringens cpa and Cryptosporidium in diarrheic dairy calves in Ningxia Hui Autonomous Region, China. The present study aimed to develop a multiplex PCR for simultaneous detection of these virulence genes and Cryptosporidium in diarrheic dairy calves. The multiplex PCR demonstrated sensitivities of 2060 copies, 18200 copies, 1300 copies, 1990 copies and 974 copies for stx1, stx2, eaeA, cpa and 18S rRNA, respectively. Moreover, the method showed no cross-reactivity with Giardia duodenalis, Enterocytozoon bieneusi, Eimeria, Haemonchus contortus, Oesophagostomum, Moniezia, Salmonella, Proteus mirabilis and Staphylococcus aureus. Further application of the multiplex PCR in 20 clinical faecal samples from diarrheic dairy calves found that the positive rates of the multiplex PCR assay were 55% (11/20), 50% (10/20), 60% (12/20), 45% (9/20) and 25% (5/20) for stx1, stx2, eaeA, cpa and 18S rRNA, respectively, which were not significantly lower than those of the conventional PCR targeting stx1 (60%, 12/20) and eaeA (65%, 13/20), but higher than those of the reported PCR targeting stx2 (45%, 9/20) and cpa (40%, 8/20), and were consistent with those of the reported nested PCR targeting 18S rRNA (25%, 5/20). Taken together, the present study preliminarily developed a multiplex PCR assay for the rapid detection of selected E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA in dairy calves, which could provide basic data and technical support for the diagnosis and prevention of calf diarrhea. However, more samples from divergent clinical settings are needed to validate the assay in the diagnosis of selected E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA in future studies.

1. Introduction

Diarrhea is one of the commonest diseases in dairy calves on large-scale farms and also a major cause of increased calf mortality and economic losses for farms [1]. Calves are highly susceptible to diarrhea within the first month after birth, particularly during the second to third week [2]. Acute diarrhea can cause fever, rapid breathing, and reduced appetite in affected calves, ultimately leading to death from dehydration and exhaustion. Chronic or persistent diarrhea may stunt growth, delay the time to maturity, reduce the productive and reproductive performance of cows, and significantly lower the economic returns of farms [3].
Calf diarrhea is a complex multifactorial disease, and its occurrence is attributed to various factors, including both infectious and non-infectious elements [4,5]. Infection with pathogens such as bacteria, viruses, and parasites represents one of the primary causes [4,6]. Among these infectious pathogens, the main bacteria include Escherichia coli, Salmonella and Clostridium perfringens [7,8,9]; the primary viruses include bovine coronavirus (BCV), bovine rotavirus (BRV) and bovine viral diarrhea virus (BVDV) [10,11,12]; and the parasites include Cryptosporidium, Giardia duodenalis and Enterocytozoon bieneusi [13,14,15]. Understanding the occurrence and distribution of these diarrhea-related pathogens is essential for the prevention and control of calf diarrhea.
Accurate diagnosis facilitates understanding of pathogen epidemiology. Using PCR-based sequencing techniques, our previous study identified a high prevalence of E. coli virulence genes (stx1, stx2 and eaeA), C. perfringens cpa and Cryptosporidium 18S rRNA in diarrheic calves in Ningxia Hui Autonomous Region, China [16]. In the present study, we developed a multiplex PCR assay capable of simultaneously detecting these virulence genes and Cryptosporidium 18S rRNA gene, aiming to provide a rapid, economical and efficient clinical diagnostic tool for detecting intestinal pathogens in dairy calves with diarrhea. This established multiplex PCR method will therefore help farms implement timely and effective prevention and control measures, thereby reducing the occurrence and transmission of calf diarrhea.

2. Materials and Methods

2.1. Genomic DNA Isolation

Genomic DNA was extracted from clinical faecal samples of diarrheic calves using the E.Z.N.A. Stool DNA kit (Omega, Norcross, GA, USA) according to the manufacturer’s instructions. Genomic DNA samples of E. coli, C. perfringens, Cryptosporidium, Giardia duodenalis, Enterocytozoon bieneusi, Eimeria, Haemonchus contortus, Oesophagostomum, Moniezia, Salmonella, Proteus mirabilis and Staphylococcus aureus were obtained from a previous study in our laboratory. All genomic DNA samples were stored at −20 °C.

2.2. Construction of Recombinant Plasmids

E. coli virulence genes (eaeA, stx1 and stx2), C. perfringens cpa and Cryptosporidium 18S rRNA were amplified from the genomic DNA by PCR as previously described [17,18,19]. The sequences of the E. coli virulence genes (eaeA, stx1 and stx2), C. perfringens cpa and Cryptosporidium 18S rRNA cloned into plasmids in this study are provided in Table S1. A universal DNA Purification Kit (Tiangen, Beijing, China) was used to recover the target gene fragments, and the gel extraction products were ligated by using the pMD 19-T Vector Cloning Kit (Takara, Dalian, China). The ligation products were then transformed into E. coli JM109 competent cells. After verification by PCR-based sequencing, the positive mono-colonies were further cultured for plasmid DNA extraction using the TIANpure Midi Plasmid Kit (Tiangen, Beijing, China). The concentration of the extracted plasmid DNA was measured using a spectrophotometer (Allsheng, Hangzhou, China), and the DNA was stored at −20 °C until use.

2.3. Primer Design

Primers targeting the selected E. coli virulence genes (eaeA, stx1 and stx2), C. perfringens cpa and Cryptosporidium 18S rRNA were designed using Primer Premier 6 (PREMIER Biosoft, San Francisco, CA, USA) and synthesized by Sangon Biotech (Shanghai, China) (Table 1).

2.4. Establishment of Gene-Specific PCRs for Detecting Selected E. coli Virulence Genes, C. perfringens cpa and Cryptosporidium 18S rRNA

Each gene-specific PCR was performed by using a PCR machine (SimpliAmpTM, Thermo Fisher Scientific, Waltham, MA, USA) with a temperature ramp rate of 1 °C/s. The reaction mixture consisted of a total volume of 25 μL containing 1.0 μL of DNA template, 0.125 μL of Ex Taq polymerase, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 2.0 μL of MgCl2 (25 mM), 2.0 μL of dNTP (2.5 mM each), 1.0 μL each of forward and reverse primers (10 μM), and 15.375 μL of ddH2O under the following conditions: initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, and a final extension at 72 °C for 10 min.
Subsequently, the reaction conditions and reaction system of each gene-specific PCR were optimized to improve PCR efficiency. Firstly, the annealing temperature was optimized over a range of 53 °C to 60 °C at 1 °C intervals. Next, primer concentrations were optimized from 0.16 μM to 0.72 μM in 0.08 μM increments. Finally, the Mg2+ concentration was optimized from 0.5 mM to 4.0 mM in 0.5 mM increments.
To assess the sensitivity, positive plasmid DNAs containing the selected E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA were subjected to tenfold serial dilutions. Using the optimal reaction conditions and system established in this study, the lowest copy number of each plasmid detectable by its gene-specific PCR assay was determined.
Using the optimal reaction conditions and system established in this study, positive DNA samples were used as controls. To evaluate the specificity of each gene-specific PCR assay, DNA samples from G. duodenalis, E. bieneusi, Eimeria, H. contortus, Oesophagostomum, Moniezia, Salmonella, P. mirabilis and S. aureus were also included.

2.5. Establishment of a Multiplex PCR for Simultaneously Detecting Selected E. coli Virulence Genes, C. perfringens cpa and Cryptosporidium 18S rRNA

Based on the optimal reaction conditions and systems established for the gene-specific PCR targeting E. coli stx1, specific primers for E. coli stx2 and eaeA, C. perfringens cpa and Cryptosporidium 18S rRNA were sequentially added to the PCR reaction mixture to perform multiplex PCR amplification. Through gradual optimization of the annealing temperature and primer concentrations, and Mg2+ concentrations, a multiplex PCR assay was successfully established.
A PCR reaction system with a total volume of 25 μL was used. The initial reaction mixture consisted of 1.0 μL of DNA template, 0.125 μL of Ex Taq, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 2.0 μL of MgCl2 (25 mM), 2.0 μL of dNTP (2.5 mM each), 0.8 μL of each of the upstream and downstream primers (10 μM) for E. coli stx1, and 0.6 μL each of the upstream and downstream primers for E. coli stx2, and the remaining volume was made up of ddH2O. The PCR amplification conditions were as follows: initial denaturation at 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min.

2.5.1. Optimization of the Multiplex PCR for Detecting the stx1 and stx2 Genes of E. coli

The annealing temperature for the multiple PCR was optimized over a range of 53 °C to 60 °C at 1 °C intervals. Subsequently, the concentration of the upstream and downstream primers for E. coli stx2 was optimized by adding them to the PCR reaction system at final concentrations ranging from 0.16 μM to 0.72 μM in 0.08 μM increments.

2.5.2. Optimization of the Multiplex PCR for Detecting the stx1, stx2 and eaeA Genes of E. coli

Using the optimal reaction conditions and systems established for the multiple PCR targeting E. coli stx1 and stx2, the annealing temperature was optimized over a range of 53 °C to 60 °C at 1 °C intervals. Subsequently, the primer concentration for E. coli eaeA was optimized by adding upstream and downstream primers to the reaction system at final concentrations ranging from 0.16 μM to 0.72 μM in 0.08 μM increments.

2.5.3. Optimization of the Multiplex PCR for Detecting Selected E. coli Virulence Genes and C. perfringens cpa

Based on the optimal reaction conditions and systems established for the multiplex PCR targeting E. coli stx1, stx2 and eaeA, the annealing temperature was optimized over a range of 53 °C to 60 °C at 1 °C intervals. Subsequently, gradient concentrations of the upstream and downstream primers for C. perfringens cpa were tested by adding them to the PCR reaction system at final concentrations ranging from 0.16 μM to 0.72 μM in 0.08 μM increments.

2.5.4. Optimization of the Multiplex PCR for Detecting Selected E. coli Virulence Genes, C. perfringens cpa and Cryptosporidium 18S rRNA

Using the optimal reaction conditions and systems established for the multiplex PCR targeting the selected E. coli virulence genes and C. perfringens cpa, the annealing temperature was further optimized over a range of 53 °C to 60 °C at 1 °C intervals. Subsequently, the primer concentration for Cryptosporidium 18S rRNA was optimized by adding upstream and downstream primers at final primer concentrations ranging from 0.16 μM to 0.72 μM in 0.08 μM increments. Based on the optimized multiplex PCR system, the Mg2+ concentration was then optimized over a final concentration ranging from 0.5 mM to 4.0 mM in 0.5 mM increments to determine the optimal Mg2+ concentration for the multiplex PCR.

2.5.5. Sensitivity Test

The positive plasmid DNA templates for E. coli eaeA, stx1 and stx2, C. perfringens cpa and Cryptosporidium 18S rRNA were each subjected to tenfold serial dilutions. Using the optimal reaction conditions and systems established in this study, the lowest copy number of each plasmid detectable by the multiplex PCR assay was determined.

2.5.6. Specificity Test

Using the optimal reaction conditions and systems established in this study, DNA samples positive for E. coli, C. perfringens and Cryptosporidium were used as controls, and DNA samples from G. duodenalis, E. bieneusi, Eimeria, H. contortus, Oesophagostomum, Moniezia, Salmonella, P. mirabilis and S. aureus were included to evaluate the specificity of the multiplex PCR assay.

2.5.7. Clinical Sample Test

The multiplex PCR assay established in this study was used to detect 20 faecal samples randomly collected from diarrheic calves on large-scale farms in Lingwu, Ningxia. The results were compared with those obtained from previously reported gene-specific PCR assays to preliminarily evaluate the applicability of the established method.

2.5.8. Statistical Analysis

Differences in the positive rates of the targeted genes between the multiplex PCR and gene-specific PCR were analyzed by using the chi-square test in SPSS V18.0 (IBM, New York, NY, USA). Differences were considered statistically significant when the p-value was less than 0.05.

3. Results

3.1. Establishment of Gene-Specific PCRs

3.1.1. Optimal Reaction Conditions and Reaction System for the Gene-Specific PCR Targeting E. coli eaeA

The optimal annealing temperature for the gene-specific PCR targeting E. coli eaeA was 58 °C (Figure 1A); the optimal primer concentration was 0.72 μM (Figure 1B); and the optimal Mg2+ concentration was 3.5 mM (Figure 1C). The final optimal PCR reaction system consisted of 1.0 μL of template DNA, 0.125 μL of Ex Taq, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 3.5 μL of MgCl2 (25 mM), 2 μL of dNTP (2.5 mM each), and 1.8 μL each of the upstream and downstream primers (10 μM) for E. coli eaeA, with the remaining volume made up of ddH2O. The PCR conditions were as follows: initial denaturation at 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min.
The original concentration of the positive plasmid pMD19-T-eaeA extracted in this study was 1.30 × 109 copies/μL. The sensitivity test showed that the minimum detection limit of the gene-specific PCR targeting E. coli eaeA was 130 copies (Figure 1D). The specificity test demonstrated that this PCR method amplified the expected band of 248 bp for E. coli eaeA, while no amplification was observed for DNA from other common enteric microorganisms (Figure 1E).

3.1.2. Optimal Reaction Conditions and Reaction System for the Gene-Specific PCR Targeting E. coli stx1

The optimal annealing temperature for the gene-specific PCR targeting E. coli stx1 was 58 °C (Figure 2A); the optimal primer concentration was 0.40 μM (Figure 2B); and the optimal Mg2+ concentration was 1.0 mM (Figure 2C). The final established PCR reaction system consisted of 1.0 μL of template DNA, 0.125 μL of Ex Taq, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 1.5 μL of MgCl2 (25 mM), 2 μL of dNTP (2.5 mM each), and 1.0 μL each of the upstream and downstream primers (10 μM) for E. coli stx1, with the remaining volume made up of ddH2O. The annealing temperature was set at 58 °C, and the other reaction conditions were the same as those described for the gene-specific PCR targeting E. coli eaeA.
The original concentration of the positive plasmid pMD19-T-stx1 extracted in this study was 2.06 × 109 copies/μL. The sensitivity test showed that the detection limit of the gene-specific PCR targeting E. coli stx1 was 206 copies (Figure 2D). The specificity test showed that this PCR method amplified the target band of 706 bp for E. coli stx1, while no amplification was observed for DNA from other common enteric microorganisms (Figure 2E).

3.1.3. Optimal Reaction Conditions and Reaction System for the Gene-Specific PCR Targeting E. coli stx2

The optimal annealing temperature for the gene-specific PCR targeting E. coli stx2 was 57 °C (Figure 3A); the optimal primer concentration was 0.40 μM (Figure 3B); and the optimal Mg2+ concentration was 1.5 mM (Figure 3C). The final established PCR reaction system consisted of 1.0 μL of template DNA, 0.125 μL of Ex Taq, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 4.0 μL of MgCl2 (25 mM), 2 μL of dNTP (2.5 mM each), and 0.8 μL each of the upstream and downstream primers (10 μM) for E. coli stx2, with the remaining volume made up of ddH2O. The annealing temperature was set at 57 °C, and the other reaction conditions were the same as those described for the gene-specific PCR targeting E. coli eaeA.
The original concentration of the positive plasmid pMD19-T-stx2 extracted in this study was 1.82 × 109 copies/μL. The sensitivity test showed that the detection limit of the gene-specific PCR targeting E. coli stx2 was 182 copies (Figure 3D). The specificity test demonstrated that this PCR method amplified the expected band of 950 bp for E. coli stx2, while no amplification was observed for DNA from other common enteric microorganisms (Figure 3E).

3.1.4. Optimal Reaction Conditions and Reaction System for the Gene-Specific PCR Targeting C. perfringens cpa

The optimal annealing temperature for the gene-specific PCR targeting C. perfringens cpa was 60 °C (Figure 4A); the optimal primer concentration was 0.32 μM (Figure 4B); and the optimal Mg2+ concentration was 1.5 mM (Figure 4C). The final established PCR reaction system consisted of 1.0 μL of template DNA, 0.125 μL of Ex Taq, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 4.0 μL of MgCl2 (25 mM), 2 μL of dNTP (2.5 mM each), and 0.8 μL each of the upstream and downstream primers (10 μM) for C. perfringens cpa, with the remaining volume made up of ddH2O. The annealing temperature was set at 60 °C, and the other reaction conditions were the same as those described for the gene-specific PCR targeting E. coli eaeA.
The original concentration of the positive plasmid pMD19-T-cpa extracted in this study was 1.99 × 109 copies/μL. The sensitivity test showed that the detection limit of the gene-specific PCR targeting C. perfringens cpa was 199 copies (Figure 4D). The specificity test demonstrated that this PCR method amplified the expected band of 550 bp for C. perfringens cpa, while no amplification was observed for DNA from other common enteric microorganisms (Figure 4E).

3.1.5. Optimal Reaction Conditions and Reaction System for the Gene-Specific PCR Targeting Cryptosporidium 18S rRNA

The optimal annealing temperature for the gene-specific PCR targeting Cryptosporidium 18S rRNA was 58 °C (Figure 5A); the optimal primer concentration was 0.72 μM (Figure 5B); and the optimal Mg2+ concentration was 2.5 mM (Figure 5C). The final established PCR reaction system consisted of 1.0 μL of template DNA, 0.125 μL of Ex Taq, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 2.5 μL of MgCl2 (25 mM), 2 μL of dNTP (2.5 mM each), and 1.8 μL each of the upstream and downstream primers (10 μM) for the 18S rRNA gene of Cryptosporidium, with the remaining volume made up of ddH2O. The annealing temperature was set at 58 °C, and other reaction conditions were the same as those described for the gene-specific PCR targeting E. coli eaeA.
The original concentration of the positive plasmid pMD19-T-18S rRNA extracted in this study was 9.74 × 108 copies/μL. The sensitivity test showed that the detection limit of the gene-specific PCR targeting Cryptosporidium 18S rRNA was 974 copies (Figure 5D). The specificity test demonstrated that this PCR method amplified the expected band of 300 bp for C. parvum, C. bovis and C. ryanae, while no amplification was observed for DNA from other common enteric microorganisms (Figure 5E).

3.2. Establishment of Multiplex PCRs

3.2.1. Optimization of Multiplex PCR

Based on the optimal reaction conditions and systems established for the single-gene-specific PCR targeting E. coli stx1, specific primers for E. coli stx2 were first added to determine the optimal annealing temperature (60.0 °C; Figure 6A) and optimal primer concentration (0.32 μM; Figure 6B) for the multiplex PCR. Subsequently, specific primers for E. coli eaeA were added to determine the optimal annealing temperature (59.0 °C; Figure 6C) and optimal primer concentration (0.72 μM; Figure 6D). Following this, specific primers for C. perfringens cpa were added to determine the optimal annealing temperature (60.0 °C; Figure 6E) and optimal primer concentration (0.32 μM; Figure 6F). Finally, specific primers for Cryptosporidium 18S rRNA were added to determine the optimal annealing temperature (58 °C; Figure 6G) and optimal primer concentration (0.72 μM; Figure 6H). Subsequently, the Mg2+ concentration for the multiplex PCR was optimized, and the optimal Mg2+ concentration was determined to be 2.5 mM (Figure 6I).
The final established multiplex PCR reaction system consisted of 1.0 μL of template DNA, 0.125 μL of Ex Taq polymerase, 2.5 μL of 10 × Ex Taq Buffer (Mg2+ free), 2.5 μL of MgCl2 (25 mM), and 2.0 μL of dNTP (2.5 mM each), along with 0.8 μL of each specific primer (10 μM) for C. perfringens cpa, 1.0 μL for E. coli stx1, 0.8 μL for E. coli stx2, 1.8 μL for E. coli eaeA, and 1.8 μL for Cryptosporidium 18S rRNA. The remaining volume was made up of ddH2O for a total reaction volume of 25 μL. The annealing temperature was set at 58 °C, and the other reaction conditions were the same as those described for the gene-specific PCR targeting E. coli eaeA.

3.2.2. Sensitivity Test of Multiplex PCR

In this study, the initial concentrations of the positive plasmids pMD19-T-stx1, pMD19-T-stx2, pMD19-T-eaeA, pMD19-T-cpa and pMD19-T-18S rRNA were 2.06 × 108 copies/μL, 1.82 × 108 copies/μL, 1.30 × 108 copies/μL, 1.99 × 108 copies/μL and 9.74 × 107 copies/μL, respectively. Each plasmid DNA template was subjected to tenfold serial dilution and detected using the multiplex PCR assay established in this study. The minimum detectable plasmid copy numbers for the multiplex PCR were determined to be 2060 copies for stx1, 18200 copies for stx2, 1300 copies for eaeA, 1990 copies for cpa, and 974 copies for 18S rRNA (Figure 6J).

3.2.3. Specificity Test of Multiplex PCR

The multiplex PCR successfully amplified the target bands for stx1 (706 bp), stx2 (950 bp), eaeA (248 bp), cpa (550 bp) and 18S rRNA (300 bp), while no amplification bands were observed for other common enteric pathogens (Figure 6K).

3.2.4. Application of Multiplex PCR in Clinical Sample Test

The final optimized multiplex PCR assay was applied to detect 20 faecal samples collected from clinically diarrheic calves on large-scale farms in Lingwu, Ningxia. The detection rates of the multiplex PCR for stx1, stx2, eaeA, cpa and 18S rRNA were 55% (11/20), 50% (10/20), 60% (12/20), 45% (9/20) and 25% (5/20), respectively (Figure 7A). These rates were not significantly lower than those of the conventional PCR targeting stx1 (60%, 12/20) (χ2 = 0.1023, df = 1, p = 0.7491) and eaeA (65%, 13/20) (χ2 = 0.1067, df = 1, p = 0.7440) (Figure 7B,C), nor significantly higher than those of the conventional PCR for stx2 (45%, 9/20) (χ2 = 0.1003, df = 1, p = 0.7515) and cpa (40%, 8/20) (χ2 = 0.1023, df = 1, p = 0.7491) (Figure 7D,E), and were consistent with that of nested PCR for 18S rRNA (25%, 5/20) (Figure 7F). To eliminate false positives, PCR products that were positive only by multiplex PCR were recovered from the gel and sent for sequencing, and the results confirmed that the two additional positive samples for stx2 and cpa were true positives.

4. Discussion

Escherichia coli, Clostridium perfringens and Cryptosporidium are common pathogens associated with diarrhea in dairy calves [1]. These pathogens disrupt the intestinal immune barrier of the host by producing toxins or colonizing the intestine, causing substantial economic losses to the dairy farming industry [20,21,22]. Moreover, these pathogens have zoonotic potential, endangering human health. In the present study, we established a multiplex PCR assay for the simultaneous detection of E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA in dairy calves, which could provide an alternative approach for the rapid and effective detection of these selected virulence genes and Cryptosporidium in dairy calves.
Several diagnostic methods have been applied in the detection of pathogens associated with diarrhea in calves, including clinical history, physical examination, laboratory diagnosis, hematological and serum biochemical analyses, and postmortem examination [23]. Previous reports have suggested an association between age and infection with E. coli, C. perfringens and Cryptosporidium, but these methods lack specificity [6,24,25]. Laboratory diagnosis is widely used in the detection of diarrheic pathogens and encompasses multiple techniques, such as morphological examination (e.g., bacterial culturing and faecal flotation), immunological assays (e.g., ELISA and ICG), molecular-based assays (e.g., PCR and qPCR) and nanotechnology-based assays [23]. Morphological examination is considered the gold standard for pathogen detection, but it is time-consuming, lacks sensitivity and specificity, and requires well-trained researchers [26,27]. Immunological assays are fast and ideal for screening large numbers of samples, and can be applied to detect antibodies and antigens of diarrheic pathogens, but they lack specificity and cannot distinguish between previous and current infections [28]. Molecular-based assays exhibit high specificity and sensitivity when performed under appropriate operating procedures, and have been widely used in practice for the detection of E. coli, C. perfringens and Cryptosporidium [29].
To overcome the limitation of traditional PCR, which can only detect a single pathogen, multiplex PCR capable of simultaneously identifying multiplex infections has become increasingly popular [30]. Recently, several multiplex PCR assays have been developed for the detection of diarrheic pathogens. For example, Abed and Menshawy established a multiplex PCR for the detection of E. coli associated with diarrhea in calves, and identified the presence of EAEC and EHEC [31]. Pansri and colleagues developed a new multiplex quantitative PCR (qPCR) test, termed Enterit4Calves, which can detect and quantify pathogens responsible for diarrhea in calves, including C. perfringens, E. coli F5, bovine rotavirus, bovine coronavirus, C. parvum and Eimeria [32]. However, these methods typically focus on a limited set of selected pathogens, which restricts their application in clinical detection due to the regional diversity of pathogens.
A previous study in our laboratory identified a high prevalence of E. coli virulence genes (stx1, stx2 and eaeA), C. perfringens cpa, and Cryptosporidium in diarrheic dairy calves in Ningxia Hui Autonomous Region, China [16]. Although a multiplex PCR has been developed to detect E. coli associated with diarrhea in calves, and another multiplex PCR has been established to detect C. perfringens, E. coli F5, bovine rotavirus, bovine coronavirus, C. parvum and Eimeria [31,32], neither method can simultaneously detect E. coli virulence genes (stx1, stx2 and eaeA), C. perfringens cpa and Cryptosporidium. To address this limitation, the present study aimed to establish a multiplex PCR for the simultaneous detection of the selected E. coli virulence genes, C. perfringens cpa and Cryptosporidium, thereby facilitating a better understanding of the prevalence of these virulence genes and pathogens in Ningxia and contributing to the prevention and control of calf diarrhea in this region. In this study, gene-specific PCR assays were first established for E. coli stx1, stx2 and eaeA, C. perfringens cpa, and Cryptosporidium 18S rRNA. Subsequently, based on the optimized PCR assay targeting stx1, specific primers for stx2, eaeA, cpa and 18S rRNA were sequentially added to develop a multiplex PCR assay for the simultaneous detection of the selected targets. When applied to 20 clinical samples from diarrheic calves, the established multiplex PCR assay showed detection rates for E. coli stx1 and eaeA that were slightly lower than those obtained with conventional PCR assays. This may be attributed to the presence of multiple primer pairs in the multiplex PCR system, which can lead to primer–dimer formation or preferential amplification of other targets, thereby reducing the amplification efficiency of stx1 and eaeA and resulting in lower detection rates [23,32]. Conversely, two samples that were positive for stx2 and cpa in the multiplex PCR were negative in the conventional single PCR assays, indicating that although conventional wisdom suggests that singleplex PCR is more sensitive than multiplex PCR, some positive samples may be detected only by multiplex PCR. Similar findings have been reported previously [33]. The detection rate for Cryptosporidium 18S rRNA was consistent with that obtained by nested PCR.
Notably, the multiplex PCR assay is approximately 10–100 times less sensitive for several targets. Several reasons may account for this phenomenon [34,35,36]. First, competition for and depletion of reaction components can occur. In a multiplex system, all reactions share limited reagents, as multiple primers and polymerases coexist in a single tube and compete for finite resources such as DNA polymerase, dNTPs, and magnesium ions. Second, there is a risk of non-specific interactions. The presence of a large number of oligonucleotides increases the chance of non-specific binding among them. Third, intrinsic physical limitations of the reaction system may also play a role. PCR requires balancing parameters such as annealing temperature, which may compromise amplification efficiency for certain targets. Therefore, future studies should focus on improving and validating the sensitivity of the multiplex PCR to enhance its practicality.
Although the established multiplex PCR assay could detect the selected E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA in these 20 dairy calf samples, several limitations may restrict its practical application and should be addressed in future studies. First, the present study lacked precise characterization and deposit of control strains, which may hinder independently replicating the experiment in another laboratory. Therefore, future studies should apply reference strains from international collections or public databases. Second, this study did not comply with WOAH guidelines for veterinary diagnostic tests for infectious diseases, as evidenced by the insufficient and unrepresentative clinical sample, lack of repeatability analysis, absence of external reproducibility assessment, and inadequate reaction control design. Third, the multiplex PCR requires validation on a substantially larger dataset, including samples from multiple farms and different geographical regions, comprising both positive and negative samples, along with statistical comparison against reference methods. Fourth, the multiplex PCR did not include bovine rotavirus, bovine coronavirus, bovine viral diarrhea virus, or other microorganisms. Given that calf diarrhea is a multifactorial disease, broader specificity testing incorporating more of the aforementioned microorganisms would strengthen assay validation in future studies. Fifth, independent gold standards were not included for comparison with the multiplex PCR, which may affect the assessment of the assay’s performance.

5. Conclusions

The multiplex PCR assay established in this study has the potential to simultaneously detect the selected three E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA. However, future studies are urgently needed to validate this assay using more samples from diverse geographical locations to assess its application prospects.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology15120921/s1, Table S1: Sequences used in this study for plasmid construction.

Author Contributions

Conceptualization, G.-H.Z. and X.Y.; methodology, J.-J.H., J.-Q.Z., Y.-Y.F., M.-Y.Z. and J.-K.S.; formal analysis, J.-J.H., J.-Q.Z. and Y.-Y.F.; writing—original draft preparation, J.-J.H., J.-Q.Z. and Y.-Y.F.; writing—review and editing, G.-H.Z. and X.Y.; supervision, G.-H.Z. and X.Y.; project administration, G.-H.Z. and X.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (Grant No. 2023YFD1801201).

Institutional Review Board Statement

This study was conducted under the approval and instructions of the ethics committee of Northwest A&F University (DY2024067; approved on 4 April 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cho, Y.I.; Yoon, K.J. An overview of calf diarrhea-infectious etiology, diagnosis, and intervention. J. Veter Sci. 2014, 15, 1–17. [Google Scholar] [CrossRef]
  2. Bartels, C.J.; Holzhauer, M.; Jorritsma, R.; Swart, W.A.; Lam, T.J. Prevalence, prediction and risk factors of enteropathogens in normal and non-normal faeces of young Dutch dairy calves. Prev. Veter Med. 2010, 93, 162–169. [Google Scholar] [CrossRef]
  3. Aghakeshmiri, F.; Azizzadeh, M.; Farzaneh, N.; Gorjidooz, M. Effects of neonatal diarrhea and other conditions on subsequent productive and reproductive performance of heifer calves. Veter Res. Commun. 2017, 41, 107–112. [Google Scholar] [CrossRef]
  4. Bernal-Córdoba, C.; Branco-Lopes, R.; Alonso-López, Y.; Minjee-Lee, C.; Pérez-Solano, D.; Fausak, E.D.; Pereira, V.R.; Silva-Del-Río, N. Antimicrobial drugs used in the prevention and control of protozoal and bacterial calf diarrhea: A scoping review. Prev. Veter Med. 2025, 241, 106543. [Google Scholar] [CrossRef] [PubMed]
  5. Lynch, C.; Leishman, E.M.; Miglior, F.; Kelton, D.; Schenkel, F.S.; Baes, C.F. Review: Opportunities and challenges for the genetic selection of dairy calf disease traits. Animal 2024, 18, 101141. [Google Scholar] [CrossRef]
  6. Díaz, P.; Navarro, E.; Remesar, S.; García-Dios, D.; Martínez-Calabuig, N.; Prieto, A.; López-Lorenzo, G.; López, C.M.; Panadero, R.; Fernández, G.; et al. The Age-related Cryptosporidium species distribution in asymptomatic cattle from North-Western SPAIN. Animals 2021, 11, 256. [Google Scholar] [CrossRef]
  7. Katsowich, N.; Elbaz, N.; Pal, R.R.; Mills, E.; Kobi, S.; Kahan, T.; Rosenshine, I. Host cell attachment elicits posttranscriptional regulation in infecting enteropathogenic bacteria. Science 2017, 355, 735–739. [Google Scholar] [CrossRef]
  8. Lamas, A.; Miranda, J.M.; Regal, P.; Vázquez, B.; Franco, C.M.; Cepeda, A. A comprehensive review of non-enterica subspecies of Salmonella enterica. Microbiol. Res. 2018, 206, 60–73. [Google Scholar] [CrossRef] [PubMed]
  9. Smulski, S.; Turlewicz-Podbielska, H.; Wylandowska, A.; Włodarek, J. Non-antibiotic possibilities in prevention and treatment of calf diarrhoea. J. Veter Res. 2020, 64, 119–126. [Google Scholar] [CrossRef]
  10. Padalino, B.; Cirone, F.; Zappaterra, M.; Tullio, D.; Ficco, G.; Giustino, A.; Ndiana, L.A.; Pratelli, A. Factors affecting the development of bovine respiratory disease: A cross-sectional study in beef steers shipped from france to Italy. Front. Veter Sci. 2021, 8, 627894. [Google Scholar] [CrossRef] [PubMed]
  11. Santiana, M.; Ghosh, S.; Ho, B.A.; Rajasekaran, V.; Du, W.L.; Mutsafi, Y.; De Jésus-Diaz, D.A.; Sosnovtsev, S.V.; Levenson, E.A.; Parra, G.I.; et al. Vesicle-cloaked virus clusters are optimal units for inter-organismal viral transmission. Cell Host Microbe 2018, 24, 208–220.e8. [Google Scholar] [CrossRef]
  12. Singasa, K.; Songserm, T.; Lertwatcharasarakul, P.; Arunvipas, P. Molecular and phylogenetic characterization of bovine coronavirus virus isolated from dairy cattle in Central Region, Thailand. Trop. Anim. Health Prod. 2017, 49, 1523–1529. [Google Scholar] [CrossRef] [PubMed]
  13. Li, N.; Zhao, W.; Song, S.; Ye, H.; Chu, W.; Guo, Y.; Feng, Y.; Xiao, L. Diarrhea outbreak caused by coinfections of Cryptosporidium parvum subtype IIdA20G1 and rotavirus in pre-weaned dairy calves. Transbound. Emerg. Dis. 2022, 69, e1606–e1617. [Google Scholar] [CrossRef]
  14. Qin, P.; Tao, Z.; Shi, K.; Zhao, J.; Huang, B.; Liu, H.; Wang, C.; Yin, J.; Zhu, G.; Cacciò, S.M.; et al. Molecular epidemiology of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Guizhou angus calves: Dominance of angus cattle-adapted genotypes and zoonotic potential of E. bieneusi. Microorganisms 2025, 13, 1735. [Google Scholar] [CrossRef]
  15. Zhang, Z.; Su, D.; Meng, X.; Liang, R.; Wang, W.; Li, N.; Guo, Y.; Guo, A.; Li, S.; Zhao, Z.; et al. Cryptosporidiosis outbreak caused by Cryptosporidium parvum subtype IIdA20G1 in neonatal calves. Transbound. Emerg. Dis. 2022, 69, 278–285. [Google Scholar] [CrossRef]
  16. Zhao, J.Q.; Fan, Y.Y.; Lei, Y.D.; Liu, D.; Wang, J.W.; Yang, X.; Song, J.K.; Zhao, G.H. Molecular characterization of common zoonotic protozoan parasites and bacteria causing diarrhea in dairy calves in Ningxia Hui Autonomous Region, China. Parasite 2024, 31, 60. [Google Scholar] [CrossRef] [PubMed]
  17. Hu, W.S.; Kim, H.; Koo, O.K. Molecular genotyping, biofilm formation and antibiotic resistance of enterotoxigenic Clostridium perfringens isolated from meat supplied to school cafeterias in South Korea. Anaerobe 2018, 52, 115–121. [Google Scholar] [CrossRef]
  18. Jiang, J.; Alderisio, K.A.; Xiao, L. Distribution of Cryptosporidium genotypes in storm event water samples from three watersheds in New York. Appl. Environ. Microbiol. 2005, 71, 4446–4454. [Google Scholar] [CrossRef]
  19. Toma, C.; Lu, Y.; Higa, N.; Nakasone, N.; Chinen, I.; Baschkier, A.; Rivas, M.; Iwanaga, M. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J. Clin. Microbiol. 2003, 41, 2669–2671. [Google Scholar] [CrossRef]
  20. Trefz, F.M.; Lorch, A.; Feist, M.; Sauter-Louis, C.; Lorenz, I. Construction and validation of a decision tree for treating metabolic acidosis in calves with neonatal diarrhea. BMC Veter Res. 2012, 8, 238. [Google Scholar] [CrossRef] [PubMed]
  21. Meganck, V.; Hoflack, G.; Piepers, S.; Opsomer, G. Evaluation of a protocol to reduce the incidence of neonatal calf diarrhoea on dairy herds. Prev. Veter Med. 2015, 118, 64–70. [Google Scholar] [CrossRef] [PubMed]
  22. Golbeck, L.; Cohrs, I.; Leonhard-Marek, S.; Grünberg, W. Effect of dehydration and acidemia on the potassium content of muscle tissue and erythrocytes in calves with neonatal diarrhea. J. Dairy Sci. 2018, 101, 9339–9349. [Google Scholar] [CrossRef]
  23. Sedky, D.; Ghazy, A.A.; Abou-Zeina, H.A.A. Advances in diagnosis of diseases causing diarrhea in newborn calves. Veter Res. Commun. 2025, 49, 293. [Google Scholar] [CrossRef]
  24. Jessop, E.; Li, L.; Renaud, D.L.; Verbrugghe, A.; Macnicol, J.; Gamsjäger, L.; Gomez, D.E. Neonatal calf diarrhea and gastrointestinal microbiota: Etiologic agents and microbiota manipulation for treatment and prevention of diarrhea. Veter Sci. 2024, 11, 108. [Google Scholar] [CrossRef]
  25. Keles, İ.; Ekinci, G.; Tüfekçi, E.; Citil, M.; Gunes, V.; Aslan, Q.; Onmaz, A.C.; Bekdik, I.K.; Varol, K.; Deniz, O. Etiological and predisposing factors in calves with neonatal diarrhea: A clinical study in 270 case series. Kafk. Univ. Vet. Fak. Derg. 2022, 28, 315–326. [Google Scholar]
  26. Dryden, M.W.; Payne, P.A.; Ridley, R.; Smith, V. Comparison of common fecal flotation techniques for the recovery of parasite eggs and oocysts. Vet. Ther. 2005, 6, 15–28. [Google Scholar]
  27. Muktar, Y.; Mamo, G.; Tesfaye, B.; Belina, D. A review on major bacterial causes of calf diarrhea and its diagnostic method. J. Vet. Med. Anim. Health 2015, 7, 173–185. [Google Scholar]
  28. Hamedian-Asl, M.; Zakian, A.; Azimpour, S.; Davoodi, F.; Kahroba, H. Evaluation of diagnostic methods for the detection of bovine coronavirus and rotavirus in feces of diarrheic calves. J. Hell. Veter Med. Soc. 2022, 73, 3951–3960. [Google Scholar] [CrossRef]
  29. Golaviya, A.; Mathakiya, R.; Jakhesara, S.; Koringa, P. Determining genetic diversity of prevalent G and P genotype of bovine rotavirus A from neonatal calves of Gujarat, India. J. Veter Sci. 2024, 25, e55. [Google Scholar] [CrossRef]
  30. Chang, L.; Li, Y.; Cai, Y.; Li, C. Establishment of multiplex PCR for detection of calf diarrhea associated virus and analysis of its clinical infection status. Pak. J. Zool. 2023, 55, 2829–2835. [Google Scholar] [CrossRef]
  31. Abed, A.H.; Menshawy, A.M.S. Escherichia coli neonatal calf diarrhea in middle Egypt: Prevalence, phenotypes, genotypes and pathotypes. World J. Veter Sci. 2019, 7, 14–23. [Google Scholar]
  32. Pansri, P.; Svensmark, B.; Liu, G.; Thamsborg, S.M.; Kudirkiene, E.; Nielsen, H.V.; Goecke, N.B.; Olsen, J.E. Evaluation of a novel multiplex qPCR method for rapid detection and quantification of pathogens associated with calf diarrhoea. J. Appl. Microbiol. 2022, 133, 2516–2527. [Google Scholar] [CrossRef]
  33. Yepsen, E.; Haddadin, Z.; Rankin, D.A.; McHenry, R.; Stewart, L.S.; Halasa, N.B. 685. Comparison of singleplex qPCR and the Luminex MAGPIX platform for the detection of viral pathogens. Open Forum Infect. Dis. 2020, 7, S396. [Google Scholar] [CrossRef]
  34. Songjaeng, A.; Thiemmeca, S.; Mairiang, D.; Punyadee, N.; Kongmanas, K.; Hansuealueang, P.; Tangthawornchaikul, N.; Duangchinda, T.; Mongkolsapaya, J.; Sriruksa, K.; et al. Development of a Singleplex real-time reverse transcriptase PCR assay for Pan-Dengue virus detection and quantification. Viruses 2022, 14, 1271. [Google Scholar] [CrossRef] [PubMed]
  35. Natonek-Wiśniewska, M.; Piestrzynska-Kajtoch, A.; Koseniuk, A.; Krzyścin, P. Current analytical methods and research trends are used to identify domestic pig and wild boar DNA in meat and meat products. Genes 2022, 13, 1825. [Google Scholar] [CrossRef] [PubMed]
  36. Thomas, P.; Arun, T.; Nair, S.S.; Subbaiyan, A.; Abhishek; Abdel-Glil, M.Y.; Dandapat, P. Chapter Seven—Advanced strategies for target selection, primer design, and development of multiplex PCR assays for pathogen genotyping. Methods Microbiol. 2025, 57, 177–201. [Google Scholar]
Biology 15 00921 g001
Figure 1. Establishment of the specific PCR assay targeting E. coli eaeA. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 1.30 × 109 copies; lane 2, 1.30 × 108 copies; lane 3, 1.30 × 107 copies; lane 4, 1.30 × 106 copies; lane 5, 1.30 × 105 copies; lane 6, 1.30 × 104 copies; lane 7, 1.30 × 103 copies; lane 8, 1.30 × 102 copies; lane 9, 1.30 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, E. coli stx1-positive strain; lane 2, Giardia duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, Enterocytozoon bieneusi; lane 6, Haemonchus contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, Proteus mirabilis; lane 10, Staphylococcus aureus; lane 11, negative control.
Figure 1. Establishment of the specific PCR assay targeting E. coli eaeA. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 1.30 × 109 copies; lane 2, 1.30 × 108 copies; lane 3, 1.30 × 107 copies; lane 4, 1.30 × 106 copies; lane 5, 1.30 × 105 copies; lane 6, 1.30 × 104 copies; lane 7, 1.30 × 103 copies; lane 8, 1.30 × 102 copies; lane 9, 1.30 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, E. coli stx1-positive strain; lane 2, Giardia duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, Enterocytozoon bieneusi; lane 6, Haemonchus contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, Proteus mirabilis; lane 10, Staphylococcus aureus; lane 11, negative control.
Biology 15 00921 g001
Biology 15 00921 g002
Figure 2. Establishment of the specific PCR assay targeting E. coli stx1. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 2.06 × 109 copies; lane 2, 2.06 × 108 copies; lane 3, 2.06 × 107 copies; lane 4, 2.06 × 106 copies; lane 5, 2.06 × 105 copies; lane 6, 2.06 × 104 copies; lane 7, 2.06 × 103 copies; lane 8, 2.06 × 102 copies; lane 9, 2.06 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, E. coli stx1-positive strain; lane 2, G. duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, E. bieneusi; lane 6, H. contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, P. mirabilis; lane 10, S. aureus; lane 11, negative control.
Figure 2. Establishment of the specific PCR assay targeting E. coli stx1. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 2.06 × 109 copies; lane 2, 2.06 × 108 copies; lane 3, 2.06 × 107 copies; lane 4, 2.06 × 106 copies; lane 5, 2.06 × 105 copies; lane 6, 2.06 × 104 copies; lane 7, 2.06 × 103 copies; lane 8, 2.06 × 102 copies; lane 9, 2.06 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, E. coli stx1-positive strain; lane 2, G. duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, E. bieneusi; lane 6, H. contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, P. mirabilis; lane 10, S. aureus; lane 11, negative control.
Biology 15 00921 g002
Biology 15 00921 g003
Figure 3. Establishment of the specific PCR assay targeting E. coli stx2. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 1.82 × 109 copies; lane 2, 1.82 × 108 copies; lane 3, 1.82 × 107 copies; lane 4, 1.82 × 106 copies; lane 5, 1.82 × 105 copies; lane 6, 1.82 × 104 copies; lane 7, 1.82 × 103 copies; lane 8, 1.82 × 102 copies; lane 9, 1.82 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, E. coli stx2-positive strain; lane 2, G. duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, E. bieneusi; lane 6, H. contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, P. mirabilis; lane 10, S. aureus; lane 11, negative control.
Figure 3. Establishment of the specific PCR assay targeting E. coli stx2. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 1.82 × 109 copies; lane 2, 1.82 × 108 copies; lane 3, 1.82 × 107 copies; lane 4, 1.82 × 106 copies; lane 5, 1.82 × 105 copies; lane 6, 1.82 × 104 copies; lane 7, 1.82 × 103 copies; lane 8, 1.82 × 102 copies; lane 9, 1.82 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, E. coli stx2-positive strain; lane 2, G. duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, E. bieneusi; lane 6, H. contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, P. mirabilis; lane 10, S. aureus; lane 11, negative control.
Biology 15 00921 g003
Biology 15 00921 g004
Figure 4. Establishment of the specific PCR assay for C. perfringens cpa. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 1.99 × 109 copies; lane 2, 1.99 × 108 copies; lane 3, 1.99 × 107 copies; lane 4, 1.99 × 106 copies; lane 5, 1.99 × 105 copies; lane 6, 1.99 × 104 copies; lane 7, 1.99 × 103 copies; lane 8, 1.99 × 102 copies; lane 9, 1.99 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, C. perfringens; lane 2, G. duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, E. bieneusi; lane 6, H. contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, P. mirabilis; lane 10, S. aureus; lane 11, negative control.
Figure 4. Establishment of the specific PCR assay for C. perfringens cpa. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 1.99 × 109 copies; lane 2, 1.99 × 108 copies; lane 3, 1.99 × 107 copies; lane 4, 1.99 × 106 copies; lane 5, 1.99 × 105 copies; lane 6, 1.99 × 104 copies; lane 7, 1.99 × 103 copies; lane 8, 1.99 × 102 copies; lane 9, 1.99 × 101 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, C. perfringens; lane 2, G. duodenalis; lane 3, Eimeria; lane 4, Moniezia; lane 5, E. bieneusi; lane 6, H. contortus; lane 7, Oesophagostomum; lane 8, Salmonella; lane 9, P. mirabilis; lane 10, S. aureus; lane 11, negative control.
Biology 15 00921 g004
Biology 15 00921 g005
Figure 5. Establishment of the specific PCR assay targeting Cryptosporidium 18S rRNA. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 9.74 × 108 copies; lane 2, 9.74 × 107 copies; lane 3, 9.74 × 106 copies; lane 4, 9.74 × 105 copies; lane 5, 9.74 × 104 copies; lane 6, 9.74 × 103 copies; lane 7, 9.74 × 102 copies; lane 8, 9.74 × 101 copies; lane 9, 9.74 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, C. parvum; lane 2, C. bovis; lane 3, C. ryanae; lane 4, G. duodenalis; lane 5, Eimeria; lane 6, Moniezia; lane 7, E. bieneusi; lane 8, H. contortus; lane 9, Oesophagostomum; lane 10, Salmonella; lane 11, P. mirabilis; lane 12, S. aureus; lane 13, negative control.
Figure 5. Establishment of the specific PCR assay targeting Cryptosporidium 18S rRNA. (A) Optimization of annealing temperature: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of MgCl2 concentration: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (D) Sensitivity test: M, DL2000 DNA Marker; lane 1, 9.74 × 108 copies; lane 2, 9.74 × 107 copies; lane 3, 9.74 × 106 copies; lane 4, 9.74 × 105 copies; lane 5, 9.74 × 104 copies; lane 6, 9.74 × 103 copies; lane 7, 9.74 × 102 copies; lane 8, 9.74 × 101 copies; lane 9, 9.74 copies; lane 10, negative control. (E) Specificity test: M, DNA Marker DL1000; lane 1, C. parvum; lane 2, C. bovis; lane 3, C. ryanae; lane 4, G. duodenalis; lane 5, Eimeria; lane 6, Moniezia; lane 7, E. bieneusi; lane 8, H. contortus; lane 9, Oesophagostomum; lane 10, Salmonella; lane 11, P. mirabilis; lane 12, S. aureus; lane 13, negative control.
Biology 15 00921 g005
Biology 15 00921 g006
Figure 6. Establishment of the multiplex PCR assay. (A) Optimization of annealing temperature for the multiplex PCR targeting the stx1 and stx2 of E. coli: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration for the multiplex PCR targeting the stx1 and stx2 of E. coli: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of annealing temperature for the multiplex PCR targeting the stx1, stx2, and eaeA of E. coli: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (D) Optimization of primer concentration for the multiplex PCR targeting the stx1, stx2 and eaeA of E. coli: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (E) Optimization of annealing temperature for the multiplex PCR targeting the stx1, stx2, eaeA and cpas: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (F) Optimization of primer concentration for the multiplex PCR targeting the stx1, stx2, eaeA and cpa: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (G) Optimization of annealing temperature for the multiplex PCR targeting the stx1, stx2, eaeA, cpa and 18S rRNA: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (H) Optimization of primer concentration for the multiplex PCR targeting the stx1, stx2, eaeA, cpa and 18S rRNA: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (I) Optimization of MgCl2 concentration for the multiplex PCR targeting the stx1, stx2, eaeA, cpa and 18S rRNA: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (J) Sensitivity test of the multiplex PCR: M, DNA Marker DL1000; lanes 1–8, recombinant plasmid pMD19-T-stx1 at concentrations ranging from 2.06 × 108 copies/μL to 20.6 copies/μL, recombinant plasmid pMD19-T-stx2 at concentrations ranging from 1.82 × 108 copies/μL to 18.2 copies/μL, recombinant plasmid pMD19-T-eaeA at concentrations ranging from 1.30 × 108 copies/μL to 13.0 copies/μL, recombinant plasmid pMD19-T-cpa at concentrations ranging from 1.99 × 108 copies/μL to 19.9 copies/μL, and recombinant plasmid pMD19-T-18S rRNA at concentrations ranging from 9.74 × 107 copies/μL to 9.74 copies/μL; lane 9, negative control. (K) Specificity test of the multiplex PCR: M, DNA Marker DL1000; lanes 1–3, DNA samples positive for stx1, stx2, and eaeA genes of E. coli; lane 4, C. perfringens; lane 5, Cryptosporidium; lane 6, G. duodenalis; lane 7, Eimeria; lane 8, Moniezia; lane 9, E. bieneusi; lane 10, H. contortus; lane 11, Oesophagostomum; lane 12, Salmonella; lane 13, P. mirabilis; lane 14, S. aureus; lane 15, negative control.
Figure 6. Establishment of the multiplex PCR assay. (A) Optimization of annealing temperature for the multiplex PCR targeting the stx1 and stx2 of E. coli: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (B) Optimization of primer concentration for the multiplex PCR targeting the stx1 and stx2 of E. coli: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (C) Optimization of annealing temperature for the multiplex PCR targeting the stx1, stx2, and eaeA of E. coli: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (D) Optimization of primer concentration for the multiplex PCR targeting the stx1, stx2 and eaeA of E. coli: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (E) Optimization of annealing temperature for the multiplex PCR targeting the stx1, stx2, eaeA and cpas: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (F) Optimization of primer concentration for the multiplex PCR targeting the stx1, stx2, eaeA and cpa: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (G) Optimization of annealing temperature for the multiplex PCR targeting the stx1, stx2, eaeA, cpa and 18S rRNA: M, DL1000 Marker; lanes 1–8, annealing temperature of 53.0 °C, 54.0 °C, 55.0 °C, 56.0 °C, 57.0 °C, 58.0 °C, 59.0 °C and 60.0 °C, respectively; lane 9, negative control. (H) Optimization of primer concentration for the multiplex PCR targeting the stx1, stx2, eaeA, cpa and 18S rRNA: M, DL1000 Marker; lanes 1–8, primer concentrations of 0.16 μM, 0.24 μM, 0.32 μM, 0.40 μM, 0.48 μM, 0.56 μM, 0.64 μM, and 0.72 μM, respectively; lane 9, negative control. (I) Optimization of MgCl2 concentration for the multiplex PCR targeting the stx1, stx2, eaeA, cpa and 18S rRNA: M, DL1000 Marker; lanes 1–8, MgCl2 concentrations of 0.5 mM, 1.0 mM, 1.5 mM, 2.0 mM, 2.5 mM, 3.0 mM, 3.5 mM, and 4.0 mM, respectively; lane 9, negative control. (J) Sensitivity test of the multiplex PCR: M, DNA Marker DL1000; lanes 1–8, recombinant plasmid pMD19-T-stx1 at concentrations ranging from 2.06 × 108 copies/μL to 20.6 copies/μL, recombinant plasmid pMD19-T-stx2 at concentrations ranging from 1.82 × 108 copies/μL to 18.2 copies/μL, recombinant plasmid pMD19-T-eaeA at concentrations ranging from 1.30 × 108 copies/μL to 13.0 copies/μL, recombinant plasmid pMD19-T-cpa at concentrations ranging from 1.99 × 108 copies/μL to 19.9 copies/μL, and recombinant plasmid pMD19-T-18S rRNA at concentrations ranging from 9.74 × 107 copies/μL to 9.74 copies/μL; lane 9, negative control. (K) Specificity test of the multiplex PCR: M, DNA Marker DL1000; lanes 1–3, DNA samples positive for stx1, stx2, and eaeA genes of E. coli; lane 4, C. perfringens; lane 5, Cryptosporidium; lane 6, G. duodenalis; lane 7, Eimeria; lane 8, Moniezia; lane 9, E. bieneusi; lane 10, H. contortus; lane 11, Oesophagostomum; lane 12, Salmonella; lane 13, P. mirabilis; lane 14, S. aureus; lane 15, negative control.
Biology 15 00921 g006
Biology 15 00921 g007
Figure 7. Detection of clinical samples. (A) Detection of clinical samples by multiplex PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (B) Detection of the stx1 gene of E. coli in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (C) Detection of E. coli stx2 in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (D) Detection of E. coli eaeA in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (E) Detection of C. perfringens cpa in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (F) Detection of Cryptosporidium 18S rRNA in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control.
Figure 7. Detection of clinical samples. (A) Detection of clinical samples by multiplex PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (B) Detection of the stx1 gene of E. coli in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (C) Detection of E. coli stx2 in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (D) Detection of E. coli eaeA in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (E) Detection of C. perfringens cpa in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control. (F) Detection of Cryptosporidium 18S rRNA in clinical samples by PCR: M, DNA Marker DL2000; lanes 1–20, clinical samples; lane 21, negative control.
Biology 15 00921 g007
Table 1. PCR primers for E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA.
Table 1. PCR primers for E. coli virulence genes, C. perfringens cpa and Cryptosporidium 18S rRNA.
PathogenGenePrimer NamePrimer Sequence (5′–3′)Fragment Size (bp)
E. colieaeAFTATGCTTAGTGCTGGTTTAGGA248
RCCTTCATCATTTCGCTTTCA
stx1FATTACAGACTATTTCATCAGGAGG706
RCGGACACATAGAAGGAAACTCA
stx2FGGTTTTTCTTCGGTATCCTATTC950
RCGCCATAAACATCTTCTTCATACT
C. perfringenscpaFTAGGTTCTACTTATCCAGATTATG550
RGCTGTTCCTTTTTGAGAGTTAG
Cryptosporidium18S rRNAFTTTACTTTGAGAAAATTAGAGTGCTT300
RCAATCTCTAGTTGGCATA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hou, J.-J.; Zhao, J.-Q.; Fan, Y.-Y.; Zhang, M.-Y.; Song, J.-K.; Yang, X.; Zhao, G.-H. Development of a Multiplex PCR Assay for Selected Escherichia coli Virulence Genes, Clostridium perfringens cpa and Cryptosporidium 18S rRNA in Faecal Samples from Diarrheic Dairy Calves. Biology 2026, 15, 921. https://doi.org/10.3390/biology15120921

AMA Style

Hou J-J, Zhao J-Q, Fan Y-Y, Zhang M-Y, Song J-K, Yang X, Zhao G-H. Development of a Multiplex PCR Assay for Selected Escherichia coli Virulence Genes, Clostridium perfringens cpa and Cryptosporidium 18S rRNA in Faecal Samples from Diarrheic Dairy Calves. Biology. 2026; 15(12):921. https://doi.org/10.3390/biology15120921

Chicago/Turabian Style

Hou, Jian-Jun, Jia-Qi Zhao, Ying-Ying Fan, Ming-Yi Zhang, Jun-Ke Song, Xin Yang, and Guang-Hui Zhao. 2026. "Development of a Multiplex PCR Assay for Selected Escherichia coli Virulence Genes, Clostridium perfringens cpa and Cryptosporidium 18S rRNA in Faecal Samples from Diarrheic Dairy Calves" Biology 15, no. 12: 921. https://doi.org/10.3390/biology15120921

APA Style

Hou, J.-J., Zhao, J.-Q., Fan, Y.-Y., Zhang, M.-Y., Song, J.-K., Yang, X., & Zhao, G.-H. (2026). Development of a Multiplex PCR Assay for Selected Escherichia coli Virulence Genes, Clostridium perfringens cpa and Cryptosporidium 18S rRNA in Faecal Samples from Diarrheic Dairy Calves. Biology, 15(12), 921. https://doi.org/10.3390/biology15120921

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop