Research on Function of Ribosomal Protein S6 Kinases, 1α and β, Based on Molecular Cloning and siRNA-Based Interference in Juvenile Blunt Snout Bream (Megalobrama amblycephala)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish Management and Sample Collection
2.2. Identification and cDNA Cloning
2.3. Sequence Characterization and Analysis
2.4. Knockdown of S6K1 in Liver
2.5. Gene Expression and qRT-PCR
2.6. Biostatistical Analysis
3. Results
3.1. Molecular Characterization of s6k1α and s6k1β
3.2. Sequence Alignment and Phylogenetic Analysis of S6k1α and S6k1β
3.3. Tissue Distribution of s6k1α and s6k1β mRNA in Megalobrama amblycephala
3.4. Knockdown of s6k1α and s6k1β by siRNA in Megalobrama amblycephala
3.5. Effects of s6k1α and s6k1β siRNA on Glycolysis- and Gluconeogenesis-Related Genes
4. Discussion
4.1. Molecular Characterization, Sequence Alignment, and Phylogenetic Analysis of s6k1α and s6k1β
4.2. Tissue Distribution of s6k1α and s6k1β mRNA in Megalobrama amblycephala
4.3. Knockdown of s6k1α and s6k1β by siRNA and Effects on Glycolysis- and Gluconeogenesis-Related Genes in Megalobrama amblycephala
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tang, H.; Hornstein, E.; Stolovich, M.; Levy, G.; Livingstone, M.; Templeton, D.; Avruch, J.; Meyuhas, O. Amino acid-induced translation of TOP mRNAs is fully dependent on phosphatidylinositol 3-kinase-mediated signaling, is partially inhibited by rapamycin, and is independent of S6K1 and rpS6 phosphorylation. Mol. Cell. Biol. 2001, 21, 8671–8683. [Google Scholar] [CrossRef] [PubMed]
- Dennis, P.B.; Jaeschke, A.; Saitoh, M.; Fowler, B.; Kozma, S.C.; Thomas, G. Mammalian TOR: A Homeostatic ATP Sensor. Science 2001, 294, 1102–1105. [Google Scholar] [CrossRef] [PubMed]
- Magnuson, B.; Ekim, B.; Fingar, D.C. Regulation and function of ribosomal protein S6 kinase (S6K) within mTOR signalling networks. Biochem. J. 2012, 441, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Ji, J.Y.; Ah, Y.S.; Jaecheol, L.; Jeung-Whan, H. Nuclear S6K1 regulates cAMP-responsive element-dependent gene transcription through activation of mTOR signal pathway. Biochem. Biophys. Res. Commun. 2022, 594, 101–108. [Google Scholar]
- Ignacio, C.M.; David, A.; Pablo, L.; Isaac, P.V.; Verónica, P. Hyperbaric oxygen treatment increases intestinal stem cell proliferation through the mTORC1/S6K1 signaling pathway in Mus musculus. Biol. Res. 2023, 56, 41. [Google Scholar]
- Fingar, D.C.; Salama, S.; Tsou, C.; Harlow, E.; Blenis, J. Mammalian cell size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Genes Dev. 2002, 16, 1472–1487. [Google Scholar] [CrossRef]
- Savinskaya, L.A.; Usenko, V.S.; Lyzogubov, V.V.; Pogrebnoy, P.V.; Pal'Chevsky, S.S.; Ovcharenko, G.V.; Cheshuk, V.S.; Gout, I.T.; Matsuka, G.K.; Filonenko, V.V. P70S6 kinase α and β isoforms expression in cell lines and breast tumors. Biopolym. Cell 2003, 1, 64–70. [Google Scholar] [CrossRef]
- Valovka, T.; Verdier, F.; Cramer, R.; Zhyvoloup, A.; Fenton, T.; Rebholz, H.; Wang, M.; Gzhegotsky, M.; Lutsyk, A.; Matsuka, G.; et al. Protein kinase C phosphorylates ribosomal protein S6 kinase βII and regulates its subcellular localization. Mol. Cell. Biol. 2003, 23, 852–863. [Google Scholar] [CrossRef]
- Elghazi, L.; Blandino-Rosano, M.; Alejandro, E.; Cras-Méneur, C.; Bernal-Mizrachi, E. Role of nutrients and mTOR signaling in the regulation of pancreatic progenitors development. Mol. Metab. 2017, 6, 560–573. [Google Scholar] [CrossRef]
- Rachdi, L.; Balcazar, N.; Osorio-Duque, F.; Elghazi, L.; Weiss, A.; Gould, A.; Chang-Chen, K.J.; Gambello, M.J.; Bernal-Mizrachi, E. Disruption of Tsc2 in pancreatic beta cells induces beta cell mass expansion and improved glucose tolerance in a TORC1-dependent manner. Proc. Natl. Acad. Sci. USA 2008, 105, 9250–9255. [Google Scholar] [CrossRef]
- Tavares, M.R.; Lemes, S.F.; de Fante, T.; de Miera, C.S.; Pavan, I.C.B.; Bezerra, R.M.N.; Prada, P.O.; Torsoni, M.A.; Elias, C.F.; Simabuco, F.M. Modulation of hypothalamic S6K1 and S6K2 alters feeding behavior and systemic glucose metabolism. J. Endocrinol. 2020, 244, 71–82. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Gao, Z.; Yin, J.; Quon, M.J.; Ye, J. S6K Directly Phosphorylates IRS-1 on Ser-270 to Promote Insulin Resistance in Response to TNF-α Signaling through IKK2. J. Biol. Chem. 2008, 283, 35375–35382. [Google Scholar] [CrossRef] [PubMed]
- Michael, K.; Barbara, B.; Attila, B.; Michaela, A.; Julia, S.; Peter, N.; Erich, R.; Clemens, F.; Miriam, P.; Christian, A.; et al. The Mammalian target of rapamycin pathway regulates nutrient-sensitive glucose uptake in man. Diabetes 2007, 56, 1600–1607. [Google Scholar]
- Karin, S.; Barbara, B.; Zsuzsanna, S.; Michael, K.; Anton, L.; Clemens, F. The effects of amino acids on glucose metabolism of isolated rat skeletal muscle are independent of insulin and the mTOR/S6K pathway. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E785–E792. [Google Scholar]
- Fenton, T.; Gout, I. Functions and regulation of the 70 kDa ribosomal S6 kinases. Int. J. Biochem. Cell Biol. 2011, 43, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Ren, Z.; Zeng, H.; Yao, B. Apparent digestibility of various feedstuffs for bluntnose black bream Megalobrama amblycephala Yih. Aquac. Nutr. 2008, 2, 153–165. [Google Scholar] [CrossRef]
- Hemre, G.; Mommsen, T.; Krogdahl, Å. Carbohydrates in fish nutrition:: Effects on growth, glucose metabolism and hepatic enzymes. Aquac. Nutr. 2002, 3, 175–194. [Google Scholar] [CrossRef]
- Liang, H.; Habte-Tsion, H.; Ge, X.; Ren, M.; Xie, J.; Miao, L.; Zhou, Q.; Lin, Y.; Pan, W. Dietary arginine affects the insulin signaling pathway, glucose metabolism and lipogenesis in juvenile blunt snout bream Megalobrama amblycephala. Sci. Rep. 2017, 7, 7864. [Google Scholar] [CrossRef]
- Liang, H.; Mokrani, A.; Chisomo-Kasiya, H.; Ji, K.; Ge, X.; Ren, M.; Liu, B.; Xi, B.; Sun, A. Dietary leucine affects glucose metabolism and lipogenesis involved in TOR/PI3K/Akt signaling pathway for juvenile blunt snout bream Megalobrama amblycephala. Fish Physiol. Biochem. 2019, 45, 719–732. [Google Scholar] [CrossRef]
- Gu, J.; Liang, H.; Ge, X.; Xia, D.; Pan, L.; Mi, H.; Ren, M. A study of the potential effect of yellow mealworm (Tenebrio molitor) substitution for fish meal on growth, immune and antioxidant capacity in juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 120, 214–221. [Google Scholar] [CrossRef]
- Amit, K.; Nir, B. Introduction to Proteins Structure, Function, and Motion; Taylor & Francis Group: Abingdon, UK, 2020; p. 932. [Google Scholar]
- Suganya, R.; Chen, S.; Lu, K. Target of rapamycin in the oriental fruit fly Bactrocera dorsalis (hendel): Its cloning and effect on yolk protein expression. Arch. Insect Biochem. Physiol. 2010, 75, 45–56. [Google Scholar] [CrossRef] [PubMed]
- Suganya, R.; Chen, S.; Lu, K. CDNA cloning and characterization of S6 kinase and its effect on yolk protein gene expression in the oriental fruit fly Bactrocera dorsalis (Hendel). Arch. Insect Biochem. Physiol. 2011, 78, 177–189. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Ai, T.; Yu, X.; Xu, B.; Guo, X. Molecular cloning and characterization of the S6K-p70 gene in Chinese honeybees, Apis cerana cerana (Hymenoptera: Apidae). Eur. J. Entomol. 2013, 110, 21–30. [Google Scholar] [CrossRef]
- Wu, M.; Bao, W.; Hao, X.; Zheng, X.; Wang, Y.; Wang, Z. Molecular Characterization and Expression Analysis of S6K1 in Cashmere Goats (Capra hircus). Asian-Australas. J. Anim. Sci. 2013, 8, 1057–1064. [Google Scholar]
- Muhammad, A.; Toufeeq, S.; Yu, H.; Wang, J.; Zhang, S. Molecular Characterization of Two Mitogen-Activated Protein Kinases: p38 MAP Kinase and Ribosomal S6 Kinase From Bombyx mori (Lepidoptera:Bombycidae), and Insight Into Their Roles in Response to BmNPV Infection. J. Insect Sci. (Online) 2019, 19, 15. [Google Scholar] [CrossRef]
- Gout, I.; Minami, T.; Hara, K.; Tsujishita, Y.; Filonenko, V.; Waterfield, M.D.; Yonezawa, K. Molecular Cloning and Characterization of a Novel p70 S6 Kinase, p70 S6 Kinase β Containing a Proline-rich Region. J. Biol. Chem. 1998, 273, 30061–30064. [Google Scholar] [CrossRef]
- Olivier, J.; JeanMarc, A.; Frédéric, B.; JeanLouis, P.; Nicole, S.; Evan, M.; Laurence, B.; Cécile, F.; Catherine, O.; Alain, B.; et al. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 2004, 431, 946–957. [Google Scholar]
- Sigmund, R.; Bjørn, H.; Knutsdatter, Ø.T.K.; Rune, A. A de novo Full-Length mRNA Transcriptome Generated From Hybrid-Corrected PacBio Long-Reads Improves the Transcript Annotation and Identifies Thousands of Novel Splice Variants in Atlantic Salmon. Front. Genet. 2021, 12, 656334. [Google Scholar]
- Egerton, S.; Culloty, S.; Jason, W.; Catherine, S.; Ross, P.R. The Gut Microbiota of Marine Fish. Front. Microbiol. 2018, 9, 873. [Google Scholar] [CrossRef]
- Chen, X.; Gao, Y.; Wu, G.; Gu, J.; Cai, Y.; Xu, J.; Cheng, H. Molecular cloning, tissue expression, and transcriptional regulation of fabp1 and fabp2 in javelin goby (Synechogobius hasta) in response to starvation stress. Comp. Biochem. Physiol. Part B 2020, 250, 110484. [Google Scholar] [CrossRef]
- Ferrari, S.; Thomas, G. S6 Phosphorylation and the p70s6k/p85s6k. Crit. Rev. Biochem. Mol. Biol. 2008, 29, 385–413. [Google Scholar] [CrossRef] [PubMed]
- Abuhagr, A.M.; MacLea, K.S.; Chang, E.S.; Mykles, D.L. Mechanistic target of rapamycin (mTOR) signaling genes in decapod crustaceans: Cloning and tissue expression of mTOR, Akt, Rheb, and p70 S6 kinase in the green crab, Carcinus maenas, and blackback land crab, Gecarcinus lateralis. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2014, 168, 25–39. [Google Scholar] [CrossRef] [PubMed]
- Bao, W.; Hao, X.; Zheng, X.; Liang, Y.; Chen, Y.; Wang, Y.; Wang, Z. Molecular Characterization and Expression Analysis of Ribosomal Protein S6 Gene in the Cashmere Goat (Capra hircus). Asian-Australas. J. Anim. Sci. 2013, 26, 1644–1650. [Google Scholar]
- Hansen, I.; Attardo, G.; Roy, S.; Raikhel, A. Target of rapamycin-dependent activation of S6 kinase is a central step in the transduction of nutritional signals during egg development in a mosquito. J. Biol. Chem. 2005, 280, 20565–20572. [Google Scholar] [CrossRef] [PubMed]
- Dixon, L.; Ford, P. Regulation of protein synthesis and accumulation during oogenesis in Xenopus laevis. Dev. Biol. 1982, 93, 478–497. [Google Scholar] [CrossRef]
- Arsic, D.; Guerin, P. Nutrient content of diet affects the signaling activity of the insulin/target of rapamycin/p70 S6 kinase pathway in the African malaria mosquito Anopheles gambiae. J. Insect Physiol. 2008, 54, 1226–1235. [Google Scholar] [CrossRef]
- Um, S.H.; D’Alessio, D.; Thomas, G. Nutrient overload, insulin resistance, and ribosomal protein S6 kinase 1, S6K1. Cell Metab. 2006, 3, 393–402. [Google Scholar] [CrossRef]
- Kim, E. Mechanisms of amino acid sensing in mTOR signaling pathway. Nutr. Res. Pract. 2009, 3, 64–71. [Google Scholar] [CrossRef]
- Li, Y.-N.; Cao, Y.-Q.; Wu, X.; Han, G.-S.; Wang, L.-X.; Zhang, Y.-H.; Chen, X.; Hao, B.; Yue, Z.-J.; Liu, J.-M. The association between Salt-inducible kinase 2 (SIK2) and gamma isoform of the regulatory subunit B55 of PP2A (B55gamma) contributes to the survival of glioma cells under glucose depletion through inhibiting the phosphorylation of S6K. Cancer Cell Int. 2015, 15, 21. [Google Scholar] [CrossRef]
- Castillo, J.; Crespo, D.; Capilla, E.; Díaz, M.; Chauvigné, F.; Cerdà, J.; Planas, J.V. Evolutionary structural and functional conservation of an ortholog of the GLUT2 glucose transporter gene (SLC2A2) in zebrafish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2009, 297, R1570–R1581. [Google Scholar] [CrossRef]
- Hassan, M.; Radina, E.; Sattar, G.; Mohammadreza, K. Assessment of Insulin, GLUT2 and inflammatory cytokines genes expression in pancreatic β-Cells in zebrafish (Danio rario) with overfeeding diabetes induction w/o glucose. J. Diabetes Metab. Disord. 2021, 20, 1567–1572. [Google Scholar]
- Massa, M.L.; Gagliardino, J.J.; Francini, F. Liver glucokinase: An overview on the regulatory mechanisms of its activity. Iubmb Life 2011, 63, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Li, C.Y.; Chen, H.T.; Guo, Y.A.; Li, L.L.; Ma, H.; Yang, Y.O.; Jin, S.Z.; Yuan, X.C. The regulation of PEPCK isoforms is the potential reason for the discrepancy in glucose utilization among fishes with different food habits. Aquac. Rep. 2022, 23, 101087. [Google Scholar] [CrossRef]
- Alexandre, C.; Reynolds, R.P.; Castorena, C.M.; Michael, N.J.; Lee, C.E.; Lee, S.; Berdeaux, R.; Scherer, P.E.; Elmquist, J.K. Adipocyte Gs but not Gi signaling regulates whole-body glucose homeostasis. Mol. Metab. 2019, 27, 11–21. [Google Scholar]
- Reyes, J.S.; Fuentes-Lemus, E.; Figueroa, J.D.; Rojas, J.; Fierro, A.; Arenas, F.; Hägglund, P.M.; Davies, M.J.; López-Alarcón, C. Implications of differential peroxyl radical-induced inactivation of glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase for the pentose phosphate pathway. Sci. Rep. 2022, 12, 21191. [Google Scholar] [CrossRef]
Genes | Primer Sequence (5′-3′) | Purpose | Accession No. |
---|---|---|---|
s6k1α-5′race | TGGCGAAAGATGGCAATC | CDS cloning | XP_017572395.1 |
s6k1α-3′race | TACCAGCTGAACAGACAGGACGCC | ||
s6k1β-5′race | AAGGCACGGAGCAGATTC | CDS cloning | XP_016416922.1 |
s6k1β-3′race | GGTGTCTAATGTGGAGCAGATGGA | ||
s6k1α-1489-F | GGGAGUUGCUGGAUAAGAUTT | siRNA knockdown | OR896619.1 |
s6k1α-1489-R | AUCUUAUCCAGCAACUCCCTT | ||
s6k1α-895-F | GGAGCCUAUUCAAACGAAATT | siRNA knockdown | OR896619.1 |
s6k1α-895-R | UUUCGUUUGAAUAGGCUCCTT | ||
s6k1α-979-F | CUACCAUUGACUGGAAUAATT | siRNA knockdown | OR896619.1 |
s6k1α-979-R | UUAUUCCAGUCAAUGGUAGTT | ||
s6k1β-584-F | GAGAACAUCAUGCUCAAUATT | siRNA knockdown | OR896620.1 |
s6k1β-584-R | UAUUGAGCAUGAUGUUCUCTT | ||
s6k1β-681-F | GUGGAACCAUAGAGUACAUTT | siRNA knockdown | OR896620.1 |
s6k1β-681-R | AUGUACUCUAUGGUUCCACTT | ||
s6k1β-354-F | GCAUCCUAGAGGAAGUUAATT | siRNA knockdown | OR896620.1 |
s6k1β-354-R | UUAACUUCCUCUAGGAUGCTT | ||
s6k1α-F | TCGAGGCAAAGGACTTGGTG | RT-PCR | OR896619.1 |
s6k1α-R | CGGGAGGGACGTTCCTATTC | ||
s6k1β-F | GCAGGTCCTCGAGATGCTTT | RT-PCR | OR896620.1 |
s6k1β-R | TGCGAGGTGAACGGGATTTT | ||
mtor-F | ATAGCACACCACAGGGCTTC | RT-PCR | OR902770.1 |
mtor-R | CCAGCAGGTGACCCATAGTG | ||
gk-F | GCTTCCACTGGGATTCACCT | RT-PCR | [19] |
gk-R | CGACGTTATTGCCTTCAGCG | ||
pk-F | CGAGATTGAGAACGGAGGCA | RT-PCR | [19] |
pk-R | GTCCTTCTCAGACACTGCGG | ||
g6pdh-F | TGGAGAAACCTTTTGGCCGT | RT-PCR | [19] |
g6pdh-R | CTGGGTACCAAACGGCTCTT | ||
glut2-F | CGGTGAAACCGAACAGGAGT | RT-PCR | [19] |
glut2-R | TTCTTTGAGATCGGGCCTGG | ||
pepck-F | TCGCCTGGATGAAGTTCGAC | RT-PCR | [19] |
pepck-R | GTCTTGGTGGAGGTTCCTGG | ||
gs-F | TTACACGGTCATTGCGTCCA | RT-PCR | [19] |
gs-R | GACACAGCTCAGTCGGTGAA | ||
g6p-F | TTCAGTGTCACGCTGTTCCT | RT-PCR | [19] |
g6p-R | TCTGGACTGACGCACCATTT | ||
β-actin-F | TCGTCCACCGCAAATGCTTCTA | RT-PCR | [19] |
β-actin-R | CCGTCACCTTCACCGTTCCAGT |
Index | S6k1α | S6k1β |
---|---|---|
molecular formula | C3736H5872N1008O1096S25 | C2472H3883N651O747S26 |
molecular weight | 83.247 KDa | 55.508 KDa |
theoretical pI | 6.64 | 5.47 |
extinction coefficient 1 | 77,240 | 39,880 |
instability index 2 | 45.66 | 42.30 |
estimated half-life 3 | 30 h/>20 h/>10 h | 30 h/>20 h/>10 h |
aliphatic index | 86.40 | 77.93 |
grand average of hydropathicity | −0.343 | −0.341 |
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | 99.9% | 98.8% | 98.2% | 98.2% | 98.0% | 97.4% | 97.8% | 94.6% | 78.2% | 80.0% | 79.2% | 79.3% | 79.3% | |
2 | 98.6% | 98.1% | 98.1% | 98.1% | 97.3% | 97.7% | 94.7% | 78.2% | 80.0% | 79.2% | 79.3% | 79.3% | ||
3 | 97.8% | 97.7% | 97.4% | 97.0% | 97.7% | 94.3% | 78.3% | 80.0% | 79.2% | 79.3% | 79.3% | |||
4 | 98.5% | 98.2% | 96.8% | 97.6% | 94.5% | 78.4% | 80.0% | 79.2% | 79.3% | 79.4% | ||||
5 | 99.1% | 96.6% | 97.7% | 94.0% | 78.5% | 79.9% | 79.2% | 79.3% | 79.4% | |||||
6 | 96.3% | 97.4% | 94.0% | 78.2% | 79.6% | 78.7% | 78.8% | 78.8% | ||||||
7 | 96.3% | 94.0% | 77.9% | 79.6% | 78.8% | 79.1% | 79.1% | |||||||
8 | 94.2% | 77.7% | 79.6% | 78.8% | 78.9% | 78.7% | ||||||||
9 | 77.3% | 79.3% | 78.1% | 78.4% | 78.0% | |||||||||
10 | 86.1% | 85.8% | 85.3% | 85.1% | ||||||||||
11 | 92.2% | 92.0% | 91.8% | |||||||||||
12 | 98.5% | 97.6% | ||||||||||||
13 | 98.2% | |||||||||||||
14 |
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | |
---|---|---|---|---|---|---|---|---|---|---|---|
1 | 99.8% | 98.2% | 87.1% | 87.6% | 84.4% | 83.8% | 83.2% | 89.3% | 81.1% | 80.9% | |
2 | 98.2% | 87.3% | 87.8% | 84.2% | 84.0% | 83.4% | 89.9% | 81.1% | 80.9% | ||
3 | 87.5% | 87.6% | 84.6% | 84.2% | 83.4% | 89.3% | 81.3% | 81.1% | |||
4 | 96.0% | 82.2% | 81.4% | 81.0% | 85.2% | 78.9% | 79.3% | ||||
5 | 83.0% | 82.4% | 82.0% | 86.0% | 79.5% | 79.5% | |||||
6 | 96.9% | 96.5% | 81.4% | 86.8% | 86.4% | ||||||
7 | 97.6% | 80.6% | 86.4% | 86.0% | |||||||
8 | 80.2% | 86.0% | 85.6% | ||||||||
9 | 78.3% | 78.5% | |||||||||
10 | 97.6% | ||||||||||
11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, J.; Mi, H.; Ren, M.; Huang, D.; Aboseif, A.M.; Liang, H.; Zhang, L. Research on Function of Ribosomal Protein S6 Kinases, 1α and β, Based on Molecular Cloning and siRNA-Based Interference in Juvenile Blunt Snout Bream (Megalobrama amblycephala). Biology 2024, 13, 875. https://doi.org/10.3390/biology13110875
Gu J, Mi H, Ren M, Huang D, Aboseif AM, Liang H, Zhang L. Research on Function of Ribosomal Protein S6 Kinases, 1α and β, Based on Molecular Cloning and siRNA-Based Interference in Juvenile Blunt Snout Bream (Megalobrama amblycephala). Biology. 2024; 13(11):875. https://doi.org/10.3390/biology13110875
Chicago/Turabian StyleGu, Jiaze, Haifeng Mi, Mingchun Ren, Dongyu Huang, Ahmed Mohamed Aboseif, Hualiang Liang, and Lu Zhang. 2024. "Research on Function of Ribosomal Protein S6 Kinases, 1α and β, Based on Molecular Cloning and siRNA-Based Interference in Juvenile Blunt Snout Bream (Megalobrama amblycephala)" Biology 13, no. 11: 875. https://doi.org/10.3390/biology13110875
APA StyleGu, J., Mi, H., Ren, M., Huang, D., Aboseif, A. M., Liang, H., & Zhang, L. (2024). Research on Function of Ribosomal Protein S6 Kinases, 1α and β, Based on Molecular Cloning and siRNA-Based Interference in Juvenile Blunt Snout Bream (Megalobrama amblycephala). Biology, 13(11), 875. https://doi.org/10.3390/biology13110875