Next Article in Journal
Establishment of Novel Simple Sequence Repeat Markers in Phragmites australis and Application in Wetlands of Nanhui Dongtan, Shanghai
Previous Article in Journal
Caffeine Supplementation Is Beneficial for the Pulling Performance of Indoor Tug-of-War Athletes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 14
Issue 4
10.3390/biology14040355
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Characterization and Phylogenetic Analysis of Babesia bigemina Isolates in Cattle from South Africa Based on BgRAP-1, BgAMA-1 and BgβTUB Genes

by
Phillip Senzo Mtshali
1 and
Moses Sibusiso Mtshali
1,2,*
1
Veterinary Parasitology Programme, Research and Scientific Services Department, National Zoological Gardens of South Africa, Pretoria 0001, South Africa
2
School of Molecular and Life Sciences, University of Limpopo, Private Bag X 1106, Sovenga, Polokwane 0727, South Africa
*
Author to whom correspondence should be addressed.
Biology 2025, 14(4), 355; https://doi.org/10.3390/biology14040355
Submission received: 13 September 2024 / Revised: 18 March 2025 / Accepted: 27 March 2025 / Published: 28 March 2025
(This article belongs to the Special Issue Tickborne Diseases and Their Vectors)
Browse Figures
Versions Notes

Simple Summary

One of the main causative agents of bovine babesiosis, a tick-borne disease that poses a serious risk to the livestock industry worldwide, including in South Africa, is Babesia bigemina. Even though bovine babesiosis has a significant economic impact on South Africa, the successful development of a single vaccine with the potential to eradicate the disease has been hampered by antigenic variation identified among B. bigemina strains worldwide. The conservation of B. bigemina genes that encode functionally significant proteins that are essential for the merozoite invasion of bovine erythrocytes is thus still poorly understood. Four nested PCR-based tests were used to genetically analyze fifty blood samples that had previously been drawn from cattle in eight provinces in South Africa for the presence of B. bigemina DNA fragments. The substantial genetic conservation reported among regional isolates of B. bigemina implies the conserved functional role of BgRAP-1 and BgAMA-1 proteins as prospective candidates that might be integrated in recombinant subunit vaccines.

Abstract

Babesia bigemina is one of the most important etiological agents of bovine babesiosis, a tick-borne disease posing a major threat in the livestock industry globally, including South Africa. Despite the huge economic impact of cattle babesiosis in South Africa, antigenic variation observed among B. bigemina strains worldwide has impeded the successful development of a single vaccine with the potential to eliminate the disease. As such, there is still a dearth of information regarding the conservation of B. bigemina genes encoding functionally important proteins that play a crucial role during the invasion of bovine erythrocytes by merozoites. Fifty blood samples previously collected from cattle in eight provinces of South Africa were genetically tested for the presence of B. bigemina DNA fragments using four nested PCR-based assays. The genes targeted coded for SpeI-AvaI restriction fragment, rhoptry-associated protein 1 (BgRAP-1), apical membrane antigen 1 (BgAMA-1) and β-tubulin (BgβTUB). PCR-generated fragments of randomly selected samples were sequenced. BLAST searches in GenBank were performed with newly determined sequences to search for homologous sequences. Neighbor-joining phylogenies were inferred from aligned, contiguous sequences of BgRAP-1, BgAMA-1 and BgβTUB genes. Nested PCR assays generated single fragments of 170 bp, 472 bp, 765 bp and 302 bp for SpeI-AvaI, BgRAP-1, BgAMA-1 and BgβTUB fragments, respectively. Of the 50 bovine samples tested by nested PCR, 82% (42/50; 95% CI = 69.2–90.2%), 68% (34/50; 95% CI = 54.2–79.2%), 50% (25/50; 95% CI = 36.6–63.4%) and 46% (23/50; 95% CI = 33.0–59.6%) possessed B. bigemina-specific SpeI-AvaI, BgRAP-1, BgAMA-1 and BgβTUB DNA fragments, respectively. The BgRAP-1, BgAMA-1 and BgβTUB sequences of South African B. bigemina isolates shared 98–100% similarity with previously reported sequences of strains originating from cattle in countries other than South Africa. The high genetic conservation observed among geographical isolates of B. bigemina suggests the conserved functional role of BgRAP-1 and BgAMA-1 proteins as potential candidates that could be incorporated in recombinant subunit vaccines.

1. Introduction

Bovine babesiosis is known as an economically important infectious disease affecting cattle in tropical and subtropical regions of the world. This disease is induced by intraerythrocytic protozoan parasites of Babesia species [1]. Babesia bovis and B. bigemina are the main etiological agents of babesiosis, a tick-borne disease causing morbidity and mortality in cattle [2]. The acute phase of babesiosis is clinically manifested by anemia, hemoglobinuria, and fever in infected cattle [3]. Animals that survive primary infections become persistently infected for life and are reservoirs for tick transmission [4]. Although the disease caused by B. bovis is more pathogenic because of its clinical manifestations, B. bigemina infection also becomes severe if it goes untreated [5]. Of both parasites, B. bigemina has the highest prevalence because it is transmitted by several tick species, including Rhipicephalus (Boophilus) microplus, R. (B.) decoloratus, and R. evertsi evertsi [6,7]. This parasite has a complex life cycle, including an asexual stage while developing in the vertebrate host and sexual reproduction in the midgut of the tick host [4,8]. Asexual reproduction occurs inside erythrocytes where infected ticks introduce protozoans when feeding on mammalian host blood. The onset of infection takes place when babesial sporozoites enter red blood cells and multiply asexually. The sexual reproduction begins when ticks take up blood containing gametocytes [9].
Microscopic examination of Giemsa-stained blood smears has always been considered a gold standard for the diagnosis of acute babesial infections. However, the low sensitivity offered by microscopy techniques does not permit the detection of parasites in subclinical infections [10]. Alternatively, serology-based assays intended for detecting antibodies reactive with Babesia species have been described. The drawbacks associated with the use of serological tests include the occurrence of cross-reactions among Babesia species and the inconsistency in discriminating between previous exposure and current infections [11,12].
The advent of DNA-based assays has made it possible to accurately diagnose B. bigemina and B. bovis parasites in cattle due to the high sensitivity and specificity of these tests. The exploitation of these specific DNA-based tests to diagnose Babesia infections is of fundamental importance in the epidemiology of tick-borne diseases. Nested PCR tests specifically designed for targeting DNA of B. bigemina and B. bovis have been described by several authors [13,14,15,16,17,18,19,20,21]. Among these, Figueroa et al. [14] developed a nested PCR assay based on the SpeI-AvaI restriction fragment, which has been widely exploited for the diagnosis of B. bigemina. Another gene that has attracted considerable interest in the diagnosis of babesial infections is the rhoptry-associated protein-1a (BgRAP-1) gene, which is secreted by rhoptries organelles participating in the success of invasion and establishment of intracellular parasitic viability [22,23]. The latter gene is characterized by five copies organized in a single genomic region [21,24]. The BgRAP-1 gene sequences of B. bigemina published in GenBank indicate that this gene is highly conserved among B. bigemina isolates originating from different countries across the globe; thus, this gene is considered a molecular marker and potent in identifying specific B. bigemina [25]. A similar observation was also the case for the B. bigemina gene coding for the apical membrane antigen (BgAMA-1); nucleotide sequences of the latter gene exhibit the highest degree of conservation among all strains sequenced to date, and their sequences were deposited in the GenBank repository [18,26]. Additionally, the β-tubulin (BgβTUB) gene has also been used in molecular diagnostics as a marker for species identification and discrimination in Theileria and Babesia parasites [27,28].
In South Africa, it is reported that the livestock industry accounts for up to 49% of the agricultural output [29], and that the tick-borne diseases in cattle are estimated to have an economic impact of USD 22 million per annum [30]. Therefore, it remains vital to establish the current status of the occurrence and geographical distribution of tick-borne parasites in cattle in order to implement efficient control strategies against cattle diseases. Of note, it has been established that the success in the development and application of recombinant vaccines against bovine babesiosis is hampered by antigenic variations observed in some parasite proteins [26]. These antigenic polymorphisms have been cited as an important route by which parasites evade the host immune response, resulting in disease outbreaks [31]. Currently, the use of acaricides and live attenuated vaccines are the only preventative measures used to control outbreaks [32]. As such, there is still a dearth of information regarding the conservation of B. bigemina genes encoding functionally important proteins that play a crucial role during the invasion of bovine erythrocytes by merozoites. It is reported in the literature that the conservation of babesial surface membrane proteins considered as potential candidate antigens may be critical for vaccine efficacy [33].
Therefore, given the huge impact of bovine babesiosis in the South African livestock industry and on the country’s economic security, the major impetus towards undertaking this study was to extend our current knowledge regarding the level and degree of sequence conservation among the field B. bigemina isolates of South African origin. In particular, the aim was to characterize the genes encoding rhoptry-associated protein 1 (BgRAP-1), apical membrane antigen 1 (BgAMA-1) and β-tubulin (BgβTUB) in B. bigemina isolates from field bovine samples. In addition, we also presented in silico bioinformatic analyses of sequences generated in this study against those from other countries published in GenBank.

2. Materials and Methods

2.1. Blood Samples

Fifty blood samples were randomly selected to validate nested PCR assays developed in this study. These samples form part of the sample collection of the Veterinary Parasitology Programme of the National Zoological Gardens of South Africa (NZG) and were previously collected from clinically healthy cattle across different locations in eight provinces of South Africa. Information on the vaccination status, age groups, husbandry practices and tick infestation status were not available at the time of sampling; other bovine blood samples were kindly collected and supplied by the farmers. The experimental collection of these samples was based upon the approval by the NZG Ethics and Scientific Committee. All blood samples were maintained at –20 °C in EDTA-coated vacutainer tubes.

2.2. DNA Isolation

DNA extraction from 200 μL of blood was performed using the ZR Genomic DNA™-Tissue MiniPrep kit (Inqaba Biotechnical Industries, Pretoria, South Africa) following the instructions of the manufacturer. Genomic DNA was eluted in 50 μL of elution buffer and stored at –20 °C until further analysis. DNA concentration was measured using NanoDrop® ND-1000 (NanoDrop Technologies Inc., Wilmington, NC, USA).

2.3. Primer Design

Polymerase Chain Reaction and nested PCR primers targeting BgRAP-1, BgAMA-1 and BgβTUB genes specific for B. bigemina were designed employing sequences of the corresponding genes published in GenBank. The accession numbers of BgAMA-1 sequences extracted from GenBank were HM543726–HM543730 and JN572795–JN572801. The BgRAP-1 sequences were available in GenBank under the accession numbers AF014757–AF014768. Accession numbers of the BgβTUB gene sequences used for primer design were AB634846, AJ289252, DQ104522 and EF060267. Primers were designed from conserved regions identified after creating multiple sequence alignments using the Clustal W algorithm embedded in BioEdit [34]. The species-specific primer sequences for the SpeI-AvaI nested PCR assay were obtained from the work published previously [14]. All the primers reflected in Table 1 were synthesized by Inqaba Biotechnical Industries.

2.4. PCR and Nested PCR Assays

Polymerase Chain Reaction and nested PCR assays to amplify B. bigemina species-specific SpeI-AvaI, BgRAP-1, BgAMA-1 and BgβTUB fragments from field-derived bovine blood samples were performed using oligonucleotide primers listed in Table 1. In all PCR assays, the primary reaction mixture was composed of 5 μL of template DNA, 0.6 μM of each primer and 12.5 μL of DreamTaq Green PCR Master Mix (Inqaba Biotechnical Industries) in a final volume of 25 μL adjusted with nuclease-free water. The reactions were thermally cycled in a BIO-RAD T100™ Thermal Cycler (Bio-Rad Laboratories, Johannesburg, South Africa) under the following temperatures: initial denaturation at 94 °C for 3 min, followed by 25 cycles of denaturation at 94 °C for 30 s, annealing at 48.5–71.5 °C for 45 s and extension at 72 °C for 1 min. The final extension step was included at 72 °C for 5 min. The specific annealing temperatures are shown in Table 1.
For the secondary (nested) PCR, 1 μL of the first PCR product was used as the template. The composition of the nested PCR mixture was similar to that described above; except that nested PCR primers were used instead. The thermal cycling conditions were as follows: 94 °C for 3 min, followed by 94 °C for 30 s, 62–70 °C for 45 s and 72 °C for 1 min. The final extension at 72 °C for 10 min was included. For all PCR assays, a reaction with nuclease-free water instead of DNA was incorporated as a negative control.
Polymerase Chain Reaction products were resolved by electrophoresis on 1.5% (w/v) agarose gels containing 1× Biotium GelRed acid stain (Anatech Instruments, Johannesburg, South Africa). Gels were run for 30 min at 100 V in 1× TAE (Tris-acetate-EDTA) buffer, and DNA fragments were visualized under UV light. O’GeneRuler 1 kb DNA ladder (Inqaba Biotechnical Industries) served as the standard molecular weight marker.

2.5. Validation of Primers

The validity and specificity of new sets of primers were checked by performing BLASTDBv5 searches in GenBank. Purified DNA stocks of B. bigemina, B. bovis, Theileria parva, Anaplasma centrale and Ehrlichia ruminantium were employed to evaluate the specificity of all primer sets tested. DNA samples of B. bigemina, B. bovis, A. centrale and E. ruminantium were kindly supplied by Dr Nicola Collins (Department of Veterinary Tropical Diseases, University of Pretoria, South Africa), while T. parva came from Prof Oriel Thekisoe (Parasitology Research Programme, University of the Free State, South Africa). Reaction mixtures were prepared and cycled as described above using 2 μL of purified DNA stocks.
Due to the genetic relatedness between B. bigemina and B. ovata DNA sequences, we further subjected bovine samples to the PCR assay targeting a 504 bp AMA-1 gene specific for B. ovata. The primer sequences and PCR conditions used were similar to those described in a recent study [35]. BovaF (5′-GAT ACG AGG CTG TCG GTA GC-3′) and BovaR (5′-AGT ATA GGT GAG CAT CAG TG-3′) were used as forward and reverse primers, respectively.

2.6. DNA Sequencing and Phylogenetic Analysis

Purified DNA fragments of selected samples, as shown in Table 2, were sequenced in both directions by Inqaba Biotechnical Industries using a Big Dye Terminator Kit (Applied Biosystems, Johannesburg, South Africa) with ABI 3130 XL Genetic Analyzer (Applied Biosystems). The determined sequences were aligned using the BioEdit software package for Windows 95/98/NT [34]. BLAST searches on the NCBI website were used to search for homologous sequences [36].
To construct phylogenetic trees, the sequences obtained in this study were aligned with the corresponding sequences published in GenBank and trimmed to equivalent lengths. Neighbor-joining trees were inferred using MEGA 5 software [37]. The Kimura two-parameter model [38] was used to estimate molecular distances, and bootstrapping analysis with 1000 replications was employed to determine the robustness of branches [39]. The EMBOSS needle program, version 6.3.1 (http://www.ebi.ac.uk/Tools/psa/emboss_needle/nucleotide.html, accessed on 7 March 2014) was used to perform pairwise comparisons of nucleotide sequences.

2.7. Nucleotide Sequence Accession Numbers

The nucleotide gene sequences reported in this study were deposited in GenBank under the following accession numbers: KF626581–KF626593 (BgRAP-1), KF626594–KF626606 (BgAMA-1) and KF626607–KF626618 (BgβTUB).

3. Results

3.1. Evaluation of Nested PCR Assays

Three diagnostic nested PCR assays developed in this study yielded single fragments with sizes corresponding to 470 bp for BgRAP-1 gene, 765 bp for BgAMA-1 gene and 302 bp for BgβTUB gene. The nested PCR assay based on the SpeI-AvaI restriction fragment presented an expected amplicon size of 170 bp. The results of PCR amplifications are presented in Table 2. While the PCR of SpeI-AvaI detected B. bigemina DNA in 41 out of 50 samples (82%; 95% CI = 69.2–90.2%), the PCR assays based on BgRAP-1, BgAMA-1 and BgβTUB genes detected B. bovis in 34 (68%; 95% CI = 54.2–79.2%), 25 (50%; 95% CI = 36.6–63.4%) and 23 (46%; 95% CI = 33.0–59.6%) samples, respectively. Of the 50 samples tested, 22 (44%; 95% CI = 31.2–57.7%) possessed all four B. bigemina genes tested for. Only six samples did not yield PCR amplifications when subjected to any of the four nested PCR assays.
The primer specificity was tested by subjecting purified DNA samples of B. bovis, T. parva, A. centrale and E. ruminantium to nested PCR assays, which yielded no amplifications. In order to confirm the correct amplification of nested PCR fragments, randomly selected SpeI-AvaI amplicons from positive reactions were sequenced. The determined sequences were confirmed to correspond to the SpeI-AvaI restriction fragment of B. bigemina strains published in GenBank (accession nos. S45366 and FJ939724).

3.2. Comparative Sequence Analyses

In order to perform in silico analysis of nucleotide sequences of genes amplified by nested PCR primers developed in this study, positive field samples marked as “++” in Table 2 were selected for subsequent sequencing of BgRAP-1, BgAMA-1 and BgβTUB genes.
From the analysis of BgRAP-1 sequences, there were single nucleotides (SNPs) at 26 positions along the length of the sequenced fragments. Of these, 25 were synonymous between the sequences from FS-146, KZN-C24, GP-C7 and NW-C4. Nucleotide changes between sequences from FS-146, KZN-C24, GP-C7 and NW-C4 were synonymous with those of B. bigemina strains published in GenBank (M85187, AF014763 and AF014765) and shared identities ranging between 99.8 and 100%. On the other hand, the BgRAP-1 sequences from DIVA, FS-189, MP-C1, MP-C11, MP-C12, WC-851, WC-10284, GP-C1 and GP-C19 were almost identical and shared 99.8–100% similarity with corresponding sequences published in GenBank (AF014757–AF014762).
Pairwise comparison of the BgAMA-1 nucleotide sequences revealed a high degree of genetic conservation between the sequences determined in this study and those of B. bigemina strains available in GenBank. As indicated in Table 3, the highest sequence identities recorded ranged between 98.5 and 100%. The BgAMA-1 sequences determined in this study shared 99.1–100% identity when compared to one another. A similar trend of sequence similarity (>98%) was recorded with GenBank strains of Mexican, Argentine and Italian origins. GenBank strains SP3 (JN572795) and M1P (JN572796) shared 99.6% sequence identity among them and revealed between 97.6 and 98.3% sequence identity with our sequences and other corresponding sequences published in GenBank.
Comparative analysis of the BgβTUB sequences indicated a high level of sequence conservation among South African B. bigemina isolates and GenBank strains. Nevertheless, there were SNPs observed along the length of the BgβTUB genes analyzed. For example, sequences from EC-19B, FS-146, GP-C1, KZN-C24, MP-C1 and MP-C11 were 100% identical and had nucleotide changes at only two positions. These sequences were also compared to BgβTUB sequences published in GenBank, revealing the maximum identity of 98.0–99.0% with strains Argentina (AB634846), Nigeria (AJ289252), Wayanad (EF060267) and Izatnagar (DQ104522). Similarly, the BgβTUB gene sequences from NW-C4, WC-851, GP-C19 and FS-189 shared 100% identity.

3.3. Analysis of Phylogenies

In studying the phylogenetic relationship among B. bigemina isolates, nucleotide sequences determined in this study were employed to infer neighbor-joining trees. Also incorporated in the phylogenies were sequences retrieved from GenBank. The phylogenetic tree constructed based on the BgRAP-1 gene sequences grouped B. bigemina isolates into three clusters, with the sequence from the PTR strain (AF014759) forming its own cluster (Figure 1). The first cluster comprised sequences of nine South African B. bigemina isolates, grouping together with GenBank strains. In the third clade, four South African isolates formed a cluster with PTR (AF014765) and CGA (AF014763) strains.
The phylogeny based on BgAMA-1 nucleotide sequences produced at least four clades (Figure 2). Sequences determined in the present study fell in clades 1 and 3, with a single sequence of Rio Grande da Sur (JN572800) found in cluster 4. Clades 1 and 3 comprised sequences derived from South African B. bigemina isolates, together with those retrieved from GenBank. Sequences in clade 3 were from Mexican B. bigemina isolates.
Although there were only four B. bigemina sequences of BgβTUB genes retrieved from GenBank, the constructed phylogeny assembled B. bigemina isolates into three clusters (Figure 3). The first clade comprised exclusively sequences of B. bigemina isolates derived from South African bovine samples. GenBank sequences (DQ104522, AB634846 and EF060267) grouping with B. bigemina sequences determined in this study were found in clade 2. The BgβTUB sequence of the Nigeria strain (AJ289252) formed a monophyletic grouping in clade 3.

4. Discussion

The impact of bovine babesiosis worldwide has prompted many researchers to increase their research efforts in the search for effective vaccine candidates that could potentially confer absolute protection against infection by Babesia parasites. It must be acknowledged that, to date, there are currently no vaccines available to purge babesial infections in cattle globally. In essence, the success in the development of effective subunit vaccines against babesiosis is impeded by antigenic variations observed among heterologous Babesia strains. Eventually, this restricts the development of novel vaccine candidates based on antigens that are functionally vital for parasite growth and survival [5,40].
In South Africa, live attenuated strains of Babesia parasites have always been exploited as a means of immunizing cattle against babesiosis. However, the shortcoming associated with the use of live attenuated strains, which involves infection with bovine blood, relates to the possible cross-contamination with other blood-borne pathogens [41]. In addition, disease outbreaks emanating from vaccination with live attenuated strains have also been reported [42]. Therefore, it is vital to study the epidemiology of Babesia species and comprehend the degree of sequence variations among Babesia parasites, more specifically B. bigemina, in an attempt to develop effective control strategies against bovine babesiosis. In a recent study, we demonstrated that B. bigemina occurred more frequently in South African cattle than B. bovis [20].
In this study, we describe the successful application of three developed nested PCR assays for specifically detecting B. bigemina DNA fragments in field bovine samples. The SpeI-AvaI nested PCR-based assay [14] used as the control for the newly developed diagnostic assays detected B. bigemina DNA in more than 80% of field bovine samples tested. This was in contrast to BgRAP-1, BgAMA-1 and BgβTUB assays, which amplified B. bigemina species-specific fragments in less than 70% of bovine samples examined, thus suggesting the high sensitivity of the SpeI-AvaI-based assay in diagnosing B. bigemina. These findings are in agreement with a previous study in which the SpeI-AvaI nested PCR assay detected more B. bigemina-positive samples than the AMA-1 nested PCR assay [18]. However, it was discovered that SpeI-AvaI primers for the specific detection of B. bigemina also amplified the SpeI-AvaI-like fragment of B. ovata [18]. To further confirm this, we subjected the surveyed bovine samples to a B. ovata-specific PCR assay developed previously on the basis of the AMA-1 gene [35]. As expected, no PCR amplifications of B. ovata AMA-1 genes were observed. Until now, B. ovata has only been recorded in cattle from Mongolia, Japan, Korea, Thailand and China [43,44,45,46], and a recent study could not detect B. ovata DNA in bovine samples originating from South Africa [46].
Positive nested PCR products of SpeI-AvaI, BgRAP-1, BgAMA-1 and BgβTUB fragments from selected samples were also sequenced to corroborate whether we amplified the correct target genes. The BLAST search in GenBank using newly determined nucleotide sequences confirmed that we amplified the correct genes. In order to rule out the possibility of Taq polymerase and sequencing errors, two independently derived nested PCR products from each isolate were sequenced. Indeed, no differences were found between the two sequenced fragments of each isolate. The obtained nucleotide gene sequences were also employed in silico sequence analysis and to study the phylogenetic relationship among B. bigemina isolates.
The ability of recombinant rhoptry-associated proteins (RAPs) to confer partial protective immunity against babesial infection with homologous and heterologous strains of Babesia species has stimulated interest among the researchers to identify both B-cell and T-cell epitopes [47]. These proteins are present on the surface of live merozoites and are considered important vaccine components as they are believed to play a vital role during the invasion of host cells [48]. In this study, we sequenced the BgRAP-1 genes of B. bigemina isolates originating from South African bovine samples. In silico analysis of nucleotide sequences revealed that South African B. bigemina isolates are genetically similar to world strains. Although the genetic organization of the RAP-1 locus among babesial species is highly complex [49], the genetic conservation observed among B. bigemina BgRAP-1 sequences determined in the present study may therefore be significant for vaccine efficacy. According to Giglioti et al. [21], the BgRAP-1 gene of B. bigemina is characterized by five copies located in a single genomic region, and this could possibly explain why this gene was detected in some of the samples tested in this study (e.g., KZN-C31, MP-C2, MP-C19, WC-BC8, etc.) when other genes were not detected.
Apical membrane antigen 1 (AMA-1) is among the functionally important proteins employed by apicomplexan parasites to invade host cells. The well-studied AMA-1 protein is that of Plasmodium falciparum, an agent of malaria. Immune responses to Plasmodium AMA-1 are believed to have intense parasite inhibitory effects [50], suggesting that these proteins can be considered as important candidate antigens for vaccine development. As such, the AMA-1 protein of B. bigemina strains also appears to be essential during host cell invasion [51]. In the present work, although we observed SNPs occurring along the lengths of BgAMA-1 genes of B. bigemina isolates examined, the high level of genetic conservation observed could imply that the AMA-1 protein of B. bigemina isolates merits inclusion in the development of subunit vaccines against babesiosis. It is also worth noting that this observation of genetic conservation among B. bigemina BgAMA-1 genes is consistent with previous findings in which BgAMA-1 nucleotide and amino acid sequences of Italian B. bigemina strains shared more than 99% identity with those of strains from Australia [26]. This feature of sequence conservation is commensurate with the proposed role of AMA-1 proteins as potential vaccine components.
The phylogeny created with BgRAP-1 sequences grouped B. bigemina isolates into three clusters. The first cluster (clade 1) comprised South African isolates of B. bigemina, which appeared to be closely related to strains derived from Brazil, Argentina, Uruguay and Puerto Rico [52]. Among the South African isolates in clade 1, the sequences used for phylogeny construction originated from bovine samples collected at various geographical regions, including KwaZulu-Natal, Free State, Western Cape, Gauteng and Mpumalanga. Sequences of B. bigemina isolates in clade 3 were derived from samples collected in Eastern Cape, Free State, KwaZulu-Natal, Gauteng and Northwest; these sequences also clustered with those of strains from Brazil and Puerto Rico.
Phylogenetic analysis of BgAMA-1 genes showed that micro-heterogeneities among B. bigemina isolates caused the formation of four clusters. Although the discriminatory power within cluster 1 was low, it was noteworthy that the sequences of isolates derived from samples collected at Gauteng, Western Cape, Free State and Northwest regions were phylogenetically related to those of B. bigemina strains from countries other than South Africa. Further, the BgAMA-1 sequences of B. bigemina isolates from KwaZulu-Natal and Mpumalanga samples grouped with that of an Italian strain, sharing a sequence identity of 99.2–99.9%.
Sequences of the BgβTUB gene encoding the β-tubulin protein were also employed to infer a neighbor-joining tree. Phylogenetic analysis indicated that the BgβTUB sequences of South African B. bigemina isolates were found in two clades, and each clade comprised isolates derived from bovine samples collected at different geographical regions. Sequences of B. bigemina strains published in GenBank fell in the first clade. From in silico sequence analysis, it was also noted that there was a high degree of conservation between BgβTUB gene sequences of our isolates and those of GenBank strains. These findings are consistent with a previous study in which the coding sequence of the β-tubulin gene was found to be conserved among Babesia and Theileria species [27]. Nonetheless, observations of the phylogenetic clustering of B. bigemina BgβTUB sequences as demonstrated in this study may not be conclusive given that only four sequences could be retrieved from GenBank. In essence, the BgβTUB gene of Babesia species is considered an informative marker that is ideal for species identification and discrimination [27]. In addition, the β-tubulin genes of apicomplexan parasites are known to possess one or more introns [53,54]. While the first intron is conserved in all apicomplexan species studied so far, other introns of the β-tubulin gene are known to exhibit a great deal of variation both in length and in sequence, thus making this gene a suitable candidate as an informative marker [27].

5. Conclusions

We have described the successful application of three nested PCR assays that can be employed for the specific diagnosis of B. bigemina parasites in bovine samples. Sequences derived from positive nested PCR products provided more insights on the genetic conservation and phylogenetic relatedness among B. bigemina isolates of South African origin and those originating from other countries. Given that the occurrence of antigenic polymorphism among the functionally important surface proteins serves as the mechanism of parasite evasion from host immune response [16], it remains crucial to ascertain the degree of polymorphisms among representative B. bigemina isolates derived from geographically distinct regions. In particular, the high conservation of the BgRAP-1 and BgAMA-1 genes suggests that the proteins encoded by these genes could be suitable for inclusion in recombinant subunit vaccines for purging Babesia infections.

Author Contributions

P.S.M. conceived the study. P.S.M. and M.S.M. participated in the study of design and coordination. P.S.M. carried out laboratory assays, performed data analysis and interpretation, and constructed phylogenetic trees. P.S.M. and M.S.M. drafted and critically reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work is based upon the research supported financially by the National Research Foundation (NRF) grant number 69090 and the National Zoological Gardens of South Africa (NZG). Any opinion, finding and conclusion or recommendation expressed in this material is that of the authors, and the NRF does not accept any liability in this regard.

Institutional Review Board Statement

The animal study protocol was approved by the NZG Ethics and Scientific Committee (ECS) [NZGECS: P13/23, 13 October 2013].

Informed Consent Statement

Not applicable.

Data Availability Statement

The species-specific primers used in PCR assays were designed from multiple alignments of nucleotide gene sequences of B. bigemina strains retrieved from GenBank. All the nucleotide sequences from this study are publicly available on Genbank, and with the following accession numbers: KF626581, KF626582, KF626583, KF626584, KF626585, KF626586, KF626587, KF626588, KF626589, KF626590, KF626591, KF626592, KF626593, KF626594, KF626595, KF626596, KF626597, KF626598, KF626599, KF626600, KF626601, KF626602, KF626603, KF626604, KF626605, KF626606, KF626607, KF626608, KF626609, KF626610, KF626611, KF626612, KF626613, KF626614, KF626615, KF626616, KF626617, and KF626618.

Acknowledgments

The technical assistance of Lerato Dlamini, Trevor Molemane and Veronica Phetla is gratefully acknowledged. The authors are indebted to Nicola Collins and Oriel Thekisoe, who kindly supplied pure DNA samples of B. bigemina, B. bovis, E. ruminantium, A. centrale and T. parva.

Conflicts of Interest

The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.

References

  1. McCosker, P.J. The global importance of babesiosis. In Babesiosis; Ristic, M., Kreier, J.P., Eds.; Academic Press: New York, NY, USA, 1981; pp. 1–24. [Google Scholar]
  2. Norval, R.A. Tick infestations and tick-borne diseases in Zimbabwe Rhodesia. J. S. Afr. Vet. Assoc. 1979, 50, 289–292. [Google Scholar] [PubMed]
  3. Ristic, M. Babesiosis. In Diseases of Cattle in the Tropics; Ristic, M., MacIntyre, I., Eds.; Martinus Nijhof Publishers: Leiden, The Netherlands, 1981; pp. 443–468. [Google Scholar]
  4. Bock, R.; Jackson, L.; de Vos, A.; Jorgensen, W. Babesiosis of cattle. Parasitology 2004, 129, S247–S269. [Google Scholar] [CrossRef] [PubMed]
  5. Brown, W.C.; Norimine, J.; Goff, W.L.; Suarez, C.E.; McElwain, T.F. Prospects for recombinant vaccines against Babesia bovis and related parasites. Parasitol. Immunol. 2006, 28, 315–327. [Google Scholar]
  6. De Vos, A.J.; Potgieter, F.T. Bovine babesiosis. In Infectious Diseases of Livestock; Coetzer, J.A.W., Thomson, G.R., Tustin, R.C., Eds.; Oxford University Press: Cape Town, South Africa, 1994; pp. 278–294. [Google Scholar]
  7. Yu, L.; Terkawi, M.A.; Cruz-Flores, M.J.; Claveria, F.G.; Aboge, G.O.; Yamagishi, J.; Goo, Y.-K.; Cao, S.; Masatani, T.; Nishikawa, Y.; et al. Epidemiological survey of Babesia bovis and Babesia bigemina infections of cattle in Philippines. J. Vet. Med. Sci. 2013, 75, 995–998. [Google Scholar]
  8. Riek, R.F. The life cycle of Babesia bigemina (Smith & Kilborne, 1893) in the tick vector Boophilus microplus (Canestrini). Aust. J. Agric. Res. 1964, 15, 802–821. [Google Scholar]
  9. Jerzak, M.; Gandurski, A.; Tokaj, M.; Stachera, W.; Szuba, M.; Dybicz, M. Advances in Babesia vaccine development: An overview. Pathogens 2023, 12, 300. [Google Scholar] [CrossRef]
  10. Almeria, S.; Castella, J.; Ferrer, D.; Ortuno, A.; Estrada-Peña, A.; Gutierrez, J.F. Bovine piroplasms in Minorca (Balearic Islands, Spain): A comparison of PCR-based and light microscopy detection. Vet. Parasitol. 2001, 99, 249–259. [Google Scholar] [CrossRef]
  11. Bessenger, R.; Schoeman, J.H. Serological responses of cattle to infection with Babesia bigemina and Babesia bovis in southern Africa. Onderstepoort J. Vet. Res. 1983, 50, 115–117. [Google Scholar]
  12. Passos, L.M.F.; Bell-Sakyi, L.; Brown, C.G.D. Immunochemical characterization of in vitro culture-derived antigens of Babesia bovis and Babesia bigemina. Vet. Parasitol. 1998, 76, 239–249. [Google Scholar] [CrossRef]
  13. Fahrimal, Y.; Goff, W.L.; Jasmer, D.P. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA. J. Clin. Microbiol. 1992, 30, 1374–1379. [Google Scholar]
  14. Figueroa, J.V.; Chieves, L.P.; Johnson, G.S.; Buening, G.M. Multiplex polymerase chain reaction based assay for the detection of Babesia bigemina, Babesia bovis and Anaplasma marginale DNA in bovine blood. Vet. Parasitol. 1993, 50, 69–81. [Google Scholar] [PubMed]
  15. Smeenk, I.; Kelly, P.J.; Wray, K.; Musuka, G.; Trees, A.J.; Jongejan, F. Babesia bovis and Babesia bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction. J. S. Afr. Vet. Assoc. 2000, 71, 21–24. [Google Scholar]
  16. Oliveira-Sequeira, T.C.G.; Oliveira, M.C.S.; Araujo, J.P., Jr.; Amarante, A.F.T. PCR-based detection of Babesia bovis and Babesia bigemina in their natural host Boophilus microplus and cattle. Int. J. Parasitol. 2005, 35, 105–111. [Google Scholar]
  17. Guerrero, F.D.; Bendele, K.G.; Davey, R.B.; George, J.E. Detection of Babesia bigemina infection in strains of Rhipicephalus (Boophilus) microplus collected from outbreaks in south Texas. Vet. Parasitol. 2007, 145, 156–163. [Google Scholar]
  18. Sivakumar, T.; Altangerel, K.; Battsetseg, B.; Battur, B.; Aboulaila, M.; Munkhjargal, T.; Yoshinari, T.; Yokoyama, N.; Igarashi, I. Genetic detection of Babesia bigemina from Mongolian cattle using apical membrane antigen-1 gene-based PCR assay. Vet. Parasitol. 2012, 187, 17–22. [Google Scholar]
  19. Terkawi, M.A.; Alhasan, H.; Huyen, N.X.; Sabagh, A.; Awier, K.; Cao, S.; Goo, Y.K.; Aboge, G.; Yokoyama, N.; Nishikawa, Y.; et al. Molecular and serological prevalence of Babesia bovis and Babesia bigemina in cattle from central region of Syria. Vet. Parasitol. 2012, 187, 307–311. [Google Scholar]
  20. Mtshali, M.S.; Mtshali, P.S. Molecular diagnosis and phylogenetic analysis of Babesia bigemina and Babesia bovis hemoparasites from cattle in South Africa. BMC Vet. Res. 2013, 9, 154. [Google Scholar]
  21. Giglioti, R.; Filho, A.E.V.; Domingos, A.G.; da Silva, S.S.; Cunha, R.C.; Ibelli, A.M.G.; Okino, C.H.; de Sena Oliveira, M.C. Detection and quantification of Babesia bovis and Babesia bigemina using different target genes. Res. Vet. Sci. 2024, 168, 105122. [Google Scholar]
  22. Cao, S.; Aboge, G.O.; Terkawi, M.A.; Yu, L.; Kamyingkird, K.; Luo, Y.; Li, Y.; Goo, Y.-K.; Yamagishi, J.; Nishikawa, Y.; et al. Molecular detection and identification of Babesia bovis and Babesia bigemina in cattle in northern Thailand. Parasitol. Res. 2012, 111, 1259–1266. [Google Scholar] [CrossRef]
  23. Kemp, L.E.; Yamamoto, M.; Soldati-Favre, D. Subversion of host cellular functions by the apicomplexan parasites. Microbiol. Rev. 2013, 37, 607–631. [Google Scholar]
  24. Suárez, C.E.; Palmer, G.H.; Florin-Christensen, M.; Hines, S.A.; Hotzel, I.; McElwain, T.F. Organization, transcription and expression of rhoptry associated protein genes in the Babesia bigemina rap-1 locus. Mol. Biochem. Parasitol. 2003, 127, 101–112. [Google Scholar] [CrossRef] [PubMed]
  25. Moumouni, P.F.A.; Aboge, G.O.; Terkawi, M.A.; Masatani, T.; Cao, S.; Kamyingkird, K.; Jirapattharasate, C.; Zhou, M.; Wang, G.; Liu, M.; et al. Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya. Parasit. Vectors 2015, 8, 496. [Google Scholar] [CrossRef] [PubMed]
  26. Torina, A.; Agnone, A.; Sireci, G.; Mosqueda, J.J.; Blanda, V.; Albanese, I.; La Farina, M.; Cerrone, A.; Cusumano, F.; Caracappa, S. Characterization of the apical membrane antigen-1 in Italian strains of Babesia bigemina. Transbound. Emerg. Dis. 2010, 57, 52–56. [Google Scholar] [CrossRef]
  27. Cacciò, S.; Cammà, C.; Onuma, M.; Severini, C. The β-tubulin gene of Babesia and Theileria parasites is an informative marker for species discrimination. Int. J. Parasitol. 2000, 30, 1181–1185. [Google Scholar] [CrossRef]
  28. Zamoto, A.; Tsuji, M.; Wei, Q.; Cho, S.H.; Shin, E.H.; Kim, T.S.; Leonova, G.N.; Hagiwara, K.; Asakawa, M.; Kariwa, H.; et al. Epizootiologic survey for Babesia microti among small wild mammals in northeastern Eurasia and a geographic diversity in the beta-tubulin gene sequences. J. Vet. Med. Sci. 2004, 66, 785–792. [Google Scholar] [CrossRef]
  29. Terkawi, M.A.; Thekisoe, O.M.M.; Katsande, C.; Latif, A.A.; Mans, B.J.; Matthee, O.; Mkize, N.; Mabogoane, N.; Marais, F.; Yokoyama, N.; et al. Serological survey of Babesia bovis and Babesia bigemina in cattle in South Africa. Vet. Parasitol. 2011, 182, 337–342. [Google Scholar] [CrossRef]
  30. Lew, A.; Jorgensen, W. Molecular approaches to detect and study the organisms causing bovine tick borne diseases: Babesiosis and anaplasmosis. Afr. J. Biotechnol. 2005, 4, 292–302. [Google Scholar]
  31. Madruga, C.R.; Leal, C.R.B.; Ferreira, A.M.T.; Araújo, F.R.; Bonato, A.L.V.; Kessler, R.H.; Schenk, M.A.M.; Soares, C.O. Genetic and antigenic analysis of Babesia bigemina isolates from five geographical regions of Brazil. Pesq. Vet. Bras. 2002, 22, 153–160. [Google Scholar] [CrossRef]
  32. Almazan, C.; Tipacamu, G.A.; Rodriguez, S.; Mosqueda, J.; Perez de Leon, A. Immunological control of ticks and tick-borne diseases that impact cattle health and production. Front. Biosci. Landmark 2018, 23, 1535–1551. [Google Scholar] [CrossRef]
  33. Figueroa, J.V.; Buening, G.M. In vitro inhibition of multiplication of Babesia bigemina by using monoclonal antibodies. J. Clin. Microbiol. 1991, 29, 997–1003. [Google Scholar] [CrossRef]
  34. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  35. Sivakumar, T.; Tagawa, M.; Yoshinari, T.; Ybañez, A.P.; Igarashi, I.; Ikehara, Y.; Hata, H.; Kondo, S.; Matsumoto, K.; Inokuma, H.; et al. PCR detection of Babesia ovata from cattle reared in Japan and clinical significance of coinfection with Theileria orientalis. J. Clin. Microbiol. 2012, 50, 2111–2113. [Google Scholar] [CrossRef] [PubMed]
  36. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [PubMed]
  37. Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9, 299–306. [Google Scholar]
  38. Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar]
  39. Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar]
  40. Florin-Christensen, M.; Schnittger, L.; Dominguez, M.; Mesplet, M.; Rodriguez, A.; Ferreri, L.; Asenzo, G.; Wilkowsky, S.; Farber, M.; Echaide, I.; et al. Search for Babesia bovis vaccine candidates. Parassitologia 2007, 1, 9–12. [Google Scholar]
  41. De Vos, A.; Bock, R.E. Vaccination against bovine babesiosis. Ann. N. Y. Acad. Sci. 2000, 916, 540–545. [Google Scholar] [CrossRef]
  42. Berens, S.J.; Brayton, K.A.; Molloy, J.B.; Bock, R.E.; Lew, A.E.; McElwain, T.F. Merozoite surface antigen 2 proteins of Babesia bovis vaccine breakthrough isolates contain a unique hypervariable region composed of degenerate repeats. Infect. Immun. 2005, 73, 7180–7189. [Google Scholar]
  43. Bai, Q.; Liu, G.; Zhang, L.; Zhou, J. Studies on the isolation and preservation a single species of bovine haematocytozoon: The finding and isolation of Babesia ovata in China. Chin. J. Vet. Med. 1990, 16, 2–4. [Google Scholar]
  44. Minami, T.; Ishihara, T. Babesia ovata sp. n. isolated from cattle in Japan. Natl. Inst. Anim. Health Q. 1980, 20, 101–113. [Google Scholar]
  45. Suh, M.D. Pure isolation and identification of Babesia ovata by morphological characteristics and complement fixation test in Korea. Korean J. Vet. Res. 1987, 27, 307–316. [Google Scholar]
  46. Yoshinari, T.; Sivakumar, T.; Asada, M.; Battsetseg, B.; Huang, X.; Lan, D.T.B.; Inpankaew, T.; Ybanez, A.; Alhassan, A.; Thekisoe, O.M.M.; et al. A PCR based survey of Babesia ovata in cattle from various Asian, African and South American countries. J. Vet. Med. Sci. 2013, 75, 211–214. [Google Scholar] [PubMed]
  47. Brown, W.C.; McElwain, T.F.; Ruef, B.J.; Suarez, C.E.; Shkap, V.; Chitko-McKown, C.G.; Tuo, W.; Rice-Ficht, A.C.; Palmer, G.H. Babesia bovis rhoptry-associated protein 1 is immunodominant for T helper cells of immune cattle and contains T-cell epitopes conserved among geographically distant B. bovis strains. Infect. Immun. 1996, 64, 3341–3350. [Google Scholar]
  48. Perkins, M.E. Rhoptry organelles of apicomplexan parasites. Parasitol. Today 1992, 8, 28–32. [Google Scholar]
  49. Suarez, C.E.; Palmer, G.H.; Hötzel, I.; McElwain, T.F. Structure, sequence, and transcriptional analysis of the Babesia bovis rap-1 multigene locus. Mol. Biochem. Parasitol. 1998, 93, 215–224. [Google Scholar]
  50. Remarque, E.J.; Faber, B.W.; Kocken, C.H.M.; Thomas, A.W. Apical membrane antigen 1: A malaria vaccine candidate in review. Trends Parasitol. 2007, 24, 74–84. [Google Scholar]
  51. Yokoyama, N.; Okamura, M.; Igarashi, I. Erythrocyte invasion by Babesia parasites: Current advances in the elucidation of the molecular interactions between the protozoan ligands and host receptors in the invasion stage. Vet. Parasitol. 2006, 138, 22–32. [Google Scholar]
  52. Hötzel, I.; Suarez, C.E.; McElwain, T.F.; Palmer, G.H. Genetic variation in the dimorphic regions of rap-1 genes and rap-1 loci of Babesia bigemina. Mol. Biochem. Parasitol. 1997, 90, 479–489. [Google Scholar]
  53. Nagel, S.D.; Boothroyd, J.C. The α- and β-tubulins of Toxoplasma gondii are encoded by single-copy genes containing multiple introns. Mol. Biochem. Parasitol. 1988, 26, 261–273. [Google Scholar] [CrossRef]
  54. Delves, C.J.; Ridley, R.G.; Goman, M.; Holloway, S.P.; Hyde, J.E.; Scaife, J.G. Cloning of β-tubulins gene from Plasmodium falciparum. Mol. Microbiol. 1989, 3, 1511–1519. [Google Scholar]
Biology 14 00355 g001
Figure 1. Phylogenetic tree constructed with the BgRAP-1 gene sequences from our Babesia bigemina isolates and GenBank strains. Nucleotide sequences determined in this study are shown in bold type, and accession numbers are given in parentheses. The horizontal scale bar indicates the number of base substitutions per site. Bootstrap values, computed as percentages of 1000 replicates, are indicated at branching points.
Figure 1. Phylogenetic tree constructed with the BgRAP-1 gene sequences from our Babesia bigemina isolates and GenBank strains. Nucleotide sequences determined in this study are shown in bold type, and accession numbers are given in parentheses. The horizontal scale bar indicates the number of base substitutions per site. Bootstrap values, computed as percentages of 1000 replicates, are indicated at branching points.
Biology 14 00355 g001
Biology 14 00355 g002
Figure 2. Neighbor-joining tree inferred with the BgAMA-1 gene sequences from our Babesia bigemina isolates and GenBank strains. Nucleotide sequences determined in this study are shown in bold type, and accession numbers are given in parentheses. The horizontal scale bar indicates the number of base substitutions per site. Bootstrap values, computed as percentages of 1000 replicates, are indicated at branching points.
Figure 2. Neighbor-joining tree inferred with the BgAMA-1 gene sequences from our Babesia bigemina isolates and GenBank strains. Nucleotide sequences determined in this study are shown in bold type, and accession numbers are given in parentheses. The horizontal scale bar indicates the number of base substitutions per site. Bootstrap values, computed as percentages of 1000 replicates, are indicated at branching points.
Biology 14 00355 g002
Biology 14 00355 g003
Figure 3. A phylogram created with BgβTUB nucleotide sequences from South African Babesia bigemina isolates and GenBank strains. Nucleotide sequences determined in this study are shown in bold type, and accession numbers are given in parentheses. The horizontal scale bar indicates the number of base substitutions per site. Bootstrap values, computed as percentages of 1000 replicates, are indicated at branching points.
Figure 3. A phylogram created with BgβTUB nucleotide sequences from South African Babesia bigemina isolates and GenBank strains. Nucleotide sequences determined in this study are shown in bold type, and accession numbers are given in parentheses. The horizontal scale bar indicates the number of base substitutions per site. Bootstrap values, computed as percentages of 1000 replicates, are indicated at branching points.
Biology 14 00355 g003
Table 1. PCR and nested PCR primers used to amplify Babesia bigemina DNA fragments.
Table 1. PCR and nested PCR primers used to amplify Babesia bigemina DNA fragments.
Target GeneAssayPrimer NamePrimer Sequence (5′ → 3′)AnnealingProduct SizeReference
SpeI-AvaIPCRBiIACATCTAATTTCTCTCCATACCCCTCC55 °C278 bp[14]
BiIBCCTCGGCTTCAACTCTGATGCCAAAG [14]
nPCRBiIANCGCAAGCCCAGCACGCCCCGGTGC59 °C170 bp[14]
BiIBNCCGACCTGGATAGGCTGTGTGATG [14]
BgRAP-1PCRBigRAP1GTTATGTCAGCAGAGGTGGTTGGA70.5 °C564 bpThis study
BigRAP2ACCGAACAGGCGAGTTGTGAA This study
nPCRBigRAP3GAGGTTGTCAATGCTGAAATGGAAGC71.5 °C472 bpThis study
BigRAP4ACTTAGCCGCCGTAAAGTCAACG This study
BgAMA-1PCRBigAmaFCGTATGCCCACAGGAAAATGC62 °C1046 bpThis study
BigAmaRGTTTTCATGTTGAGAGCGGTGG This study
nPCRBigAmaFNCGGACTTCCTCGAACCGAT66 °C765 bpThis study
BigAmaRNCGTAGTTCGCCCAGTTCATACC This study
BgβTUBPCRBtBigACTCTGACGAGCATGGAATCG48.5 °C408 bpThis study
BtBigBCTTTGGCCCAGTTGTTACCAG This study
nPCRBtBigANCATGGCAGCCTGAAGCTTTG67 °C302 bpThis study
BtBigBNCGAAATTGTCGGGCCTGAAG This study
Table 2. Results of nested PCR detection of Babesia bigemina DNA fragments in field samples.
Table 2. Results of nested PCR detection of Babesia bigemina DNA fragments in field samples.
Sample IDPlace of OriginCollection DateSourceNested PCR Assay Results 1
SpeI-AvaIBgRAP-1BgAMA-1BgβTUB
K0500-10KwaZulu-NatalMay 2011Bovine++++
KZN-C24KwaZulu-NatalMay 2011Bovine+++++++
KZN-C25KwaZulu-NatalMay 2011Bovine–+–+
KZN-C31KwaZulu-NatalMay 2011Bovine++––
KZN-C50KwaZulu-NatalMay 2011Bovine+++–
KZN-C58KwaZulu-NatalMay 2011Bovine++++
KZN-C60KwaZulu-NatalMay 2011Bovine+–––
ARUSHAKwaZulu-NatalMay 2011Bovine++++
COCO2KwaZulu-NatalMay 2011Bovine+–––
DIVAKwaZulu-NatalMay 2011Bovine+++++++
NATALIEKwaZulu-NatalMay 2011Bovine++++
MP-C1MpumalangaJune 2011Bovine+++++++
MP-C2MpumalangaJune 2011Bovine++––
MP-C8MpumalangaJune 2011Bovine+++–
MP-C11MpumalangaJune 2011Bovine+++++++
MP-C12MpumalangaJune 2011Bovine+++++–
MP-C18MpumalangaJune 2011Bovine––+–
MP-C19MpumalangaJune 2011Bovine++––
WC-723Western CapeJuly 2012Bovine++++
WC-851Western CapeJuly 2012Bovine+++++++
WC-10272Western CapeJuly 2012Bovine––––
WC-10284Western CapeJuly 2012Bovine+++++++
WC-11134Western CapeJuly 2012Bovine++++
WC-BC8Western CapeJuly 2012Bovine++––
FS-80Free StateJuly 2005Bovine+–––
FS-156Free StateJuly 2005Bovine++++
FS-146Free StateJuly 2005Bovine+++++++
FS-189Free StateJuly 2005Bovine+++++++
FS-284Free StateJuly 2005Bovine++++
FS-289Free StateJuly 2005Bovine+–––
GP-C1GautengDecember 2009Bovine+++++++
GP-C2GautengMay 2010Bovine–+––
GP-C3GautengMay 2010Bovine++––
GP-C7GautengMarch 2010Bovine++++++
GP-C9GautengMay 2010Bovine+–––
GP-C19GautengMay 2010Bovine+++++++
EC-28AEastern CapeMay 2009Bovine++––
EC-37AEastern CapeMay 2009Bovine––––
EC-9BEastern CapeMay 2009Bovine+–––
EC-19BEastern CapeMay 2009Bovine++–++
NW-C2NorthwestMarch 2011Bovine++++
NW-C4NorthwestMarch 2011Bovine+++++++
NW-C7NorthwestJune 2012Bovine––––
NW-C10NorthwestJune 2012Bovine++––
NW-C17NorthwestJune 2012Bovine+–––
NC-1Northern CapeAugust 2012Bovine––––
NC-8Northern CapeAugust 2012Bovine+–––
NC-20Northern CapeAugust 2012Bovine+–––
NC-24Northern CapeAugust 2012Bovine––––
NC-41Northern CapeAugust 2012Bovine––––
1 “(–)” denotes negative PCR amplifications; “(+)” denotes positive PCR amplifications; “(++)” denotes positive PCR amplicons selected for sequencing.
Table 3. Pairwise comparisons of B. bigemina BgAMA-1 nucleotide sequences of South African isolates and GenBank strains.
Table 3. Pairwise comparisons of B. bigemina BgAMA-1 nucleotide sequences of South African isolates and GenBank strains.
Sequences 1 01020304050607080910111213141516171819202122
AB4812000110099.699.299.199.399.199.599.198.999.198.999.199.198.999.599.699.799.799.699.799.799.6
GQ25773802 10099.399.299.799.299.699.599.199.299.399.599.599.399.999.799.999.910099.999.9100
GQ25773903 10099.199.199.198.999.398.999.999.299.399.399.599.599.399.599.599.399.599.599.3
GQ25774004 10099.599.598.898.799.998.998.898.998.998.899.399.299.399.399.299.399.399.2
HM54372605 10099.599.399.299.398.999.199.299.299.199.699.599.699.699.799.699.699.7
HM54372706 10098.898.799.398.998.898.998.998.899.399.299.399.399.299.399.399.2
JN57279907 10099.198.798.898.999.199.198.999.599.399.599.599.699.599.599.6
JN57280008 10098.599.599.399.599.599.699.399.299.399.399.599.399.399.5
JN57280109 10098.898.798.898.898.799.299.199.299.299.199.299.299.1
KZN-C24 *10 10099.399.599.599.699.399.299.399.399.299.399.399.2
MP-C1 *11 10099.999.999.599.599.199.299.299.399.299.299.3
MP-C11 *12 10010099.699.699.299.399.399.599.399.399.5
MP-C12 *13 10099.699.699.299.399.399.599.399.399.5
DIVA *14 10099.599.199.299.299.399.299.299.3
NW-C4 *15 10099.699.799.799.999.799.799.9
FS-146 *16 10099.999.999.799.999.999.7
FS-189 *17 10010099.910010099.9
WC-851 *18 10099.910010099.9
WC-10284 *19 10099.999.9100
GP-C1 *20 10010099.9
GP-C7 *21 10099.9
GP-C19 *22 100
1 Accession numbers of sequences retrieved from GenBank (01 through 09) are given, and sequences determined in the present study are indicated with asterisks. The highlights is the standard way of representing data for this statistical test.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mtshali, P.S.; Mtshali, M.S. Genetic Characterization and Phylogenetic Analysis of Babesia bigemina Isolates in Cattle from South Africa Based on BgRAP-1, BgAMA-1 and BgβTUB Genes. Biology 2025, 14, 355. https://doi.org/10.3390/biology14040355

AMA Style

Mtshali PS, Mtshali MS. Genetic Characterization and Phylogenetic Analysis of Babesia bigemina Isolates in Cattle from South Africa Based on BgRAP-1, BgAMA-1 and BgβTUB Genes. Biology. 2025; 14(4):355. https://doi.org/10.3390/biology14040355

Chicago/Turabian Style

Mtshali, Phillip Senzo, and Moses Sibusiso Mtshali. 2025. "Genetic Characterization and Phylogenetic Analysis of Babesia bigemina Isolates in Cattle from South Africa Based on BgRAP-1, BgAMA-1 and BgβTUB Genes" Biology 14, no. 4: 355. https://doi.org/10.3390/biology14040355

APA Style

Mtshali, P. S., & Mtshali, M. S. (2025). Genetic Characterization and Phylogenetic Analysis of Babesia bigemina Isolates in Cattle from South Africa Based on BgRAP-1, BgAMA-1 and BgβTUB Genes. Biology, 14(4), 355. https://doi.org/10.3390/biology14040355

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop