Molecular Cloning and Characterization of Estrogen-Related Receptor Gene in Corbicula fluminea: Expression Profiles in Response to Bisphenol A and Its Substitutes Exposure
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Pollutants Preparation
2.2. RACE Cloning of CfERR Gene
2.2.1. RNA Extraction and First-Strand cDNA Synthesis
2.2.2. The 5′ and 3′ RACE Experiment
2.2.3. Sequence Assembly and Open Reading Frame (ORF) Prediction of the CfERR
2.3. Bioinformatics of CfERR
2.4. Tissue-Specific Analysis of the CfERR
2.5. Expression of the CfERR Gene Under Long-Term Exposure to BPA and Its Substitutes
2.6. Statistical Analyses
3. Results
3.1. Cloning and Bioinformatics Analysis of the CfERR
3.1.1. Sequence Analysis of the CfERR
3.1.2. Homology and Phylogenetic Analysis of the CfERR
3.2. Tissue-Specific Expression Analysis of CfERR
3.3. Expression of the CfERR Gene Under 28-Day Exposure to BPA and Its Substitutes
4. Discussion
4.1. The Evolutionary Analysis of ERRs in Bivalve Mollusks
4.2. The Tissue-Specific Expression Analysis of ERRs in Bivalve Mollusks
4.3. Effects of EDCs on ERR Expression in Bivalve Mollusks
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pironti, C.; Ricciardi, M.; Proto, A.; Bianco, P.M.; Montano, L.; Motta, O. Endocrine-Disrupting Compounds: An Overview on Their Occurrence in the Aquatic Environment and Human Exposure. Water 2021, 13, 1347. [Google Scholar] [CrossRef]
- Gupta, A.; Singh, A.; Mishra, V.K. Impact of Bisphenol-A in the Environment and Its Removal through Biological Agents: A Review. Environ. Qual. Manag. 2024, 34, e22246. [Google Scholar] [CrossRef]
- Chen, D.; Kannan, K.; Tan, H.; Zheng, Z.; Feng, Y.-L.; Wu, Y.; Widelka, M. Bisphenol Analogues Other than BPA: Environmental Occurrence, Human Exposure, and Toxicity—A Review. Environ. Sci. Technol. 2016, 50, 5438–5453. [Google Scholar] [CrossRef] [PubMed]
- Rochester, J.R.; Bolden, A.L. Bisphenol S and F: A Systematic Review and Comparison of the Hormonal Activity of Bisphenol A Substitutes. Environ. Health Perspect. 2015, 123, 643–650. [Google Scholar] [CrossRef] [PubMed]
- Moreman, J.; Lee, O.; Trznadel, M.; David, A.; Kudoh, T.; Tyler, C.R. Acute Toxicity, Teratogenic, and Estrogenic Effects of Bisphenol A and Its Alternative Replacements Bisphenol S, Bisphenol F, and Bisphenol AF in Zebrafish Embryo-Larvae. Environ. Sci. Technol. 2017, 51, 12796–12805. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.-Y.; Ren, X.-M.; Li, C.-H.; Zhang, J.; Qin, W.-P.; Yang, Y.; Wan, B.; Guo, L.-H. Bisphenol AF and Bisphenol B Exert Higher Estrogenic Effects than Bisphenol A via G Protein-Coupled Estrogen Receptor Pathway. Environ. Sci. Technol. 2017, 51, 11423–11430. [Google Scholar] [CrossRef]
- Wu, L.-H.; Zhang, X.-M.; Wang, F.; Gao, C.-J.; Chen, D.; Palumbo, J.R.; Guo, Y.; Zeng, E.Y. Occurrence of Bisphenol S in the Environment and Implications for Human Exposure: A Short Review. Sci. Total Environ. 2018, 615, 87–98. [Google Scholar] [CrossRef]
- Wan, Y.; Xia, W.; Yang, S.; Pan, X.; He, Z.; Kannan, K. Spatial Distribution of Bisphenol S in Surface Water and Human Serum from Yangtze River Watershed, China: Implications for Exposure through Drinking Water. Chemosphere 2018, 199, 595–602. [Google Scholar] [CrossRef]
- Li, Y.; Luh, C.J.; Burns, K.A.; Arao, Y.; Jiang, Z.; Teng, C.T.; Tice, R.R.; Korach, K.S. Endocrine-Disrupting Chemicals (EDCs): In Vitro Mechanism of Estrogenic Activation and Differential Effects on ER Target Genes. Environ. Health Perspect. 2013, 121, 459–466. [Google Scholar] [CrossRef]
- Cosmo, A.D.; Cristo, C.D.; Paolucci, M. Sex Steroid Hormone Fluctuations and Morphological Changes of the Reproductive System of the Female of Octopus vulgaris throughout the Annual Cycle. J. Exp. Zool. 2001, 289, 33–47. [Google Scholar] [CrossRef]
- Gauthier-Clerc, S.; Pellerin, J.; Amiard, J.C. Estradiol-17β and Testosterone Concentrations in Male and Female Mya arenaria (Mollusca Bivalvia) during the Reproductive Cycle. Gen. Comp. Endocrinol. 2006, 145, 133–139. [Google Scholar] [CrossRef] [PubMed]
- Osada, M.; Takamura, T.; Sato, H.; Mori, K. Vitellogenin Synthesis in the Ovary of Scallop, Patinopecten yessoensis: Control by Estradiol-17 β and the Central Nervous System. J. Exp. Zool. Part A Comp. Exp. Biol. 2003, 299A, 172–179. [Google Scholar] [CrossRef] [PubMed]
- Croll, R.P.; Wang, C. Possible Roles of Sex Steroids in the Control of Reproduction in Bivalve Molluscs. Aquaculture 2007, 272, 76–86. [Google Scholar] [CrossRef]
- De Lisa, E.; Paolucci, M.; Di Cosmo, A. Conservative Nature of Oestradiol Signalling Pathways in the Brain Lobes of Octopus vulgaris Involved in Reproduction, Learning and Motor Coordination. J. Neuroendocrinol. 2012, 24, 275–284. [Google Scholar] [CrossRef]
- Mangelsdorf, D.J.; Thummel, C.; Beato, M.; Herrlich, P.; Schütz, G.; Umesono, K.; Blumberg, B.; Kastner, P.; Mark, M.; Chambon, P.; et al. The Nuclear Receptor Superfamily: The Second Decade. Cell 1995, 83, 835–839. [Google Scholar] [CrossRef]
- Takayanagi, S.; Tokunaga, T.; Liu, X.; Okada, H.; Matsushima, A.; Shimohigashi, Y. Endocrine Disruptor Bisphenol A Strongly Binds to Human Estrogen-Related Receptor γ (ERRγ) with High Constitutive Activity. Toxicol. Lett. 2006, 167, 95–105. [Google Scholar] [CrossRef]
- Cheung, N.K.M.; Cheung, A.C.K.; Ye, R.R.; Ge, W.; Giesy, J.P.; Au, D.W.T. Expression Profile of Oestrogen Receptors and Oestrogen-Related Receptors Is Organ Specific and Sex Dependent: The Japanese medaka Oryzias latipes model. J. Fish Biol. 2013, 83, 295–310. [Google Scholar] [CrossRef]
- Tarrant, A.M.; Greytak, S.R.; Callard, G.V.; Hahn, M.E. Estrogen Receptor-Related Receptors in the Killifish Fundulus heteroclitus: Diversity, Expression, and Estrogen Responsiveness. J. Mol. Endocrinol. 2006, 37, 105–120. [Google Scholar] [CrossRef][Green Version]
- Tohyama, S.; Miyagawa, S.; Lange, A.; Ogino, Y.; Mizutani, T.; Tatarazako, N.; Katsu, Y.; Ihara, M.; Tanaka, H.; Ishibashi, H.; et al. Understanding the Molecular Basis for Differences in Responses of Fish Estrogen Receptor Subtypes to Environmental Estrogens. Environ. Sci. Technol. 2015, 49, 7439–7447. [Google Scholar] [CrossRef]
- Park, E.; Kumar, S.; Lee, B.; Kim, K.-J.; Seo, J.-E.; Choi, H.-S.; Lee, K. Estrogen Receptor-Related Receptor γ Regulates Testicular Steroidogenesis through Direct and Indirect Regulation of Steroidogenic Gene Expression. Mol. Cell. Endocrinol. 2017, 452, 15–24. [Google Scholar] [CrossRef]
- In, S.; Cho, H.; Lee, K.-W.; Won, E.-J.; Lee, Y.-M. Cloning and Molecular Characterization of Estrogen-Related Receptor (ERR) and Vitellogenin Genes in the Brackish Water Flea Diaphanosoma celebensis Exposed to Bisphenol A and Its Structural Analogues. Mar. Pollut. Bull. 2020, 154, 111063. [Google Scholar] [CrossRef]
- Bannister, R.; Beresford, N.; May, D.; Routledge, E.J.; Jobling, S.; Rand-Weaver, M. Novel Estrogen Receptor-Related Transcripts in Marisa cornuarietis; a Freshwater Snail with Reported Sensitivity to Estrogenic Chemicals. Environ. Sci. Technol. 2007, 41, 2643–2650. [Google Scholar] [CrossRef] [PubMed]
- Nagasawa, K.; Treen, N.; Kondo, R.; Otoki, Y.; Itoh, N.; Rotchell, J.M.; Osada, M. Molecular Characterization of an Estrogen Receptor and Estrogen-Related Receptor and Their Autoregulatory Capabilities in Two Mytilus Species. Gene 2015, 564, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Hu, Y.; Guo, J.; Yu, T.; Sun, L.; Xiao, X.; Zhu, D.; Nakanishi, T.; Hiromori, Y.; Li, J.; et al. Fluorene-9-Bisphenol Is Anti-Oestrogenic and May Cause Adverse Pregnancy Outcomes in Mice. Nat. Commun. 2017, 8, 14585. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Zhang, P.; Song, J.; Zhang, C.; Xu, R. Reproductive Risk Assessment of Bisphenol A and Its Substitutes on Estrogen Receptors (ERs) in Bivalves. Int. J. Mol. Sci. 2025, 26, 7969. [Google Scholar] [CrossRef]
- Li, Z.; Feng, C.; Pang, W.; Tian, C.; Zhao, Y. Nanoplastic-Induced Genotoxicity and Intestinal Damage in Freshwater Benthic Clams (Corbicula fluminea): Comparison with Microplastics. ACS Nano 2021, 15, 9469–9481. [Google Scholar] [CrossRef]
- Huang, Y.; Cartlidge, R.; Walpitagama, M.; Kaslin, J.; Campana, O.; Wlodkowic, D. Unsuitable Use of DMSO for Assessing Behavioral Endpoints in Aquatic Model Species. Sci. Total Environ. 2018, 615, 107–114. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Eick, G.N.; Thornton, J.W. Evolution of Steroid Receptors from an Estrogen-Sensitive Ancestral Receptor. Mol. Cell. Endocrinol. 2011, 334, 31–38. [Google Scholar] [CrossRef]
- Scholtes, C.; Giguère, V. Transcriptional Regulation of ROS Homeostasis by the ERR Subfamily of Nuclear Receptors. Antioxidants 2021, 10, 437. [Google Scholar] [CrossRef]
- Ni, J.; Zeng, Z.; Ke, C. Sex Steroid Levels and Expression Patterns of Estrogen Receptor Gene in the Oyster Crassostrea angulata during Reproductive Cycle. Aquaculture 2013, 376–379, 105–116. [Google Scholar] [CrossRef]
- Matsumoto, T.; Nakamura, A.M.; Mori, K.; Akiyama, I.; Hirose, H.; Takahashi, Y. Oyster Estrogen Receptor: cDNA Cloning and Immunolocalization. Gen. Comp. Endocrinol. 2007, 151, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Pan, L.; Zhang, L. Molecular Cloning and Characterization of Estrogen Receptor Gene in the Scallop Chlamys farreri: Expression Profiles in Response to Endocrine Disrupting Chemicals. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2012, 156, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Robinson-Rechavi, M.; Carpentier, A.-S.; Duffraisse, M.; Laudet, V. How Many Nuclear Hormone Receptors Are There in the Human Genome? Trends Genet. 2001, 17, 554–556. [Google Scholar] [CrossRef]
- Ding, M.; Han, L.; Miao, J.; Wang, X.; Wang, L.; Pan, L. Estrogen Receptor Knockdown Suggests Its Role in Gonadal Development Regulation in Manila Clam Ruditapes philippinarum. J. Steroid Biochem. Mol. Biol. 2024, 243, 106594. [Google Scholar] [CrossRef]
- Ciocan, C.M.; Cubero-Leon, E.; Minier, C.; Rotchell, J.M. Identification of Reproduction-Specific Genes Associated with Maturation and Estrogen Exposure in a Marine Bivalve Mytilus edulis. PLoS ONE 2011, 6, e22326. [Google Scholar] [CrossRef]
- Lü, Z.; Zhu, K.; Pang, Z.; Liu, L.; Jiang, L.; Liu, B.; Shi, H.; Ping, H.; Chi, C.; Gong, L. Identification, Characterization and mRNA Transcript Abundance Profiles of Estrogen Related Receptor (ERR) in Sepiella japonica Imply Its Possible Involvement in Female Reproduction. Anim. Reprod. Sci. 2019, 211, 106231. [Google Scholar] [CrossRef]
- Thornton, J.W. Evolution of Vertebrate Steroid Receptors from an Ancestral Estrogen Receptor by Ligand Exploitation and Serial Genome Expansions. Proc. Natl. Acad. Sci. USA 2001, 98, 5671–5676. [Google Scholar] [CrossRef]
- Patisaul, H.B. Endocrine Disruption by Dietary Phyto-Oestrogens: Impact on Dimorphic Sexual Systems and Behaviours. Proc. Nutr. Soc. 2016, 76, 130–144. [Google Scholar] [CrossRef]
- Lee, H.; Park, J.; Park, K. Mixture Effects of Bisphenol A and Its Structural Analogs on Estrogen Receptor Transcriptional Activation. Toxics 2023, 11, 986. [Google Scholar] [CrossRef]
- Okada, H.; Tokunaga, T.; Liu, X.; Takayanagi, S.; Matsushima, A.; Shimohigashi, Y. Direct Evidence Revealing Structural Elements Essential for the High Binding Ability of Bisphenol A to Human Estrogen-Related Receptor-γ. Environ. Health Perspect. 2008, 116, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Horard, B.; Vanacker, J.M. Estrogen Receptor-Related Receptors: Orphan Receptors Desperately Seeking a Ligand. J. Mol. Endocrinol. 2003, 31, 349–357. [Google Scholar] [CrossRef] [PubMed]
- Tišler, T.; Krel, A.; Gerželj, U.; Erjavec, B.; Dolenc, M.S.; Pintar, A. Hazard Identification and Risk Characterization of Bisphenols A, F and AF to Aquatic Organisms. Environ. Pollut. 2016, 212, 472–479. [Google Scholar] [CrossRef] [PubMed]
- Pivnenko, K.; Pedersen, G.A.; Eriksson, E.; Astrup, T.F. Bisphenol A and Its Structural Analogues in Household Waste Paper. Waste Manag. 2015, 44, 39–47. [Google Scholar] [CrossRef]
- Chen, Z.; Zhou, T.; Chen, X.; Huan, Z.; Huang, J.; Lu, S.; Zeng, M.; Guo, Y.; Wang, Z.; Dong, Z. Toxic Effects of Chronic Exposure to BPAF and Perturbation of Gut Microbiota Homeostasis in Marine Medaka (Oryzias melastigma). Sci. Total Environ. 2024, 957, 177745. [Google Scholar] [CrossRef]
- Morales, M.; Martínez-Paz, P.; Sánchez-Argüello, P.; Morcillo, G.; Martínez-Guitarte, J.L. Bisphenol A (BPA) Modulates the Expression of Endocrine and Stress Response Genes in the Freshwater Snail Physa acuta. Ecotoxicol. Environ. Saf. 2018, 152, 132–138. [Google Scholar] [CrossRef]
- Park, K.; Kwak, I.-S. Molecular Effects of Endocrine-Disrupting Chemicals on the Chironomus riparius Estrogen-Related Receptor Gene. Chemosphere 2010, 79, 934–941. [Google Scholar] [CrossRef]





| Purpose | Primer Name | Sequence (5′ to 3′) |
|---|---|---|
| 5′ RACE | B947-1(GSP1) | GTTTTATTGTCTGCGA |
| B947-2(GSP2) | TTTGTACGAATGGAAATGAA | |
| 3′ RACE | B947-3(GSP3) | GCACCCTGTCCAACCTCA |
| C583-1 (GSP1) | GAAACTCCACGAGGCTCTCACCGA | |
| C583-2(GSP2) | TAATGGTGGCCTCAAACGTGTCGG | |
| qRT-PCR | CfERR-S | AAAAACTCAAAGCCCACC |
| CfERR-A | GCTCAGACTCGCAAACC | |
| qRT-PCR | β-actin-S | GGCTGTGCTTTCATTGT |
| β-actin-A | TTTCTCTTTCGGCTGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, R.; Guo, W.; Zhang, P.; Zhang, C. Molecular Cloning and Characterization of Estrogen-Related Receptor Gene in Corbicula fluminea: Expression Profiles in Response to Bisphenol A and Its Substitutes Exposure. Biology 2025, 14, 1384. https://doi.org/10.3390/biology14101384
Xu R, Guo W, Zhang P, Zhang C. Molecular Cloning and Characterization of Estrogen-Related Receptor Gene in Corbicula fluminea: Expression Profiles in Response to Bisphenol A and Its Substitutes Exposure. Biology. 2025; 14(10):1384. https://doi.org/10.3390/biology14101384
Chicago/Turabian StyleXu, Ruiyi, Weili Guo, Pengyu Zhang, and Chunnuan Zhang. 2025. "Molecular Cloning and Characterization of Estrogen-Related Receptor Gene in Corbicula fluminea: Expression Profiles in Response to Bisphenol A and Its Substitutes Exposure" Biology 14, no. 10: 1384. https://doi.org/10.3390/biology14101384
APA StyleXu, R., Guo, W., Zhang, P., & Zhang, C. (2025). Molecular Cloning and Characterization of Estrogen-Related Receptor Gene in Corbicula fluminea: Expression Profiles in Response to Bisphenol A and Its Substitutes Exposure. Biology, 14(10), 1384. https://doi.org/10.3390/biology14101384
