Time-Restricted Feeding Affects Energy Metabolism in Lactating Striped Hamsters (Cricetulus barabensis, Cricetidae, Rodentia)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Experimental Design
2.3. Measurement of Mother Body Mass, Litter Body Mass, and Dietary Intake
2.4. Measurement of Metabolic Rate
2.5. Body Tissues and Organs
2.6. Melatonin Measurement
2.7. Measurement of Carcass Fat Content
2.8. Real-Time PCR
2.9. Oroboros O2K Analysis of Mitochondrial Energy Metabolism in Tissues
2.10. 16S rDNA Gene Sequencing Analysis
2.11. Western Blotting
2.12. Statistical Analysis
3. Results
3.1. Body Mass, Food Intake, and Metabolic Rate in Lactating Striped Hamster

3.2. Litter Size and Litter Mass
3.3. Expression of Neuropeptides Involved in Feeding Regulation
3.4. Organ Weight
3.5. Serum Melatonin Levels
3.6. Mitochondrial Respiration
3.7. Gut Microbiota
3.8. Rhythmic Protein Expression in Liver
4. Discussion
4.1. Lactation Significantly Increased the Level of Energy Budget in Striped Hamsters
4.2. TRF Manipulation Reduced the Energy Budget and Litter Survival of Lactating Hamsters
4.3. Phase-Specific Effects of TRF Manipulation
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- Teeple, K.; Rajput, P.; Gonzalez, M.; Han-Hallett, Y.; Fernández-Juricic, E.; Casey, T. High fat diet induces obesity, alters eating pattern and disrupts corticosterone circadian rhythms in female ICR mice. PLoS ONE 2023, 18, e0279209. [Google Scholar] [CrossRef]
- Muñoz Alférez, M.J.; Robles Rebollo, M.; Moreno-Fernández, J.; Díaz Castro, J.; López Aliaga, M.I. Effect of fermented goat milk on body composition, basal metabolism, and food intake control in rats. Nutr. Hosp. 2020, 37, 123–128. [Google Scholar]
- Hatori, M.; Vollmers, C.; Zarrinpar, A.; DiTacchio, L.; Bushong, E.A.; Gill, S.; Leblanc, M.; Chaix, A.; Joens, M.; Fitzpatrick, J.A.; et al. Time-restricted feeding without reducing caloric intake prevents metabolic diseases in mice fed a high-fat diet. Cell Metab. 2012, 15, 848–860. [Google Scholar] [CrossRef]
- Bae, S.A.; Fang, M.Z.; Rustgi, V.; Zarbl, H.; Androulakis, I.P. At the interface of lifestyle, behavior, and circadian rhythms: Metabolic implications. Front. Nutr. 2019, 6, 132. [Google Scholar] [CrossRef]
- Hepler, C.; Weidemann, B.J.; Waldeck, N.J.; Marcheva, B.; Cedernaes, J.; Thorne, A.K.; Kobayashi, Y.; Nozawa, R.; Newman, M.V.; Gao, P.; et al. Time-restricted feeding mitigates obesity through adipocyte thermogenesis. Science 2022, 378, 276–284. [Google Scholar] [CrossRef]
- Goede, P.; Wüst, R.C.I.; Schomakers, B.V.; Denis, S.; Vaz, F.M.; Pras-Raves, M.L.; Weeghel, M.; Yi, C.X.; Kalsbeek, A.; Houtkooper, R.H. Time-restricted feeding during the inactive phase abolishes the daily rhythm in mitochondrial respiration in rat skeletal muscle. FASEB J. 2022, 36, e22133. [Google Scholar] [CrossRef] [PubMed]
- Andreychev, A.V. Daily and seasonal feeding activity of the greater mole-rat (Spalax microphthalmus, Rodentia, Spalacidae). Biol. Bull. Russ. Acad. Sci. 2019, 46, 1172–1181. [Google Scholar] [CrossRef]
- Schilperoort, M.; Van Den Berg, R.; Dollé, M.E.T.; van Oostrom, C.T.M.; Wagner, K.; Tambyrajah, L.L.; Wackers, P.; Deboer, T.; Hulsegge, G.; Proper, K.I.; et al. Time-restricted feeding improves adaptation to chronically alternating light-dark cycles. Sci. Rep. 2019, 9, 7874. [Google Scholar] [CrossRef]
- Ramanathan, C.; Johnson, H.; Sharma, S.; Son, W.; Puppa, M.; Rohani, S.N.; Tipirneni-Sajja, A.; Bloomer, R.J.; Van Der Merwe, M. Early time-restricted feeding amends circadian clock function and improves metabolic health in male and female nile grass rats. Medicines 2022, 9, 15. [Google Scholar] [CrossRef]
- Sanetra, A.M.; Palus-Chramiec, K.; Chrobok, L.; Jeczmien-Lazur, J.S.; Gawron, E.; Klich, J.D.; Pradel, K.; Lewandowski, M.H. High-fat-diet-evoked disruption of the rat dorsomedial hypothalamic clock can be prevented by restricted nighttime feeding. Nutrients 2022, 14, 5034. [Google Scholar] [CrossRef]
- Yang, L.; Wang, X.Z.; Wang, C.Z.; Wang, D.H.; Wang, Z.S.; Zhang, X.Y. Time-restricted feeding modulates gene expression related with rhythm and inflammation in Mongolian gerbils. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2025, 287, 110038. [Google Scholar] [CrossRef]
- Chawla, S.; Beretoulis, S.; Deere, A.; Radenkovic, D. The window matters: A systematic review of time restricted eating strategies in relation to cortisol and melatonin secretion. Nutrients 2021, 13, 2525. [Google Scholar] [CrossRef]
- Chaix, A.; Lin, T.; Ramms, B.; Cutler, R.G.; Le, T.; Lopez, C.; Miu, P.; Pinto, A.F.M.; Saghatelian, A.; Playford, M.P.; et al. Time-restricted feeding reduces atherosclerosis in LDLR KO mice but not in ApoE knockout mice. Arterioscler. Thromb. Vasc. Biol. 2024, 44, 2069–2087. [Google Scholar] [CrossRef]
- He, Z.; Yang, H.; Mao, Y. Time-restricted feeding changes as inspiration for drug design. Curr. Pharm. Des. 2023, 29, 559–561. [Google Scholar] [CrossRef] [PubMed]
- Wu, U.I.; Mai, F.D.; Sheu, J.N.; Chen, L.Y.; Liu, Y.T.; Huang, H.C.; Chang, H.M. Melatonin inhibits microglial activation, reduces pro-inflammatory cytokine levels, and rescues hippocampal neurons of adult rats with acute Klebsiella pneumoniae meningitis. J. Pineal Res. 2011, 50, 159–170. [Google Scholar] [CrossRef] [PubMed]
- Wehrens, S.M.T.; Christou, S.; Isherwood, C.; Middleton, B.; Gibbs, M.A.; Archer, S.N.; Skene, D.J.; Johnston, J.D. Meal timing regulates the human circadian system. Curr. Biol. 2017, 27, 1768–1775.e1763. [Google Scholar] [CrossRef] [PubMed]
- Vitaterna, M.H.; Selby, C.P.; Todo, T.; Niwa, H.; Thompson, C.; Fruechte, E.M.; Hitomi, K.; Thresher, R.J.; Ishikawa, T.; Miyazaki, J.; et al. Differential regulation of mammalian Period genes and circadian rhythmicity by cryptochromes 1 and 2. Proc. Natl. Acad. Sci. USA 1999, 96, 12114–12119. [Google Scholar] [CrossRef]
- Shimba, S.; Ishii, N.; Ohta, Y.; Ohno, T.; Watabe, Y.; Hayashi, M.; Wada, T.; Aoyagi, T.; Tezuka, M. Brain and muscle Arnt-like protein-1 (BMAL1), a component of the molecular clock, regulates adipogenesis. Proc. Natl. Acad. Sci. USA 2005, 102, 12071–12076. [Google Scholar] [CrossRef]
- Yin, L.; Wu, N.; Lazar, M.A. Nuclear receptor rev-erbα: A heme receptor that coordinates circadian rhythm and metabolism. Nucl. Recept. Signal. 2010, 8, e001. [Google Scholar] [CrossRef]
- Nießner, C.; Denzau, S.; Malkemper, E.P.; Gross, J.C.; Burda, H.; Winklhofer, M.; Peichl, L. Cryptochrome 1 in retinal cone photoreceptors suggests a novel functional role in mammals. Sci. Rep. 2016, 6, 21848. [Google Scholar] [CrossRef]
- Stokkan, K.A.; Yamazaki, S.; Tei, H.; Sakaki, Y.; Menaker, M. Entrainment of the circadian clock in the liver by feeding. Science 2001, 291, 490–493. [Google Scholar] [CrossRef] [PubMed]
- Leone, V.; Gibbons, S.M.; Martinez, K.; Hutchison, A.L.; Huang, E.Y.; Cham, C.M.; Pierre, J.F.; Heneghan, A.F.; Nadimpalli, A.; Hubert, N.; et al. Effects of diurnal variation of gut microbes and high-fat feeding on host circadian clock function and metabolism. Cell Host Microbe 2015, 17, 681–689. [Google Scholar] [CrossRef]
- Chaix, A.; Lin, T.; Le, H.D.; Chang, M.W.; Panda, S. Time-restricted feeding prevents obesity and metabolic syndrome in mice lacking a circadian clock. Cell. Metab. 2019, 29, 303–319.e304. [Google Scholar] [CrossRef]
- Mieda, M.; Sakurai, T. Bmal1 in the nervous system is essential for normal adaptation of circadian locomotor activity and food intake to periodic feeding. J. Neurosci. 2011, 31, 15391–15396. [Google Scholar] [CrossRef]
- Costello, H.M.; Crislip, G.R.; Cheng, K.Y.; Lynch, I.J.; Juffre, A.; Bratanatawira, P.; Mckee, A.; Thelwell, R.S.; Mendez, V.M.; Wingo, C.S.; et al. Adrenal-specific KO of the circadian clock protein BMAL1 alters blood pressure rhythm and timing of eating behavior. Function 2023, 4, zqad001. [Google Scholar] [CrossRef]
- Wen, J.; Li, W.; Bo, T.; Ding, B.; Zhang, X.; Wang, D. Involvement of the gut microbiota in the metabolic phenotypes of two sympatric gerbils. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2024, 297, 111710. [Google Scholar] [CrossRef]
- Thaiss, C.A.; Zeevi, D.; Levy, M.; Zilberman-Schapira, G.; Suez, J.; Tengeler, A.C.; Abramson, L.; Katz, M.N.; Korem, T.; Zmora, N.; et al. Transkingdom control of microbiota diurnal oscillations promotes metabolic homeostasis. Cell 2014, 159, 514–529. [Google Scholar] [CrossRef]
- Voigt, R.M.; Forsyth, C.B.; Green, S.J.; Engen, P.A.; Keshavarzian, A. Circadian rhythm and the gut microbiome. Int. Rev. Neurobiol. 2016, 131, 193–205. [Google Scholar] [CrossRef]
- Zhang, L.; Xue, X.; Zhai, R.; Yang, X.; Li, H.; Zhao, L.; Zhang, C. Timing of calorie restriction in mice impacts host metabolic phenotype with correlative changes in gut microbiota. mSystems 2019, 4, e00348-19. [Google Scholar] [CrossRef]
- Cui, Y.; Li, S.; Yin, Y.; Li, X.; Li, X. Daytime restricted feeding promotes circadian desynchrony and metabolic disruption with changes in bile acids profiles and gut microbiota in C57BL/6 Male Mice. J. Nutr. Biochem. 2022, 109, 109121. [Google Scholar] [CrossRef]
- Zhao, Z.J. Energy budget during lactation in striped hamsters at different ambient temperatures. J. Exp. Biol. 2011, 214, 988–995. [Google Scholar] [CrossRef]
- Italianer, M.F.; Naninck, E.F.G.; Roelants, J.A.; Van Der Horst, G.T.J.; Reiss, I.K.M.; Goudoever, J.B.V.; Joosten, K.F.M.; Chaves, I.; Vermeulen, M.J. Circadian variation in human milk composition, a systematic review. Nutrients 2020, 12, 2328. [Google Scholar] [CrossRef]
- Sabau, R.M.; Ferkin, M.H. Food restriction affects the maternal behavior provided by female meadow voles (Microtus pennsylvanicus). J. Mammal. 2013, 94, 1068–1076. [Google Scholar] [CrossRef]
- Fujisaki, M.; Nakamura, A.; Muroi, Y.; Ishii, T. Oxytocin in the dorsal raphe nucleus antagonizes the inhibition of maternal care induced by food deprivation. Horm. Behav. 2020, 124, 104773. [Google Scholar] [CrossRef] [PubMed]
- Casey, T.M.; Crodian, J.; Erickson, E.; Kuropatwinski, K.K.; Gleiberman, A.S.; Antoch, M.P. Tissue-specific changes in molecular clocks during the transition from pregnancy to lactation in mice. Biol. Reprod. 2014, 90, 127. [Google Scholar] [CrossRef]
- Xie, X.; Kukino, A.; Calcagno, H.E.; Berman, A.M.; Garner, J.P.; Butler, M.P. Natural food intake patterns have little synchronizing effect on peripheral circadian clocks. BMC Biol. 2020, 18, 160. [Google Scholar] [CrossRef] [PubMed]
- Aung, O.; Weber, E.T. Differential effects of time-restricted feeding on circadian locomotor activity, food intake and body weight gain in BALB/cJ and C57BL/6J mice. Biol. Rhythm Res. 2022, 53, 1523–1538. [Google Scholar] [CrossRef]
- Ye, Z.; Huang, K.; Dai, X.; Gao, D.; Gu, Y.; Qian, J.; Zhang, F.; Zhai, Q. Light-phase time-restricted feeding disrupts the muscle clock and insulin sensitivity yet potentially induces muscle fiber remodeling in mice. Heliyon 2024, 10, e37475. [Google Scholar] [CrossRef]
- Leng, H.; Thijs, T.; Desmet, L.; Vanotti, G.; Farhadipour, M.; Depoortere, I. Time-restricted feeding reinforces gut rhythmicity by restoring rhythms in intestinal metabolism in a jetlag mouse model. Cell. Mol. Gastroenterol. Hepatol. 2025, 19, 101440. [Google Scholar] [CrossRef]
- Song, Z.G.; Wang, D.H. Metabolism and thermoregulation in the striped hamster Cricetulus barabensis. J. Therm. Biol. 2003, 28, 509–514. [Google Scholar] [CrossRef]
- Wen, J.; Tan, S.; Qiao, Q.; Shi, L.; Huang, Y.; Zhao, Z. Strategies of behavior, energetic and thermogenesis of striped hamsters in response to food deprivation. Integr. Zool. 2018, 13, 70–83. [Google Scholar] [CrossRef]
- Zhu, H.; Wu, M.; Mou, J.; Yang, X.; Xu, Q.; Zhang, Y.; Zhang, H.; Wang, X.; Xue, H.; Xu, J.; et al. Behavior and physiology in female Cricetulus barabensis are associated with the expression of circadian genes. Front. Endocrinol. Lausanne 2024, 14, 1281617. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Zhang, K.; Du, Y.; Cao, J.; Zhao, Z.J. The energy budget and reproductive performance of striped hamsters in response to variations in food quality. J. Zool. 2025, 326, 173–184. [Google Scholar] [CrossRef]
- Firth, N.L.; Ross, D.A.; Thonney, M.L. Comparison of ether and chloroform for Soxhlet extraction of freeze-dried animal tissues. J. Assoc. Off. Anal. Chem. 1985, 68, 1228–1231. [Google Scholar] [CrossRef] [PubMed]
- Wen, J.; Bo, T.; Zhang, X.; Wang, Z.; Wang, D. Thermo-TRPs and gut microbiota are involved in thermogenesis and energy metabolism during low temperature exposure of obese mice. J. Exp. Biol. 2020, 223, 218974. [Google Scholar] [CrossRef]
- Marco, A.; Kisliouk, T.; Tabachnik, T.; Meiri, N.; Weller, A. Overweight and CpG methylation of the Pomc promoter in offspring of high-fat-diet-fed dams are not “reprogrammed” by regular chow diet in rats. FASEB J. 2014, 28, 4148–4157. [Google Scholar] [CrossRef]
- Ladyman, S.R.; Carter, K.M.; Grattan, D.R. Energy homeostasis and running wheel activity during pregnancy in the mouse. Physiol. Behav. 2018, 194, 83–94. [Google Scholar] [CrossRef]
- Brogan, R.S.; Grove, K.L.; Smith, M.S. Differential regulation of leptin receptor but not orexin in the hypothalamus of the lactating rat. J. Neuroendocrinol. 2000, 12, 1077–1086. [Google Scholar] [CrossRef]
- Liu, W.; Liao, S.S.; Bao, M.H.; Huo, D.L.; Cao, J.; Zhao, Z.J. Lactating striped hamsters (Cricetulus barabensis) do not decrease the thermogenic capacity to cope with extreme cold temperature. Zoology 2024, 166, 126195. [Google Scholar] [CrossRef]
- Xu, Y.C.; Yang, D.B.; Wang, D.H. No evidence for a trade-off between reproductive investment and immunity in a rodent. PLoS ONE 2012, 7, e37182. [Google Scholar] [CrossRef]
- Zhu, W.; Wang, Z. Resting metabolic rate and energetics of reproduction in lactating Eothenomys miletus from Hengduan mountain region. Zool. Stud. 2014, 53, 41. [Google Scholar] [CrossRef]
- Yang, D.B.; Li, L.; Wang, L.P.; Chi, Q.S.; Hambly, C.; Wang, D.H.; Speakman, J.R. Limits to sustained energy intake. XIX. A test of the heat dissipation limitation hypothesis in Mongolian gerbils (Meriones unguiculatus). J. Exp. Biol. 2013, 216, 3358–3368. [Google Scholar] [CrossRef] [PubMed]
- Hammond, K.A.; Lam, M.; Lloyd, K.C.; Diamond, J. Simultaneous manipulation of intestinal capacities and nutrient loads in mice. Am. J. Physiol.-Gastr. L. 1996, 271, G969–G979. [Google Scholar] [CrossRef]
- Volk, N.; Lacy, B. Anatomy and physiology of the small bowel. Gastrointest. Endosc. Clin. N. Am. 2017, 27, 1–13. [Google Scholar] [CrossRef]
- Ladyman, S.R.; Khant Aung, Z.; Grattan, D.R. Impact of pregnancy and lactation on the long-term regulation of energy balance in female mice. Endocrinology 2018, 159, 2324–2336. [Google Scholar] [CrossRef]
- Gamo, Y.; Troup, C.; Mitchell, S.; Hambly, C.; Vaanholt, L.; Speakman, J.R. Limits to sustained energy intake. XX. body temperatures and physical activity of female mice during lactation. J. Exp. Biol. 2013, 216, 3751–3761. [Google Scholar] [CrossRef]
- Rogowitz, G.L. Trade-offs in energy allocation during lactation. Am. Zool. 1996, 36, 197–204. [Google Scholar] [CrossRef]
- Montano, M.E.; Molpeceres, V.; Mauriz, J.L.; Garzo, E.; Cruz, I.B.; González, P.; Barrio, J.P. Effect of melatonin supplementation on food and water intake in streptozotocin-diabetic and non-diabetic male Wistar rats. Nutr. Hosp. 2010, 25, 931–938. [Google Scholar]
- López, A.; García, J.A.; Escames, G.; Venegas, C.; Ortiz, F.; López, L.C.; Acuña-Castroviejo, D. Melatonin protects the mitochondria from oxidative damage reducing oxygen consumption, membrane potential, and superoxide anion production. J. Pineal Res. 2009, 46, 188–198. [Google Scholar] [CrossRef]
- Cano-Barquilla, P.; Jiménez-Ortega, V.; Fernández-Mateos, P.; Virto, L.; Maldonado Bautista, E.; Perez-Miguelsanz, J.; Esquifino, A.I. Daily Lipolysis Gene Expression in Male Rat Mesenteric Adipose Tissue: Obesity and Melatonin Effects. Int. J. Mol. Sci. 2025, 26, 577. [Google Scholar] [CrossRef]
- Fernández Vázquez, G.; Reiter, R.J.; Agil, A. Melatonin increases brown adipose tissue mass and function in Zücker diabetic fatty rats: Implications for obesity control. J. Pineal Res. 2018, 64, e12472. [Google Scholar] [CrossRef]
- De Souza, M.C.; Agneis, M.L.G.; das Neves, K.A.; de Almeida, M.R.; Feltran, G.D.S.; Souza Cruz, E.M.; Schoffen, J.P.F.; Chuffa, L.G.A.; Seiva, F.R.F. Melatonin Improves Lipid Homeostasis, Mitochondrial Biogenesis, and Antioxidant Defenses in the Liver of Prediabetic Rats. Int. J. Mol. Sci. 2025, 26, 4652. [Google Scholar] [CrossRef]
- Vasey, C.; McBride, J.; Penta, K. Circadian rhythm dysregulation and restoration: The role of melatonin. Nutrients 2021, 13, 3480. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Cao, X.; Zhang, K.; Pan, M.; Wu, Y.; Langda, S.; Yang, Y.; Chen, Y.; Gui, B.; Ma, B. 16S rRNA gene Sequencing revealed changes in gut microbiota composition during pregnancy and lactation in mice model. Vet. Sci. 2022, 9, 169. [Google Scholar] [CrossRef] [PubMed]
- Magne, F.; Gotteland, M.; Gauthier, L.; Zazueta, A.; Pesoa, S.; Navarrete, P.; Balamurugan, R. The firmicutes/bacteroidetes ratio: A relevant marker of gut dysbiosis in obese patients? Nutrients 2020, 12, 1474. [Google Scholar] [CrossRef]
- Koch, A.A.; Bagnall, J.S.; Smyllie, N.J.; Begley, N.; Adamson, A.D.; Fribourgh, J.L.; Spiller, D.G.; Meng, Q.J.; Partch, C.L.; Strimmer, K.; et al. Quantification of protein abundance and interaction defines a mechanism for operation of the circadian clock. eLife 2022, 11, e73976. [Google Scholar] [CrossRef]
- Laermans, J.; Vancleef, L.; Tack, J.; Depoortere, I. Role of the clock gene Bmal1 and the gastric ghrelin-secreting cell in the circadian regulation of the ghrelin-GOAT system. Sci. Rep. 2015, 5, 16748. [Google Scholar] [CrossRef]
- La Fleur, S.E.; Blancas-Velazquez, A.S.; Stenvers, D.J.; Kalsbeek, A. Circadian influences on feeding behavior. Neuropharmacology 2024, 256, 110007. [Google Scholar] [CrossRef]
- Sen, S.; Dumont, S.; Sage-Ciocca, D.; Reibel, S.; De Goede, P.; Kalsbeek, A.; Challet, E. Expression of the clock gene Rev-erbα in the brain controls the circadian organisation of food intake and locomotor activity, but not daily variations of energy metabolism. J. Neuroendocrinol. 2018, 30, e12557. [Google Scholar] [CrossRef]
- Passos, M.C.F.; Ramos, C.F.; Moura, E.G. Short and long term effects of malnutrition in rats during lactation on the body weight of offspring. Nutr. Res. 2000, 20, 1603–1612. [Google Scholar] [CrossRef]
- Bao, M.H.; Chen, L.B.; Hambly, C.; Speakman, J.R.; Zhao, Z.J. Exposure to hot temperatures during lactation stunted offspring growth and decreased the future reproductive performance of female offspring. J. Exp. Biol. Jeb. 2020, 223, 223560. [Google Scholar] [CrossRef]
- Bumgarner, J.R.; Nelson, R.J. Light at night and disrupted circadian rhythms alter physiology and behavior. Integr. Comp. Biol. 2021, 61, 1160–1169. [Google Scholar] [CrossRef] [PubMed]
- Forsum, E.; Hillman, P.E.; Nesheim, M.C. Effect of energy restriction on total heat production, basal metabolic rate, and specific dynamic action of food in rats. J. Nutr. 1981, 111, 1691–1697. [Google Scholar] [CrossRef] [PubMed]
- Hambly, C.; Speakman, J.R. Contribution of different mechanisms to compensation for energy restriction in the mouse. Obes. Res. 2005, 13, 1548–1557. [Google Scholar] [CrossRef]
- Pontzer, H.; McGrosky, A. Balancing growth, reproduction, maintenance, and activity in evolved energy economies. Curr. Biol. 2022, 32, R709–R719. [Google Scholar] [CrossRef]
- Fu, M.; Zhang, L.; Ahmed, A.; Plaut, K.; Haas, D.M.; Szucs, K.; Casey, T.M. Does circadian disruption play a role in the metabolic–hormonal link to delayed lactogenesis II? Front. Nutr. 2015, 2, 4. [Google Scholar] [CrossRef]
- Ogunlusi, O.; Sarkar, M.; Chakrabarti, A.; Boland, D.J.; Nguyen, T.; Sampson, J.; Nguyen, C.; Fails, D.; Jones-Hall, Y.; Fu, L.; et al. Disruption of circadian clock induces abnormal mammary morphology and aggressive basal tumorigenesis by enhancing LILRB4 signaling. bioRxiv 2024. [Google Scholar] [CrossRef]
- Zhao, Z.J.; Hambly, C.; Shi, L.L.; Bi, Z.Q.; Cao, J.; Speakman, J.R. Late lactation in small mammals is a critically sensitive window of vulnerability to elevated ambient temperature. Proc. Natl. Acad. Sci. USA 2020, 117, 24352–24358. [Google Scholar] [CrossRef]
- Daddi, L.; Dorsett, Y.; Geng, T.; Bokoliya, S.; Yuan, H.; Wang, P.; Xu, W.; Zhou, Y. Baseline Gut Microbiome Signatures Correlate with Immunogenicity of SARS-CoV-2 mRNA Vaccines. Int. J. Mol. Sci. 2023, 24, 11703. [Google Scholar] [CrossRef]
- Zhou, H.; Huang, D.; Sun, Z.; Chen, X. Effects of intestinal desulfovibrio bacteria on host health and its potential regulatory strategies: A review. Microbiol. Res. 2024, 284, 127725. [Google Scholar] [CrossRef]
- Milhem, F.; Skates, E.; Wilson, M.; Komarnytsky, S. Obesity-Resistant Mice on a High-Fat Diet Display a Distinct Phenotype Linked to Enhanced Lipid Metabolism. Nutrients 2024, 16, 171. [Google Scholar] [CrossRef]
- Tojo, R.; Suárez, A.; Clemente, M.G.; de los Reyes-Gavilán, C.G.; Margolles, A.; Gueimonde, M.; Ruas-Madiedo, P. Intestinal microbiota in health and disease: Role of bifidobacteria in gut homeostasis. World J. Gastroenterol. 2014, 20, 15163–15176. [Google Scholar] [CrossRef]
- Dodt, S.; Widdershooven, N.V.; Dreisow, M.L.; Weiher, L.; Steuernagel, L.; Wunderlich, F.T.; Brüning, J.C.; Fenselau, H. NPY-mediated synaptic plasticity in the extended amygdala prioritizes feeding during starvation. Nat. Commun. 2024, 15, 5439. [Google Scholar] [CrossRef] [PubMed]
- De Solis, A.J.; Del Río-Martín, A.; Radermacher, J.; Chen, W.; Steuernagel, L.; Bauder, C.A.; Eggersmann, F.R.; Morgan, D.A.; Cremer, A.L.; Sué, M.; et al. Reciprocal activity of AgRP and POMC neurons governs coordinated control of feeding and metabolism. Nat. Metab. 2024, 6, 473–493. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.L.; Wang, Z.K. Seasonal changes in body mass, serum leptin levels and hypothalamic neuropeptide gene expression in male Eothenomys olitor. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2015, 184, 83–89. [Google Scholar] [CrossRef]
- Reghunandanan, V. Functional interactions between neurotransmitters and neuropeptides in regulating suprachiasmatic nucleus function and circadian rhythms. Explor. Neurosci. 2024, 3, 434–477. [Google Scholar] [CrossRef]
- Mendoza, J. Brain circadian clocks timing the 24h rhythms of behavior. npj Biol. Timing Sleep 2025, 2, 13. [Google Scholar] [CrossRef]








| Gene | Primers (5′ to 3′) |
|---|---|
| Actin (forward) | AAAGACCTCTATGCCAACA |
| Actin (reverse) | ACATCTGCTGGAAGGTGG |
| NPY (forward) | ACCCTCGCTCTGTCCCTG |
| NPY (reverse) | AATCAGTGTCTCAGGGCTA |
| AgRP (forward) | TGTTCCCAGAGTTCCCAGGTC |
| AgRP (reverse) | ATTGAAGAAGCGGCAGTAGCAC |
| CART (forward) | TACCTTTGCTGGGTGCCG |
| CART (reverse) | AAGTTCCTCGGGGACAGT |
| POMC (forward) | GGTGGGCAAGAAGCGACG |
| POMC(reverse) | CTTGTCCTTGGGCGGGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, W.; Dong, X.; He, J.; Jin, X.; Yin, B.; Bo, T.; Wen, J. Time-Restricted Feeding Affects Energy Metabolism in Lactating Striped Hamsters (Cricetulus barabensis, Cricetidae, Rodentia). Biology 2025, 14, 1261. https://doi.org/10.3390/biology14091261
Li W, Dong X, He J, Jin X, Yin B, Bo T, Wen J. Time-Restricted Feeding Affects Energy Metabolism in Lactating Striped Hamsters (Cricetulus barabensis, Cricetidae, Rodentia). Biology. 2025; 14(9):1261. https://doi.org/10.3390/biology14091261
Chicago/Turabian StyleLi, Wenting, Xinyuan Dong, Jiachen He, Xiaojie Jin, Binxin Yin, Tingbei Bo, and Jing Wen. 2025. "Time-Restricted Feeding Affects Energy Metabolism in Lactating Striped Hamsters (Cricetulus barabensis, Cricetidae, Rodentia)" Biology 14, no. 9: 1261. https://doi.org/10.3390/biology14091261
APA StyleLi, W., Dong, X., He, J., Jin, X., Yin, B., Bo, T., & Wen, J. (2025). Time-Restricted Feeding Affects Energy Metabolism in Lactating Striped Hamsters (Cricetulus barabensis, Cricetidae, Rodentia). Biology, 14(9), 1261. https://doi.org/10.3390/biology14091261

