Generation of Novel High-Quality Small-Grained Rice Germplasm by Targeting the OsVIN2 Gene
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. sgRNA Design and Vector Construction
2.3. Agrobacterium-Mediated Rice Transformation
2.4. Genotyping and Off-Target Analysis
2.5. Agronomic Trait Measurement
3. Results
3.1. CRISPR/Cas9 Target Site Selection for the OsVIN2 Gene
3.2. CRISPR/Cas9-Mediated Mutagenesis of OsVIN2
3.3. Putative Off-Target Analysis
3.4. Phenotypic Analysis of Grain Size in OsVIN2 Mutants
3.5. osvin2 Mutants Confer Superior Grain Quality
3.6. Agronomic Traits of osvin2 Mutants
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gong, D.; Zhang, X.; He, F.; Chen, Y.; Li, R.; Yao, J.; Zhang, M.; Zheng, W.; Yu, G. Genetic Improvements in Rice Grain Quality: A Review of Elite Genes and Their Applications in Molecular Breeding. Agronomy 2023, 13, 1375. [Google Scholar] [CrossRef] [Scilit]
- Ren, D.; Ding, C.; Qian, Q. Molecular bases of rice grain size and quality for optimized productivity. Sci. Bull. 2023, 68, 314–350. [Google Scholar] [CrossRef] [Scilit]
- Lei, B.; Shao, J.; Zhang, F.; Wang, J.; Xiao, Y.; Cheng, Z.; Tang, W.; Wan, J. Genetic analysis and fine mapping of a grain size QTL in the small-grain sterile rice line Zhuo201S. J. Integr. Agric. 2023, 23, 2155–2163. [Google Scholar] [CrossRef] [Scilit]
- Ying, J.; Qin, Y.; Zhang, F.; Duan, L.; Cheng, P.; Yin, M.; Wang, Y.; Tong, X.; Huang, J.; Li, Z.; et al. A weak allele of TGW5 enables greater seed propagation and efficient size-based seed sorting for hybrid rice production. Plant Commun. 2024, 5, 100811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, H.; Xia, D.; He, Y. Rice grain quality—Traditional traits for high quality rice and health-plus substances. Mol. Breed. 2019, 40, 1. [Google Scholar] [CrossRef] [Scilit]
- Ibarrola-Rivas, M.J.; Nonhebel, S. Regional food preferences influence environmental impacts of diets. Food Secur. 2022, 14, 1063–1083. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.; Zhao, G.; Gao, X.; Zhang, L.; Zhang, Y.; Cai, X.; Yuan, X.; Guo, X. CRISPR/Cas9 gene editing technology: A precise and efficient tool for crop quality improvement. Planta 2023, 258, 36. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Gao, L.; Luo, S.; Liu, K.; Qing, D.; Pan, Y.; Dai, G.; Deng, G.; Zhu, C. The genetic editing of GS3 via CRISPR/Cas9 accelerates the breeding of three-line hybrid rice with superior yield and grain quality. Mol. Breed. 2022, 42, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rasheed, H.; Fiaz, S.; Khan, M.A.; Mehmood, S.; Ullah, F.; Saeed, S.; Khan, S.U.; Yaseen, T.; Hussain, R.M.; Qayyum, A. Characterization of functional genes GS3 and GW2 and their effect on the grain size of various landraces of rice (Oryza sativa L.). Mol. Biol. Rep. 2022, 49, 5397–5403. [Google Scholar] [CrossRef] [Scilit]
- Usman, B.; Zhao, N.; Nawaz, G.; Qin, B.; Liu, F.; Liu, Y.; Li, R. CRISPR/Cas9 Guided Mutagenesis of Grain Size 3 Confers Increased Rice (Oryza sativa L.) Grain Length by Regulating Cysteine Proteinase Inhibitor and Ubiquitin-Related Proteins. Int. J. Mol. Sci. 2021, 22, 3225. [Google Scholar] [CrossRef] [Scilit]
- Chen, K.; Łyskowski, A.; Jaremko, Ł.; Jaremko, M. Genetic and Molecular Factors Determining Grain Weight in Rice. Front. Plant Sci. 2021, 12, 605779. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Yang, Z.; Zhou, S.; Zhu, J.; Liu, X.; Luo, J. Cellulose synthase-like OsCSLD4: A key regulator of agronomic traits, disease resistance, and metabolic indices in rice. Plant Cell Rep. 2024, 43, 264. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Ren, Y.; Wang, C.; Zhang, H.; Wang, F.; Chen, J.; Liu, X.; Zheng, T.; Cai, M.; Zeng, Z.; et al. OsVIN2 encodes a vacuolar acid invertase that affects grain size by altering sugar metabolism in rice. Plant Cell Rep. 2019, 38, 1273–1290. [Google Scholar] [CrossRef] [Scilit]
- Deng, X.; Han, X.; Yu, S.; Liu, Z.; Guo, D.; He, Y.; Li, W.; Tao, Y.; Sun, C.; Xu, P.; et al. OsINV3 and Its Homolog, OsINV2, Control Grain Size in Rice. Int. J. Mol. Sci. 2020, 21, 2199. [Google Scholar] [CrossRef] [Scilit]
- Morey, S.R.; Hirose, T.; Hashida, Y.; Miyao, A.; Hirochika, H.; Ohsugi, R.; Yamagishi, J.; Aoki, N. Genetic Evidence for the Role of a Rice Vacuolar Invertase as a Molecular Sink Strength Determinant. Rice 2018, 11, 6. [Google Scholar] [CrossRef] [Scilit]
- Zhang, A.; Gao, Y.; Li, Y.; Ruan, B.; Yang, S.; Liu, C.; Zhang, B.; Jiang, H.; Fang, G.; Ding, S.; et al. Genetic Analysis for Cooking and Eating Quality of Super Rice and Fine Mapping of a Novel Locus qGC10 for Gel Consistency. Front. Plant Sci. 2020, 11, 342. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Wang, J.; Huang, L.; Kan, L.; Wang, C.; Xiong, M.; Zhou, P.; Zhou, L.; Chen, C.; Zhao, D.; et al. ABA-mediated regulation of rice grain quality and seed dormancy via the NF-YB1-SLRL2-bHLH144 Module. Nat. Commun. 2024, 15, 4493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, C.; Du, Y.; Zeng, M.; Deng, X.; Zhang, Z.; Liu, D.; Zeng, Y. Relationship between Chalkiness and the Structural and Physicochemical Properties of Rice Starch at Different Nighttime Temperatures during the Early Grain-Filling Stage. Foods 2024, 13, 1516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Zheng, J.; Xie, H.; Luo, J.; Huang, X.; Deng, Z.; Wu, L. Breeding the new rice restorer line Minghui 86 and its hybrid combinations. J. Plant Genet. Resour. 2001, 1, 32–36. [Google Scholar]
- Xie, H.; Wu, F.; Zhang, J.; Xie, H. Application of indica restorer line Minghui86 for super hybrid Rice. Fujian J. Agric. Sci. 2013, 28, 397–404. [Google Scholar]
- Ma, T.; Wang, Q.; Wu, T.; Hao, Q.; Huang, Y.; Mou, C.; Miao, R.; Lan, J.; Zhang, F.; Wang, P.; et al. Quiescin Sulfhydryl Oxidase-Like 1 Positively Regulates Seed Dormancy in Rice. Plant Biotechnol. J. 2025. ahead of print. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Ding, Y.; Zhou, Y.; Jin, W.; Xie, K.; Chen, L. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Mol. Plant 2017, 10, 530–532. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y.; et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hiei, Y.; Ohta, S.; Komari, T.; Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6, 271–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allen, G.C.; Flores-Vergara, M.A.; Krasynanski, S.; Kumar, S.; Thompson, W.F. A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat. Protoc. 2006, 1, 2320–2325. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Li, X.; Lian, H.; Ni, D.; He, Y.; Chen, X.; Ruan, Y. Evidence that high activity of vacuolar invertase is required for cotton fiber and Arabidopsis root elongation through osmotic dependent and independent pathways, respectively. Plant Physiol. 2010, 154, 744–756. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Variety | No. of Transgenic Plants | No. of Plants with Mutations (%) | No. of Homozygous Mutants (%) | No. of Biallelic Mutants (%) | No. of Heterozygous Mutants (%) |
|---|---|---|---|---|---|
| MH86 | 30 | 18 (60) | 5 (16.6) | 6 (20.0) | 7 (23.3) |
| Target | Name of Putative Off-Target Sites | Putative Off-Target Locus | Putative Off-Target Sequence | No. of Mismatch Bases | No. of Plants Examined | No. of Indel Mutations |
|---|---|---|---|---|---|---|
| sgRNA | OFF1 | chr01: 24753948 | TGGTCGTCTTCTCCGGCGTC GGG | 3 | 5 | 0 |
| OFF2 | chr02: 21042203 | TGAAGGTGCTCTCCGGCGTC AGG | 3 | 5 | 0 | |
| OFF3 | chr01: 22880578 | CGGCGATCCACTCCGGCGCC AGG | 4 | 5 | 0 | |
| OFF4 | chr03: 35220013 | TGGCGGTGGTCGCCGACGTC AGG | 4 | 5 | 0 | |
| OFF5 | chr09: 15493407 | TGCTCGTCCTCTTCGGCGTC AGG | 4 | 5 | 0 | |
| OFF6 | Chr01: 26653040 | GGGAGGTCCTCGCCGGCGAC AGG | 4 | 5 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Chen, X.; Lin, Y.; Xi, X.; Yang, S.; Wu, S.; Qian, H.; Wu, M.; Hu, T.; Mei, F.; Zheng, M.; et al. Generation of Novel High-Quality Small-Grained Rice Germplasm by Targeting the OsVIN2 Gene. Biology 2026, 15, 64. https://doi.org/10.3390/biology15010064
Chen X, Lin Y, Xi X, Yang S, Wu S, Qian H, Wu M, Hu T, Mei F, Zheng M, et al. Generation of Novel High-Quality Small-Grained Rice Germplasm by Targeting the OsVIN2 Gene. Biology. 2026; 15(1):64. https://doi.org/10.3390/biology15010064
Chicago/Turabian StyleChen, Xi, Yarong Lin, Xiangzhe Xi, Shaohua Yang, Shiyu Wu, Hongge Qian, Mingji Wu, Taijiao Hu, Fating Mei, Mengyan Zheng, and et al. 2026. "Generation of Novel High-Quality Small-Grained Rice Germplasm by Targeting the OsVIN2 Gene" Biology 15, no. 1: 64. https://doi.org/10.3390/biology15010064
APA StyleChen, X., Lin, Y., Xi, X., Yang, S., Wu, S., Qian, H., Wu, M., Hu, T., Mei, F., Zheng, M., Shi, C., & Zhu, Y. (2026). Generation of Novel High-Quality Small-Grained Rice Germplasm by Targeting the OsVIN2 Gene. Biology, 15(1), 64. https://doi.org/10.3390/biology15010064

