Long-Term Engraftment of Cryopreserved Human Neurons for In Vivo Disease Modeling in Neurodegenerative Disease
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Single Cell Sorting
2.2. Quantitative PCR
2.3. Transplantation of iGABAs
2.4. Immunohistochemistry and Stereology
3. Results
3.1. In Vitro Characterization of iGABAs
3.2. Survival and Outgrowth of iGABAs in Immunosuppressed Rat Brain
3.3. Long-Term Engraftment and Biodistribution in Aged Immunodeficient Rat Brain
3.4. Engraftment of iGABAs in Non-Human Primate Brain
3.5. Long-Term Engraftment, Biodistribution, and Pathogenic Assessment in Immunodeficient Transgenic HD Mouse Brain
3.6. Transfer of Endogenous mHtt into Grafted iGABAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
Aq | Aqueduct |
cc | Corpus Collosum |
CNS | Central Nervous System |
Ctx | Cortex |
Fr3 | Frontal cortex, area 3 |
HD | Huntington’s Disease |
HuCyto | Human Cytoplasm |
HuNCAM | Human Neural Cell Adhesion Molecule |
HuNuclei | Human Nuclei |
iGABA | iPSC derived forebrain GABAergic neurons |
iPSC | Induced Pluripotent Stem Cell |
M1 | Primary Motor cortex |
M2 | Secondary Motor cortex |
MDPI | Multidisciplinary Digital Publishing Institute |
MFB | Medial Forebrain Bundle |
mHtt | Mutant Huntington protein |
NSG | Nod-Skid-Gamma |
PD | Parkinson’s disease |
S1J | Primary Somatosensory |
SN | Substantia Nigra |
Str | Striatum |
Tp | Transplant |
V | Ventricle |
WT | Wild-Type |
ZI | Zona Inserta |
References
- Barker, R.A.; Parmar, M.; Studer, L.; Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson’s Disease: Dawn of a New Era. Cell Stem Cell 2017, 21, 569–573. [Google Scholar] [CrossRef]
- Schweitzer, J.S.; Song, B.; Herrington, T.M.; Park, T.-Y.; Lee, N.; Ko, S.; Jeon, J.; Cha, Y.; Kim, K.; Li, Q.; et al. Personalized iPSC-Derived Dopamine Progenitor Cells for Parkinson’s Disease. N. Engl. J. Med. 2020, 382, 1926–1932. [Google Scholar] [CrossRef]
- Bachoud-Lévi, A.C. From open to large-scale randomized cell transplantation trials in Huntington’s disease: Lessons from the multicentric intracerebral grafting in Huntington’s disease trial (MIG-HD) and previous pilot studies. Prog. Brain Res. 2017, 230, 227–261. [Google Scholar] [CrossRef]
- Bachoud-Lévi, A.C. On behalf the Multicentric Intracerebral Grafting in Huntington’s Disease Group. Human Fetal Cell Therapy in Huntington’s Disease: A Randomized, Multicenter, Phase II Trial. Mov. Disord. 2020, 35, 1323–1335. [Google Scholar] [CrossRef]
- Bachoud-Lévi, A.C.; Massart, R.; Rosser, A. Cell therapy in Huntington’s disease: Taking stock of past studies to move the field forward. Stem Cells 2021, 39, 144–155. [Google Scholar] [CrossRef] [PubMed]
- Aubry, L.; Bugi, A.; Lefort, N.; Rousseau, F.; Peschanski, M.; Perrier, A.L. Striatal progenitors derived from human ES cells mature into DARPP32 neurons in vitro and in quinolinic acid-lesioned rats. Proc. Natl. Acad. Sci. USA 2008, 105, 16707–16712. [Google Scholar] [CrossRef]
- Arber, C.; Precious, S.V.; Cambray, S.; Risner-Janiczek, J.R.; Kelly, C.; Noakes, Z.; Fjodorova, M.; Heuer, A.; Ungless, M.A.; Rodríguez, T.A.; et al. Activin A directs striatal projection neuron differentiation of human pluripotent stem cells. Development 2015, 142, 1375–1386. [Google Scholar] [CrossRef] [PubMed]
- Adil, M.M.; Gaj, T.; Rao, A.T.; Kulkarni, R.U.; Fuentes, C.M.; Ramadoss, G.N.; Ekman, F.K.; Miller, E.W.; Schaffer, D.V. hPSC-Derived Striatal Cells Generated Using a Scalable 3D Hydrogel Promote Recovery in a Huntington Disease Mouse Model. Stem Cell Rep. 2018, 10, 1481–1491. [Google Scholar] [CrossRef]
- Besusso, D.; Schellino, R.; Boido, M.; Belloli, S.; Parolisi, R.; Conforti, P.; Faedo, A.; Cernigoj, M.; Campus, I.; Laporta, A.; et al. Stem Cell-Derived Human Striatal Progenitors Innervate Striatal Targets and Alleviate Sensorimotor Deficit in a Rat Model of Huntington Disease. Stem Cell Rep. 2020, 14, 876–891. [Google Scholar] [CrossRef] [PubMed]
- Victor, M.B.; Richner, M.; Hermanstyne, T.O.; Ransdell, J.L.; Sobieski, C.; Deng, P.-Y.; Klyachko, V.A.; Nerbonne, J.M.; Yoo, A.S. Generation of human striatal neurons by microRNA-dependent direct conversion of fibroblasts. Neuron 2014, 84, 311–323. [Google Scholar] [CrossRef] [PubMed]
- Richner, M.; Victor, M.B.; Liu, Y.; Abernathy, D.; Yoo, A.S. MicroRNA-based conversion of human fibroblasts into striatal medium spiny neurons. Nat. Protoc. 2015, 10, 1543–1555. [Google Scholar] [CrossRef] [PubMed]
- Huh, C.J.; Zhang, B.; Victor, M.B.; Dahiya, S.; Batista, L.F.; Horvath, S.; Yoo, A.S.; Angeles, L.; States, U. Maintenance of age in human neurons generated by microRNA-based neuronal conversion of fibroblasts. Elife 2016, 5, e18648. [Google Scholar] [CrossRef]
- Svendsen, S.P.; Svendsen, C.N. Cell therapy for neurological disorders. Nat. Med. 2024, 30, 2756–2770. [Google Scholar] [CrossRef]
- Guo, J.L.; Lee, V.M. Cell-to-cell transmission of pathogenic proteins in neurodegenerative diseases. Nat. Med. 2014, 20, 130–138. [Google Scholar] [CrossRef]
- Kordower, J.H.; Chu, Y.; Hauser, R.A.; Freeman, T.B.; Olanow, C.W. Lewy body-like pathology in long-term embryonic nigral transplants in Parkinson’s disease. Nat. Med. 2008, 14, 504–506. [Google Scholar] [CrossRef] [PubMed]
- Li, J.Y.; Englund, E.; Holton, J.L.; Soulet, D.; Hagell, P.; Lees, A.J.; Lashley, T.; Quinn, N.P.; Rehncrona, S.; Björklund, A.; et al. Lewy bodies in grafted neurons in subjects with Parkinson’s disease suggest host-to-graft disease propagation. Nat. Med. 2008, 14, 501–503. [Google Scholar] [CrossRef] [PubMed]
- Masnata, M.; Cicchetti, C. The Evidence for the Spread and Seeding Capacities of the Mutant Huntingtin Protein in in Vitro Systems and Their Therapeutic Implications. Front. Neurosci. 2017, 11, 647. [Google Scholar] [CrossRef] [PubMed]
- Masnata, M.; Sciacca, G.; Maxan, A.; Bousset, L.; Denis, H.L.; Lauruol, F.; David, L.; Saint-Pierre, M.; Kordower, J.H.; Melki, R.; et al. Demonstration of prion-like properties of mutant huntingtin fibrils in both in vitro and in vivo paradigms. Acta Neuropathol. 2019, 137, 981–1001. [Google Scholar] [CrossRef] [PubMed]
- Pecho-Vrieseling, E.; Rieker, C.; Fuchs, S.; Bleckmann, D.; Esposito, M.S.; Botta, P.; Goldstein, C.; Bernhard, M.; Galimberti, I.; Müller, M.; et al. Transneuronal propagation of mutant huntingtin contributes to non-cell autonomous pathology in neurons. Nat. Neurosci. 2014, 17, 1064–1072. [Google Scholar] [CrossRef] [PubMed]
- Gosset, P.; Maxan, A.; Alpaugh, M.; Breger, L.; Dehay, B.; Tao, Z.; Ling, Z.; Qin, C.; Cisbani, G.; Fortin, N.; et al. Evidence for the spread of human-derived mutant huntingtin protein in mice and non-human primates. Neurobiol. Dis. 2020, 141, 104941. [Google Scholar] [CrossRef]
- Jeon, I.; Cicchetti, F.; Cisbani, G.; Lee, S.; Li, E.; Bae, J.; Lee, N.; Li, L.; Im, W.; Kim, M.; et al. Human-to-mouse prion-like propagation of mutant huntingtin protein. Acta Neuropathol. 2016, 132, 577–592. [Google Scholar] [CrossRef] [PubMed]
- Cicchetti, F.; Lacroix, S.; Cisbani, G.; Vallières, N.; Saint-Pierre, M.; St-Amour, I.; Tolouei, R.; Skepper, J.N.; Hauser, R.A.; Mantovani, D.; et al. Mutant huntingtin is present in neuronal grafts in Huntington disease patients. Ann. Neurol. 2014, 76, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Cisbani, G.; Maxan, A.; Kordower, J.H.; Planel, E.; Freeman, T.B.; Cicchetti, F. Presence of tau pathology within foetal neural allografts in patients with Huntington’s and Parkinson’s disease. Brain 2017, 140, 2982–2992. [Google Scholar] [CrossRef] [PubMed]
- Espuny-Camacho, I.; Arranz, A.M.; Fiers, M.; Snellinx, A.; Ando, K.; Munck, S.; Bonnefont, J.; Lambot, L.; Corthout, N.; Omodho, L.; et al. Hallmarks of Alzheimer’s Disease in Stem-Cell-Derived Human Neurons Transplanted into Mouse Brain. Neuron 2017, 93, 1066–1081. [Google Scholar] [CrossRef]
- Hoban, D.B.; Shrigley, S.; Mattsson, B.; Breger, L.S.; Jarl, U.; Cardoso, T.; Wahlestedt, J.N.; Luk, K.C.; Björklund, A.; Parmar, M. Impact of α-synuclein pathology on transplanted hESC-derived dopaminergic neurons in a humanized α-synuclein rat model of PD. Proc. Natl. Acad. Sci. USA 2020, 117, 15209–15220. [Google Scholar] [CrossRef] [PubMed]
- Linaro, D.; Vermaercke, B.; Iwata, R.; Ramaswamy, A.; Libé-Philippot, B.; Boubakar, L.; Davis, B.A.; Wierda, K.; Davie, K.; Poovathingal, S.; et al. Xenotransplanted Human Cortical Neurons Reveal Species-Specific Development and Functional Integration into Mouse Visual Circuits. Neuron 2019, 104, 972–986. [Google Scholar] [CrossRef] [PubMed]
- Berry, B.J.; Akanda, N.; Smith, A.S.; Long, C.J.; Schnepper, M.T.; Guo, X.; Hickman, J.J. Morphological and functional characterization of human induced pluripotent stem cell-derived neurons (iCell Neurons) in defined culture systems. Biotechnol. Prog. 2015, 31, 1613–1622. [Google Scholar] [CrossRef] [PubMed]
- Wakeman, D.R.; Hiller, B.M.; Marmion, D.J.; McMahon, C.W.; Corbett, G.T.; Mangan, K.P.; Ma, J.; Little, L.E.; Xie, Z.; Perez-Rosello, T.; et al. Cryopreservation Maintains Functionality of Human iPSC Dopamine Neurons and Rescues Parkinsonian Phenotypes In Vivo. Stem Cell Rep. 2017, 9, 149–161. [Google Scholar] [CrossRef]
- Okano, H.; Morimoto, S. iPSC-based disease modeling and drug discovery in cardinal neurodegenerative disorders. Cell Stem Cell 2022, 29, 189–208. [Google Scholar] [CrossRef] [PubMed]
- Mattis, V.B.; Wakeman, D.R.; Tom, C.; Dodiya, H.B.; Yeung, S.Y.; Tran, A.H.; Bernau, K.; Ornelas, L.; Sahabian, A.; Reidling, J.; et al. Neonatal immune-tolerance in mice does not prevent xenograft rejection. Exp. Neurol. 2014, 254, 90–98. [Google Scholar] [CrossRef] [PubMed]
- Pollock, K.; Dahlenburg, H.; Nelson, H.; Fink, K.D.; Cary, W.; Hendrix, K.; Annett, G.; Torrest, A.; Deng, P.; Gutierrez, J.; et al. Human Mesenchymal Stem Cells Genetically Engineered to Overexpress Brain-derived Neurotrophic Factor Improve Outcomes in Huntington’s Disease Mouse Models. Mol. Ther. 2016, 24, 965–977. [Google Scholar] [CrossRef] [PubMed]
- Kriks, S.; Shim, J.W.; Piao, J.; Ganat, Y.M.; Wakeman, D.R.; Xie, Z.; Carrillo-Reid, L.; Auyeung, G.; Antonacci, C.; Buch, A.; et al. Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease. Nature 2011, 480, 547–551. [Google Scholar] [CrossRef]
- Haythornthwaite, A.; Stoelzle, S.; Hasler, A.; Kiss, A.; Mosbacher, J.; George, M.; Brüggemann, A.; Fertig, N. Characterizing human ion channels in induced pluripotent stem cell-derived neurons. J. Biomol. Screen. 2012, 17, 1264–1272. [Google Scholar] [CrossRef]
- Wijdicks, E.F. Neurotoxicity of immunosuppressive drugs. Liver Transpl. 2001, 7, 937–942. [Google Scholar] [CrossRef] [PubMed]
- Mangiarini, L.; Sathasivam, K.; Seller, M.; Cozens, B.; Harper, A.; Hetherington, C.; Lawton, M.; Trottier, Y.; Lehrach, H.; Davies, S.W.; et al. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 1996, 87, 493–506. [Google Scholar] [CrossRef] [PubMed]
- Doerr, J.; Schwarz, M.K.; Wiedermann, D.; Leinhaas, A.; Jakobs, A.; Schloen, F.; Schwarz, I.; Diedenhofen, M.; Braun, N.C.; Koch, P.; et al. Whole-brain 3D mapping of human neural transplant innervation. Nat. Commun. 2017, 8, 14162. [Google Scholar] [CrossRef] [PubMed]
- Asher, D.M.; Belay, E.; Bigio, E.; Brandner, S.; A Brubaker, S.; Caughey, B.; Clark, B.; Damon, I.; Diamond, M.; Freund, M.; et al. Risk of Transmissibility From Neurodegenerative Disease-Associated Proteins: Experimental Knowns and Unknowns. J. Neuropathol. Exp. Neurol. 2020, 79, 1141–1146. [Google Scholar] [CrossRef] [PubMed]
- Gibbons, G.S.; Kim, S.J.; Wu, Q.; Riddle, D.M.; Leight, S.N.; Changolkar, L.; Xu, H.; Meymand, E.S.; O’reilly, M.; Zhang, B.; et al. Conformation-selective tau monoclonal antibodies inhibit tau pathology in primary neurons and a mouse model of Alzheimer’s disease. Mol. Neurodegener. 2020, 15, 64. [Google Scholar] [CrossRef]
- Grealish, S.; Heuer, A.; Cardoso, T.; Kirkeby, A.; Jönsson, M.; Johansson, J.; Björklund, A.; Jakobsson, J.; Parmar, M. Monosynaptic Tracing using Modified Rabies Virus Reveals Early and Extensive Circuit Integration of Human Embryonic Stem Cell-Derived Neurons. Stem Cell Rep. 2015, 4, 975–983. [Google Scholar] [CrossRef]
- Cardoso, T.; Adler, A.F.; Mattsson, B.; Hoban, D.B.; Nolbrant, S.; Wahlestedt, J.N.; Kirkeby, A.; Grealish, S.; Björklund, A.; Parmar, M. Target-specific forebrain projections and appropriate synaptic inputs of hESC-derived dopamine neurons grafted to the midbrain of parkinsonian rats. J. Comp. Neurol. 2018, 526, 2133–2146. [Google Scholar] [CrossRef]
- Adler, A.F.; Cardoso, T.; Nolbrant, S.; Mattsson, B.; Hoban, D.B.; Jarl, U.; Wahlestedt, J.N.; Grealish, S.; Björklund, A.; Parmar, M. hESC-Derived Dopaminergic Transplants Integrate into Basal Ganglia Circuitry in a Preclinical Model of Parkinson’s Disease. Cell Rep. 2019, 28, 3462–3473. [Google Scholar] [CrossRef]
- Xiong, M.; Tao, Y.; Gao, Q.; Feng, B.; Yan, W.; Zhou, Y.; Kotsonis, T.A.; Yuan, T.; You, Z.; Wu, Z.; et al. Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell 2021, 28, 112–126. [Google Scholar] [CrossRef] [PubMed]
- Fink, K.D.; Crane, A.T.; Lévêque, X.; Dues, D.J.; Huffman, L.D.; Moore, A.C.; Story, D.T.; DeJonge, R.E.; Antcliff, A.; Starski, P.A.; et al. Intrastriatal transplantation of adenovirus-generated induced pluripotent stem cells for treating neuropathological and functional deficits in a rodent model of Huntington’s disease. Stem Cells Transl. Med. 2014, 3, 620–631. [Google Scholar] [CrossRef]
- Pouladi, M.A.; Morton, A.J.; Hayden, M.R. Choosing an animal model for the study of Huntington’s disease. Nat. Rev. Neurosci. 2013, 14, 708–721. [Google Scholar] [CrossRef] [PubMed]
- Gray, M.; Shirasaki, D.I.; Cepeda, C.; André, V.M.; Wilburn, B.; Lu, X.H.; Tao, J.; Yamazaki, I.; Li, S.H.; Sun, Y.E.; et al. Full-length human mutant huntingtin with a stable polyglutamine repeat can elicit progressive and selective neuropathogenesis in BACHD mice. J. Neurosci. 2008, 28, 6182–6195. [Google Scholar] [CrossRef]
- Slow, E.J.; van Raamsdonk, J.; Rogers, D.; Coleman, S.H.; Graham, R.K.; Deng, Y.; Oh, R.; Bissada, N.; Hossain, S.M.; Yang, Y.-Z.; et al. Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease. Hum. Mol. Genet. 2003, 12, 1555–1567. [Google Scholar] [CrossRef] [PubMed]
- Nair, R.R.; Corrochano, S.; Gasco, S.; Tibbit, C.; Thompson, D.; Maduro, C.; Ali, Z.; Fratta, P.; Arozena, A.A.; Cunningham, T.J.; et al. Uses for humanised mouse models in precision medicine for neurodegenerative disease. Mamm. Genome 2019, 30, 173–191. [Google Scholar] [CrossRef]
- Chavan, S.S.; Pavlov, V.A.; Tracey, K.J. Mechanisms and Therapeutic Relevance of Neuro-immune Communication. Immunity 2017, 46, 927–942. [Google Scholar] [CrossRef]
- Paolicelli, R.C.; Bolasco, G.; Pagani, F.; Maggi, L.; Scianni, M.; Panzanelli, P.; Giustetto, M.; Ferreira, T.A.; Guiducci, E.; Dumas, L.; et al. Synaptic pruning by microglia is necessary for normal brain development. Science 2011, 333, 1456–1458. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.; Lee, H.J.; Masliah, E.; Lee, S.-J. Non-cell-autonomous Neurotoxicity of α-synuclein Through Microglial Toll-like Receptor 2. Exp. Neurobiol. 2016, 25, 113–119. [Google Scholar] [CrossRef]
- Leng, F.; Edison, P. Neuroinflammation and microglial activation in Alzheimer disease: Where do we go from here? Nat. Rev. Neurol. 2020, 17, 157–172. [Google Scholar] [CrossRef]
- Abud, E.M.; Ramirez, R.N.; Martinez, E.S.; Healy, L.M.; Nguyen, C.H.H.; Newman, S.A.; Yeromin, A.V.; Scarfone, V.M.; Marsh, S.E.; Fimbres, C.; et al. iPSC-Derived Human Microglia-like Cells to Study Neurological Diseases. Neuron 2017, 94, 278–293. [Google Scholar] [CrossRef] [PubMed]
- National Academies of Sciences, Engineering, and Medicine; Policy and Global Affairs; Committee on Science, Technology, and Law; Committee on Ethical, Legal, and Regulatory Issues Associated with Neural Chimeras and Organoids. The Emerging Field of Human Neural Organoids, Transplants, and Chimeras: Science, Ethics, and Governance; National Academies Press: Washington, DC, USA, 2021. [Google Scholar] [CrossRef]
- Jeziorski, J.; Brandt, R.; Evans, J.H.; Campana, W.; Kalichman, M.; Thompson, E.; Goldstein, L.; Koch, C.; Muotri, A.R. Brain organoids, consciousness, ethics and moral status. Semin. Cell Dev. Biol. 2023, 144, 97–102. [Google Scholar] [CrossRef] [PubMed]
ID | Forward Primer | Reverse Primer |
---|---|---|
GAPDH | GAACGGGAAGCTTGTCATCAA | ATCGCCCCACTTGATTTTGG |
DLG4 | AGCTGGAGCAGGAGTTCAC | ACACGCTTCACCTTGTGGTA |
FOXG1 | GCCAGCAGCACTTTGAGTTA | TGAGTCAACACGGAGCTGTA |
DLX1 | CATGACCACCATGCCAGAAA | CGGCCCAAACTCCATAAACA |
DLX2 | TTCGTCCCCAGCCAACAA | TGGCTTCCCGTTCACTATCC |
SLC32A1 | AGGCTGGAACGTGACCAAC | GAGAAACAACCCCAGGTAGCC |
GAD2 | CTGCTCCAAAGTGGATGTCAAC | AAAGTGGGCCTTTCTCCATCA |
GAD1 | ATCCTGGTTGACTGCAGAGAC | CCAGTGGAGAGCTGGTTGAA |
SOX1 | GGGTCAAACGGCCCATGAA | TTGTGCATCTTGGGGTTCTCC |
CUX2 | TCCATCACCAAGAGGGTGAA | CAGGATGCTTTCCCCAAACA |
RELN | TCCAGAATTGGAAGCGGATCA | GTTGGCCTGAATCCATCTGAAC |
SYN1 | GCAAGGACGGAAGGGATCA | TGTCTTCATCCTGGTGGTCAC |
HTR2C | AGACTGAAGCAATCATGGTGAAC | TGCTACTGGGCTCACAGAAA |
PAX6 | CCCCACATATGCAGACACACA | GAACTGACACACCAGGGGAAA |
NR4A2 | TGGCTGTTGGGATGGTCAAA | TCTTCGGTTTCGAGGGCAAA |
FOXP2 | AGGGACTCATCTCCATTCCA | GCTGAATCTCAGCAGGACTTA |
POU3F2 | CGGATCAAACTGGGATTTACCC | CGAGAACACGTTGCCATACA |
BCL11B | CAACCCGCAGCACTTGTC | CCTCGTCTTCTTCGAGGATGG |
ISL1 | TCGCCTTGCAGAGTGACATA | CCCGGTCCTCCTTCTGAAAA |
TBR1 | ACGAACAACAAAGGAGCTTCA | TGGTACTTGTGCAAGGACTGTA |
SLC17A6 | TGGGGCTACATCATCACTCA | GAAGTATGGCAGCTCCGAAA |
EMX2 | GCCCCATAAATCCGTTCCTCA | CAAGTCCGGGTTGGAGTAGAC |
LHX2 | CAAAAGACGGGCCTCACCAA | CGTAAGAGGTTGCGCCTGAA |
NEUROG1 | CGACACCAAGCTCACCAAAA | CCAGAGCCCAGATGTAGTTGTA |
ETV1 | AGCCGTTCACTCCGCTATTA | AAGGGCTTCTGGATCACACA |
ASCL1 | TGGTGCGAATGGACTTTGGAA | CTCCCAACGCCACTGACAA |
CALB2 | TTGGCGGAAGTACGACACA | CCTTCTTCAGCAGGTCTGACA |
SST | CCCAGACTCCGTCAGTTTCT | AGCAGCTCTGCCAAGAAGTA |
SATB2 | TTTGCCAAAGTGGCTGCAAA | TTTCTGGGCTTGGGTTCTCC |
NKX2-1 | GATGGTACGGCGCCAAC | CCATGCCGCTCATGTTCA |
Animal | Vendor | Number (Sex) | Sacrifice |
---|---|---|---|
Sprague Dawley Rat | Harlan Laboratories | 3 (Female) | 3 Months |
RNU Nude | Charles River Laboratories | 1 (Male) | 7 Days |
RNU Nude | Charles River Laboratories | 5 (Male) | 9 Months |
R6/NSG WT | UC Davis Stem Cell Program | 2 (Female) | 3 Months |
R6/NSG Tg | UC Davis Stem Cell Program | 3 (Female) | 3 Months |
R6/NSG Tg | UC Davis Stem Cell Program | 9 (Female) | 6 Months |
Cynomolgus Monkey | University of Illinois at Chicago | 2 (Male) | 1 Month |
Primary Antibody | Species | Company | Catalog# | Dilution | Assay |
---|---|---|---|---|---|
Calbindin (C26D12) | Rabbit | Cell Signaling | 2173 | 1:200 | IHC |
DARPP32 | Rabbit | Abcam | ab-40801 | 1:5000 | IHC |
Human Nuclei | Mouse | Millipore | MAB1281 | 1:400 | IHC |
Human NCAM (Eric-1) | Mouse | Santa Cruz | sc-106 | 1:1000 | IHC |
Human Cytoplasm | Mouse | Takara | SC121 | 1:1000 | IHC |
Ki-67 | Rabbit | Abcam | ab-15580 | 1:500 | IHC |
mEM48 | Mouse | Millipore-Sigma | MAB5374 | 1:500 | IHC |
NeuN | Rabbit | Abcam | ab177487 | 1:1000 | IHC |
Map2 | Rabbit | Abcam | ab183830 | 1:1000 | IHC |
anti-Mouse AF-555 | Donkey | Molecular Probes | A31570 | 1:500 | IHC |
anti-Rabbit AF-488 | Donkey | Molecular Probes | A21206 | 1:500 | IHC |
anti-Rabbit AF-594 | Goat | LifeTech | A32740 | 1:500 | IHC |
anti-Mouse AF-488 | Goat | LifeTech | A32723 | 1:500 | IHC |
Animal #, Graft | Estimated Number of HuNuclei+ Cells | Coefficient of Error (Gundersen), m = 1 | % Survival |
---|---|---|---|
#29, Left Caudate | 116,505.62 | 0.06 | 25.89 |
#30, Left Caudate | 217,355.33 | 0.04 | 48.30 |
#33, Left Caudate | 956.19 | 0.16 | 0.21 |
#34, Left Caudate | 165,083.25 | 0.08 | 36.69 |
#35, Left Caudate | 97,738.29 | 0.10 | 21.72 |
#29, Right Caudate | 129,043.14 | 0.06 | 28.68 |
#30, Right Caudate | 123,517.76 | 0.10 | 27.45 |
#33, Right Caudate | 116,236.52 | 0.08 | 25.83 |
#34, Right Caudate | 156,574.52 | 0.05 | 34.79 |
#35, Right Caudate | 109,047.51 | 0.07 | 24.23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marmion, D.J.; Deng, P.; Hiller, B.M.; Lewis, R.L.; Harms, L.J.; Cameron, D.L.; Nolta, J.A.; Kordower, J.H.; Fink, K.D.; Wakeman, D.R. Long-Term Engraftment of Cryopreserved Human Neurons for In Vivo Disease Modeling in Neurodegenerative Disease. Biology 2025, 14, 217. https://doi.org/10.3390/biology14020217
Marmion DJ, Deng P, Hiller BM, Lewis RL, Harms LJ, Cameron DL, Nolta JA, Kordower JH, Fink KD, Wakeman DR. Long-Term Engraftment of Cryopreserved Human Neurons for In Vivo Disease Modeling in Neurodegenerative Disease. Biology. 2025; 14(2):217. https://doi.org/10.3390/biology14020217
Chicago/Turabian StyleMarmion, David J., Peter Deng, Benjamin M. Hiller, Rachel L. Lewis, Lisa J. Harms, David L. Cameron, Jan A. Nolta, Jeffrey H. Kordower, Kyle D. Fink, and Dustin R. Wakeman. 2025. "Long-Term Engraftment of Cryopreserved Human Neurons for In Vivo Disease Modeling in Neurodegenerative Disease" Biology 14, no. 2: 217. https://doi.org/10.3390/biology14020217
APA StyleMarmion, D. J., Deng, P., Hiller, B. M., Lewis, R. L., Harms, L. J., Cameron, D. L., Nolta, J. A., Kordower, J. H., Fink, K. D., & Wakeman, D. R. (2025). Long-Term Engraftment of Cryopreserved Human Neurons for In Vivo Disease Modeling in Neurodegenerative Disease. Biology, 14(2), 217. https://doi.org/10.3390/biology14020217