Next Article in Journal
Population Status of a Regionally Endangered Plant, Lunaria rediviva (Brassicaceae), near the Eastern Border of Its Range
Next Article in Special Issue
Proteomic and Phosphoproteomic Analysis Reveals Differential Immune Response to Hirame Novirhabdovirus (HIRRV) Infection in the Flounder (Paralichthys olivaceus) under Different Temperature
Previous Article in Journal
Molecular Characterization and Expression Pattern of leptin in Yellow Cheek Carp (Elopichthys bambusa) and Its Transcriptional Changes in Response to Fasting and Refeeding
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Characterization of Infectious Pathogens Associated with Mass Mortalities of Pacific Oyster (Crassostrea gigas) Cultured in Northern China

1
Key Laboratory of Maricultural Organism Disease Control, Ministry of Agriculture, Qingdao Key Laboratory of Mariculture Epidemiology and Biosecurity, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
2
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China
3
Dalian Modern Agricultural Production Development Service Center, Dalian 116023, China
4
Changdao Enhancement and Experiment Station, Chinese Academy of Fishery Sciences, Yantai 265800, China
*
Author to whom correspondence should be addressed.
Biology 2023, 12(6), 759; https://doi.org/10.3390/biology12060759
Submission received: 31 March 2023 / Revised: 10 May 2023 / Accepted: 19 May 2023 / Published: 23 May 2023

Abstract

Simple Summary

The history of oyster culture consists of a succession of developmental phases using different species, followed by collapses associated with infectious diseases. The Pacific oyster (Crassostrea gigas), native to the northwest Pacific Ocean, was characterized by wide adaptability, and translocated to support major aquaculture industries in many countries around the world. A deadly herpesvirus, Ostreid herpesvirus-1 (OsHV-1), has hit the superior oyster since 1991. OsHV-1 infection, combined with subsequent bacteraemia by opportunistic bacteria, has brought heavy losses to the main production regions of the Pacific oyster. Because of the considerable economic importance of Pacific oysters, there is a wealth of information available on diseases that affect them around the world. Little comprehensive information is available about the epidemiology status of major disease-causing agents in China. On the other hand, the scale and yields of Pacific oyster increased rapidly in recent years, as a result of the introduction and popularization of triploid oysters. In the present study, a comprehensive survey of potential pathogens associated with mortality events of Pacific oysters was carried out. Our results highlight the potential risks of OsHV-1, Vibrio natriegens, and Vibrio alginolyticus to the aquaculture industry of the Pacific oyster in China.

Abstract

The Pacific oyster (Crassostrea gigas) aquaculture industry increased rapidly in China with the introduction and promotion of triploid oysters in recent years. Mass mortalities affecting different life stages of Pacific oysters emerged periodically in several important production areas of Northern China. During 2020 and 2021, we conducted a passive two-year investigation of infectious pathogens linked to mass mortality. Ostreid herpesvirus-1 (OsHV-1) was detected to be associated with mass mortalities of hatchery larvae, but not juveniles and adults in the open sea. Protozoan parasites, such as Marteilia spp., Perkinsus spp. and Bonamia spp. were not detected. Bacterial isolation and identification revealed that Vibrio natriegens and Vibrio alginolyticus were the most frequently (9 out of 13) identified two dominant bacteria associated with mass mortalities. Pseudoalteromonas spp. was identified as the dominant bacteria in three mortality events that occurred during the cold season. Further bacteriological analysis was conducted on two representative isolates of V. natriegens and V. alginolyticus, designated as CgA1-1 and CgA1-2. Multisequence analysis (MLSA) showed that CgA1-1 and CgA1-2 were closely related to each other and nested within the Harveyi clade. Bacteriological investigation revealed faster growth, and more remarkable haemolytic activity and siderophore production capacity at 25 °C than at 15 °C for both CgA1-1 and CgA1-2. The accumulative mortalities of experimental immersion infections were also higher at 25 °C (90% and 63.33%) than at 15 °C (43.33% and 33.33%) using both CgA1-1 and CgA1-2, respectively. Similar clinical and pathological features were identified in samples collected during both naturally and experimentally occurring mortalities, such as thin visceral mass, discolouration, and connective tissue and digestive tube lesions. The results presented here highlight the potential risk of OsHV-1 to hatchery production of larvae, and the pathogenic role of V. natriegens and V. alginolyticus during mass mortalities of all life stages of Pacific oysters in Northern China.

Graphical Abstract

1. Introduction

The Pacific oyster (Crassostrea gigas) is an economically and ecologically important species endemic to the waters of China, Korea, Japan, and Russia in the northwest Pacific Ocean [1]. Because of its rapid growth potential and wide adaptability to environmental conditions, the Pacific oyster has been introduced to many parts of the world as a supplemental aquaculture species for a decline of the local native oyster species [2]. In China, the Pacific oyster aquaculture production has increased from 0.81 million tonnes in 2000 to 1.46 million tonnes in 2018, with a growth rate of 3.32% per annum [3]. Beyond China, the Pacific oyster aquaculture production has been nearly stagnant from the mid-1980s [4], which fluctuates around 0.7 million tonnes, or even dropped to less than 0.6 million tonnes for several years [5]. China is responsible for most of the increased production of Pacific oyster aquaculture in recent decades [3,4]. The rapid increase in China could be attributed to a suite of technological advancements, such as artificial seeding in hatcheries, and longline aquaculture in the open sea [6]. More importantly, in recent years, the introduction and promotion of triploid oysters has stimulated more capital to be invested in the production and depuration of Pacific oysters in China [7]. Now, the Pacific oyster aquaculture industry has greatly commercialized nationwide in Northern China, with larval culture hatcheries concentrated along the coastline of LaiZhou, Shandong Province, and sold out to farmers for growing to market size. Before marketing, a short period (several weeks to months) for final fattening in bays with rich microalgae feed was always required. Therefore, long-distance transfer of live oysters was common during Pacific oyster production [6], which may contribute to the spread of mollusk pathogens [8].
High rates of Pacific oyster mortality (50–90%) could be traced back to 1927, which is shortly after the introduction of intensive hanging culture in Japan [9]. High water temperature and high salinity correlated with the spawning season, and pathogenic microorganisms were postulated to be responsible for the mortality [9]. After the war in 1945, the Pacific oyster was transplanted from its native range and established for large-scale commercial culture in Australia, America, and Europe. Similar epidemics with mortality rates ranging from 20 to 100% were reported periodically in many regions of the world where the species is cultivated [10]. Intensive studies have been carried out to investigate the causative factors involved in the syndrome [11,12,13,14]. A strictly pathological explanation has not been defined, though collective evidence suggested that multiplex intrinsic and extrinsic factors and their interactions were responsible for the phenomenon [15,16,17].
In recent decades, significant losses of oyster production have been reported more frequently, some of which were linked to pathogenic microorganisms including virus, bacteria, and parasites [8,18,19]. The most notorious mollusk parasites, Perkinsus spp., members of the Phylum Haplosporidia, and members of the Phylum Paramyxea, have caused serious local disruption to the complete collapse of indigenous oyster aquaculture industries in Europe and the USA [20]. Following that, C. gigas was then introduced successfully as a supplement to local indigenous oyster species. In 1991, mass mortalities of hatchery-reared Pacific oyster larvae were firstly reported to be associated with Ostreid herpesvirus-1 (OsHV-1) infection in France and New Zealand [21,22]. Subsequently, similar epidemics associated with OsHV-1 were reported in Mexico, Spain, and the USA [23,24,25]. In 2008, a new OsHV-1 variant (called μVar) emerged and outgrew the reference variant in France [26]. OsHV-1 μVar differs from the reference genotype at open reading frames (ORFs) 4 and 43, which primarily infects juvenile oysters (<12 months), and results in more serious mortality episodes [26]. OsHV-1 μVar has been subsequently identified as the primary etiological agent of Pacific oyster mortality syndrome (POMS) in a dozen countries [27]. Bacterial agents, especially members of the genus Vibrio, have also been linked to some cases of mass mortalities, which were capable of affecting all life stages of Pacific oysters [28,29,30]. More recently, it has also been proven that opportunistic bacteria, especially the strains assigned to the genus Vibrio, could act synergistically with OsHV-1 to contribute to the pathogenesis of mass mortality disease in Pacific oysters [31,32].
Increased mass mortalities of Pacific oysters were noticed in northern China in recent years, especially in the summer season. In the present study, we collected samples from mortality cases reported in multiple sites during 2020 and 2021. Multiple diagnosis methods, including molecular detection, histological investigation, bacteria isolation, and identification, were employed for the identification of potential etiologies. The key bacteriological features of the two identified pathogenic bacteria, Vibrio alginolyticus and Vibrio natriegens, were examined. The pathogenicity of the two Vibrio species was determined by experimental infection under controlled conditions.

2. Materials and Methods

2.1. Sample Collection and Preprocessing

Abnormal mortalities of Pacific oysters in Northern China were identified and reported by farmers according to their experiences. A total of eighteen batches of samples were collected from ten open sea areas and three hatcheries located in LaiZhou (Figure 1). Samples were collected and transported to the lab according to professional advice [33]. Macroscopic examinations were performed to record the shell abnormalities and fouling organisms. The juvenile and adult oysters were measured from bill to hinge, and opened for further investigation of gross abnormalities of viscera mass, such as predators, visible parasites, and physiological abnormalities. The larval samples were transferred to a petri dish with sterilized seawater at room temperature, and investigated under an inverted microscope.

2.2. DNA Extraction and qPCR Screening of Known Pathogens

A total of approximately 30 mg of targeted tissues (mantle and gills) of juvenile/adult oysters or larvae were collected from each sample for DNA extraction. The larvae samples were firstly ground using sterile pellet pestles to destroy the valves and expose soft tissues. The total DNA of each sample was extracted using the TIANamp Marine Animals DNA Kit (TIANGEN) according to the manufacturer’s instructions.
qPCR primer sequences and protocols for detection of OsHV-1, Perkinsus spp., Marteilia spp., and Bonamia spp. are listed in Table 1. Each sample was tested in duplicate, and the sample was recorded as positive if both replicates were amplified. For each run, total DNA from healthy oysters was used as a negative control; standard curves were generated using gradient dilutions of plasmids containing the targeted sequences of specific primers, which were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd.

2.3. Bacteria Isolation and Identification

Only sample batches maintained at about 0–8 °C, and which arrived in the lab within 48 h after sampling, were subjected to bacterial isolation. For each batch, moribund individuals with weak responses to external stimuli were selected as priority for analysis. The external valves of the selected individuals were sprayed with 70% ethanol, then opened in sterile conditions and held on ice. The surfaces of targeted tissues (mantle, gill filament, and adductor muscles) were firstly wiped with 70% ethanol to remove the attached bacteria. Then, a mixture of about 50 mg tissues was dissected and placed in a 1.5 mL centrifuge tube using separate sterile scalpel blades and forceps for each oyster. The dissected samples of the juvenile and adult were rinsed with sterile seawater to remove alcohol and bacteria from the surface of the samples, and ground in 500 μL of sterile seawater with a sterile pellet-pestle (Tiangen Biotech Co, Beijing, China; No. OSE-Y50) for 1 min on average. For larval samples, they were rinsed using 500 μL of sterile seawater and ground as described above. The preparation of tissue homogenate was performed on ice before plate plating. Then, the homogenates of all samples were mixed, and 50 µL of supernatant was used to coat 2216E medium plates (Solarbio, NO. LA0340). The plates were incubated for 24–48 h at 28 °C, and observed for bacterial growth.
Colonies were identified according to their sizes, shapes, and colours on the plates. The numbers of colonies of each type for each sample were counted, which were used for identification of dominant types for each batch sample. The dominant types refer to the ones constituting at least 30% of all colonies. A representative colony of each dominant type was taken by a sterile loop and stroked onto new plates for purification. The purified isolates were then incubated in 1 mL 2216E liquid medium (Solarbio, NO. LA0341) at 28 °C overnight. A volume of 600 µL liquid cultures containing 40% glycerol were stored at −80 °C.
Bacterial DNA was extracted using the E.Z.N.A. ®Bacterial DNA Kit (Omega Bio-Tek Co., Guangdong, China; No. D3350-01) following the manufacturer’s instructions. The preliminary identification of isolated bacteria was performed using the primers 27F and 1492R to amplify 16S rDNA (Table 1). Sequencing was performed by Sangon Biotech Co., Ltd. (Shanghai, China).
In addition, two dominant pathogenic bacteria (V. alginolyticus and V. natriegens) associated with characteristic syndromes (Figure 2A,B) were selected for further study. Amplification and sequencing of housekeeping genes atpA (ATP synthase alpha subunit gene), mreB (rod shaping protein B subunit gene), pyrH (uridylate kinase gene), recA (recombinase A gene), rpoA (RNA polymerase alpha subunit gene), rpoD (RNA polymerase σ70 factor), and gyrB (DNA gyrase subunit B gene) were performed (primers used are shown in Table 1), as previously described, to further confirm their species [43]. The concatenated sequences of atpA-mreB-pyrH-recA-rpoA-rpoD-gyrB from the isolates and other reported Vibrio strains were aligned using the software Clustal X ver. 2.0 [44]. The phylogenetic tree was constructed using the neighbor-joining (NJ) method, and evaluated using bootstrap analysis with 1000 replicates. Phylogenetic analysis was carried out with tools embedded in MEGA ver. 7.0 [45], and visualized in iTOL ver. 6.1.1. “https://itol.embl.de/ (accessed on 1 September 2022)”.

2.4. Histopathology Analysis

For histopathologic analysis, cross-sections of oyster tissues were made to include most of the organs, including the digestive gland, gonad, intestine, gills, and adductor muscle, then fixed immediately in Davidson’s alcohol formalin–acetic acid fixative (DAFA) for 24–36 h. The fixed tissues were then dehydrated in an ascending ethanol series, cleared with two changes of xylene (1 h each), and immersed in liquid paraffin. After mounting in paraffin blocks, the tissue blocks were cut into 3–5 μm thick sections using a rotary microtome. The tissue sections were stained with hematoxylin and eosin (H&E) solution, then examined for the presence of parasites and pathological alterations.

2.5. Morphological and Cultural Characteristic Analysis

After incubating CgA1-1 and CgA1-2 in 2216E at 28 °C for 12 h, the bacterial culture went through static settlement for 20 min, the precipitate was washed twice with sterile seawater, and then concentrated 10-fold with sterile seawater. For electron microscopic observation, 10 μL of the sample was placed on the grid. The grid was stained with 2% phosphotungstic acid at neutral pH and stored at room temperature before imaging. The morphological structures of CgA1-1 and CgA1-2 were observed by transmission electron microscope (HT7700, Hitachi, Japan) with 6000× magnification. The remaining pure bacteria cultures were plastered on Vibrio selective agar (thiosulfate-citrate-bile salts-sucrose agar, TCBS), and plates were incubated at 28 °C for 24 h to investigate the colony morphology under microscope.
The strains CgA1-1 and CgA1-2 were inoculated on 2216E agar plates, the volume of inoculant being 10 μL, and then incubated at 28 °C for 24 h. A colony of each strain was then randomly selected and inoculated into 2216E liquid medium, and cultured at 28 °C until the OD600 value reached about 0.5. After that, 50 μL bacterial solution was inoculated in 50 mL 2216E liquid medium and cultured at different temperatures (15 ± 0.5 °C, 25 ± 0.5 °C) for 24 h. The absorbance value was measured at OD600 every two hours.

2.6. Haemolytic Activity and Chrome Azurol S Production Analysis

Overnight cultures of CgA1-1 and CgA1-2 were spotted on sheep blood agar plates, which were separated equally and incubated at 15 °C and 25 °C for 4 days. Haemolytic activity was assessed by visual inspection and measurement of the haemolytic zone.
Siderophore production was determined by the Chrome azurol S (CAS) method, as described by Schwyn and Neilands [46]. Overnight cultures of CgA1-1 and CgA1-2 were spotted on CAS agar medium, and incubated at 15 °C and 25 °C, respectively, for 6 days. Siderophore production was qualitatively observed by visual inspection and measurement of the orange-yellow halos around the colonies.

2.7. Experimental Infection

Oysters (measured 33.6–42.3 mm) without abnormal mortality were obtained from Jimo, China. Before the artificial infection experiments, the oysters were temporarily housed in tanks at 15 ± 0.5 °C or 25 ± 0.5 °C for two weeks. Oysters were fed daily with microalgae, and the water was changed once a week. The pacific oysters acclimated at different temperatures were randomly divided into four groups for each strain of CgA1-1 and CgA1-2, including 15 °C-challenged and control groups, 25 °C-challenged and control groups (60 pacific oysters were equally separated and cultured in three 50 L tanks for each group as repeats). Pacific oysters in the challenged group were immersed in strains CgA1-1 and CgA1-2, both with a final concentration of 1 × 105 CFU/mL, while no bacteria were added to the control group. Mortality in each group was recorded at 12 h intervals for over 20 days, and both dead and moribund individuals were sampled. For each experimental group, 6 moribund samples were selected for bacterial isolation, identification, and histopathological investigation. For each negative control group, 3 individuals were randomly selected for histopathological investigation at the end of the experimental infection.

3. Results

3.1. Pathological Characteristics of Diseased Pacific Oysters

A total of eighteen batches of samples were collected, as shown in Table 2. Biofouling organisms such as barnacles, sponges, and blue mussels were occasionally observed, which may negatively affect the growth of the oysters. There were usually no characteristic gross abnormalities in the remaining populations after mass mortalities, except thinning, edema, erosions, and colour alteration of visceral mass were detected in some cases (Figure 2B). However, these clinical symptoms were always inconsistent among individuals, which could provide little information during the diagnosis. H&E-stained pathological sections of the clinically asymptomatic individuals always showed histopathological alterations. Different degrees of tissue lesions and accompanied haemocyte infiltrations were frequently observed in the connective tissue around the alimentary tract (intestine and stomach) (Figure 2D), and occasionally in the mantle. Sloughing of epithelial cells of digestive tubules into tubule lumens, and deterioration and vacuolization of the digestive tubules were also evident in thinner oysters (Figure 2D). No apparent pathology was observed in gonad and adductor muscle. The prodromal signs of diseased larvae were always a reduction of motility and feed intake, and an extension of rudimentary foot or velum.
qPCR screening of the known viral and parasite pathogens revealed that all tests were negative, except for OsHV-1 detection, in the five samples of larvae collected in April 2020. The viral DNA loads of the five samples ranged from 4.37 × 104 to 3.82 × 105 copies per ng of DNA, with an average of 1.79 × 105 copies per ng of DNA.

3.2. Isolation and Identification of Bacteria from Diseased Pacific Oysters

Due to transportation and storage conditions, moribunds of 13 mortality cases were qualified for bacterial isolation. A total of 171 bacterial colonies were isolated. The 16S rDNA sequence analysis revealed that these colonies consisted of 55.56% Vibrio spp., 24.78% Pseudoalteromonas spp., 4.68% Photobacterium spp., 4.42% Psychrobacter spp., and the other genera comprising less than 3%. Bacteria that accounted for more than 30% of each batch were considered dominant, and are listed in Table 2. V. alginolyticus and V. natriegens were the two most frequently encountered dominant strains. The survey demonstrated that V. alginolyticus and V. natriegens acted as the dominant bacteria species in 9 out of the 13 investigated mortality cases, most of which were outbreaks in summer. V. natriegens was only identified as the dominant species in the summer season. Two isolates (CgA1-1 and CgA1-2) involved in summer mortality of Pacific oysters, with the most prevalent symptoms, were selected for further analysis.
CgA1-1 and CgA1-2 were identified as V. natriegens and V. alginolyticus, respectively, by 16S rDNA sequence analysis. Sequencing and alignment of the seven housekeeping genes (atpA, mreB, pyrH, recA, rpoA, rpoD, and gyrB) of CgA1-1 and CgA1-2 resulted in a matrix of 6443 characters. Phylogenetic analysis was carried out using the concatenated sequences of the seven housekeeping genes of CgA1-1 and CgA1-2, and that of the other 50 representative Vibrio strains. The results firstly confirmed the taxonomic affiliation of CgA1-1 and CgA1-2 as inferred from 16S rDNA sequence analysis. The phylogenetic tree also showed that CgA1-1 and CgA1-2 form sister groups with Vibrio mytili and Vibrio parahaemolyticus, respectively, and the two groups further composed a sister clade that nested the Harveyi clade (Figure 3).

3.3. Phenotypic Characterization of CgA1-1 and CgA1-2

CgA1-1 was roughly spherical in shape, and approximately 1–1.2 μm in size. A single polar flagellum approximately 4.5 μm in length was observed by negative stain under electron microscope (Figure 4A). CgA1-2 was regularly rod-shaped of uniform size, approximately 1.5 μm long and 0.8 μm wide, with lateral flagella observed at the surface of the cell (Figure 4B). After incubation at 28 °C for 24 h on TCBS agar, both CgA1-1 and CgA1-2 colonies were round with smooth margins in shape, orange in colour, and nonmotile (Figure 4C,D). Growth of CgA1-1 and CgA1-2 at different temperatures (15 ± 0.5 °C, 25 ± 0.5 °C) showed significant differences, which grew faster when incubated at 25 °C (Figure 4E,F).

3.4. Haemolytic Activity and Siderophore Production Analysis

Haemolytic activity and siderophore production were detected after spotting both CgA1-1 (V. natriegens) and CgA1-2 (V. alginolyticus) on blood agar plates and CAS agar plates, respectively (Figure 5). For each test, the signal was very weak at 15 °C, and evident at 25 °C.

3.5. Temperature Effects on the Pathogenicity of CgA1-1 and CgA1-2

To assess the pathogenicity of CgA1-1 and CgA1-2, and the effect of temperature, experimental infection was carried out at different temperatures (15 °C and 25 °C). The mortality rates of the experimental groups were significantly higher at 25 °C than at 15 °C for CgA1-1 (χ2 = 5.30, df = 1, p < 0.05), while only marginally significant for CgA1-2 (χ2 = 3.20, df = 1, p = 0.07). For the experimental groups at 25 °C, the mortality rate reached 90% and 63.33% at the end of the experimental infection for CgA1-1 and CgA1-2, respectively (Figure 6A). The mortality rates only reach 43.33% and 33.33% for experimental groups at 15 °C for CgA1-1 and CgA1-2, respectively (Figure 6B). The most evident gross clinical signs of moribund oysters were thinning and discolouration of visceral mass. V. natriegens and V. alginolyticus were isolated and identified as the dominant bacteria from corresponding experimental groups immersed with CgA1-1 and CgA1-2, respectively. Similar histopathological alterations were detected in moribund samples of all experimental groups (Figure 6D,E), which resembled those found in the naturally infected individuals, as described in Section 3.1. No clinical signs and mortality of oysters were observed in negative control groups (Figure 6C).

4. Discussion

With the development and promotion of triploid Pacific oysters in China, the aquaculture scale of Pacific oysters has expanded quickly in recent years. Mass mortalities of Pacific oysters were frequently reported in Northern China during the summer season, which is also a familiar phenomenon in other parts of the world [10,47]. At the same time, abnormal mortality cases were also found in the other seasons, affecting larval, juvenile, and adult oysters throughout the production process. There were more than ten infectious diseases of Pacific oysters, including those with viral, bacterial, protozoan, and metazoan etiologies [48]. Summer mortality syndrome [47,49,50], OsHV-1 infections [27], and Vibriosis have been identified as the main causes of disease outbreaks in recent decades [51,52], which led to the significant loss of production stocks around the world [24,53].
In the present study, most of the mortality events occurred during the warm season, suggesting that high temperatures may play a vital role in triggering mass mortality. Vibrio spp. have been frequently isolated from moribund Pacific oysters during the summer mortality events, which were suspected to be responsible for the mortality events [28,54,55]. For example, Vibrio splendidus and Vibrio aestuarianus were frequently identified in mortality events in France [51], V. alginolyticus was isolated in a mortality case reported in China [14,56], and V. harveyi was characterized in a mortality case that occurred in Australia [11]. In the present study, bacteria of the genus Vibrio were identified as the primary dominant strains in both hatcheries and open sea areas during 2020 and 2021 in China. Among them, V. alginolyticus and V. natriegens were the first two most predominant species associated with oyster mortality outbreaks. The abundance and pathogenicity of V. alginolyticus in Pacific oysters along some coastal areas in Shandong Province have also been proven in several other studies [14,57,58]. V. alginolyticus is also a widespread species of seawater Vibrio, which has been shown to cause disease in a variety of aquatic animals such as fish [59], shrimp [60], and shellfish [61]. V. natriegens has not been reported to be involved in mollusk mortality previously in China, while it was reported occasionally as the dominant bacterial species during summer mortality events in Pacific oysters in France [28]. However, the phenotypic and pathogenic properties of V. natriegens have not been characterized previously, according to our knowledge.
Environmental parameters, especially the seawater temperature, could dramatically affect the bacterial abundance and microbiome structure [54]. Warm (20–30 °C), mesohaline (<5–30) waters are the most hospitable for the growth of pathogenic Vibrio bacteria [62]. High temperatures in the summer season would drive the proliferation of Vibrio spp. in temperate waters [63]. In the present study, both V. alginolyticus and V. natriegens cultured under 25 °C outgrew their counterparts cultured under 15 °C. The virulence mechanisms of V. alginolyticus and V. natriegens are still undetermined. Several species of the Harveyi clade (including V. alginolyticus) have been reported to produce several common virulence factors, such as haemolysin and iron uptake system (tonB) [64]. Generating haemolytic molecules and producing siderophores have been proven to be two important phenotypes related to virulence properties [65,66,67]. In the present study, both V. alginolyticus and V. natriegens groups tested positive for haemolytic activity and siderophore production at 25 °C and 15 °C, with stronger signals being observed at 25 °C than at 15 °C in both Vibrio groups. Subsequent experimental infection using either V. alginolyticus or V. natriegens indicated that water temperature (25 °C and 15 °C) had a significant effect on the survival of Pacific oysters. These results, combined with the field observations, support the postulation that rising temperatures during the summer season may lead to an increase in Vibrio-associated illness in Pacific oysters [62,68].
The Pacific oyster is known for having been affected by a major worldwide epizootic disease associated with OsHV-1 μVar and related variants since 2008. Pacific oyster mortality syndrome (POMS) was created to refer to the mass mortalities due to Ostreid herpesvirus-1 (OsHV-1) [69], which has become panzootic, and represents a major threat to the Pacific oyster industry worldwide [27]. POMS is proven to be a polymicrobial (OsHV-1 variants and bacteria) and multifactorial (environmental and host factors) disease [17,70,71,72], and is now thought to be caused by an immune deficiency caused by OsHV-1 infection, thus allowing the conditional pathogen to take advantage of the situation, which results in oyster death [31]. The OsHV-1 infection (reference variant) was primarily limited to larval stages of C. gigas when the virus first emerged in 1991 [21,73]. Since 2008, OsHV-1 µVar and related variants have emerged and become the predominant variants of OsHV-1 worldwide [26,53,74,75,76,77]. Since the first report of shellfish mortalities associated with OsHV-1 in China in 1997, viral infection and the associated mass mortality have been reported in several bivalve species, such as Chlamys farreri [78,79], C. gigas [80,81], and Scapharca broughtonii [82,83]. The present study and previous unpublished epidemiological investigations indicate that no cases of mass mortality of juvenile or adult Pacific oysters were associated with OsHV-1 in China. POMS does not appear to be the main cause of Pacific oyster mortality in its natural populations in China. Similar situations were reported in the coastlines of Korea and Japan [84,85,86], the other two countries of the natural distribution range of Pacific oysters.
Pacific oysters are susceptible to a wide range of diseases caused by parasites, such as Marteilioides chungmuensis [87], Perkinsus spp. [88,89], Haplosporidium spp. [90], and Mikrocytos mackini [91]. The susceptibility of Pacific oyster to Marteilia refringens, Bonamia ostreae, and Bonamia exitiosa is still undetermined [92,93]. The occurrence and distribution patterns of parasites and associated diseases in Pacific oyster were not well characterized in China. In the present study, the presence of Perkinsus spp., M. refringens, B. ostreae, and B. exitiosa was screened by both histopathological and qPCR methods. No parasite or apparent infection was detected in these samples, which indicated that its effect on oyster populations was probably none or limited.

5. Conclusions

In summary, we carried out a two-year passive survey of mass mortalities associated with Pacific oysters. Although reporting bias and neglect of mortality cases might exist, it is meaningful to act as an alert and extent of mass mortality outbreaks that occurred in Pacific oysters. OsHV-1 infections were only detected during larvae production in hatcheries at low incidence. Considering the intensive production model of larvae and densely distributed hatcheries, the viral pathogen still poses a huge threat to the aquaculture industry of Pacific oysters. V. natriegens (CgA1-1) and V. alginolyticus (CgA1-2) were identified as potential pathogens that are closely associated with mass mortalities of Pacific oysters of different life stages in Northern China. Phenotypic assays and pathogenic analyses of CgA1-1 and CgA1-2 indicated that temperature plays a key role during the growth and virulence of the two Vibrios. Long-term sea-surface temperature increases during the summer season will lead to an increase in Vibrio-associated illness of Pacific oysters in Northern China. The results suggested that V. alginolyticus and V. natriegens are two widespread and dominant bacteria in oyster-farming areas, and should be monitored as a priority in the future.

Author Contributions

Conceptualization, C.-M.B. and B.-W.H.; methodology, X.Z., C.L. and Y.-D.Z.; formal analysis, X.Z. and C.-M.B.; investigation, C.-M.W. and L.-S.X.; resources, W.-B.C. and T.Y.; data curation, C.-M.W.; writing—original draft preparation, X.Z. and B.-W.H.; writing—review and editing, X.Z., C.-M.B. and L.-S.X.; supervision, C.-M.W.; project administration, C.-M.B.; funding acquisition, C.-M.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by National Natural Science Foundation of China (Grant No. 32073014), the earmarked fund for CARS (Grant No. CARS-49).

Institutional Review Board Statement

Ethical review and approval were waived for this study by IACUC Committee of Yellow Sea Fisheries Research Institute, because the Pacific oysters have no central nervous system.

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article.

Acknowledgments

We are grateful to Umberto Rosani for providing valuable advice during the preparation of the manuscript. We thank Li Gu from Tianjin Agricultural University for providing assistance during sample collection and transportation. We also thank Jiang-Nan Yu and Dan-Dan Wang for the maintaining and sampling of oysters during the experimental infection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bayne, B.L. Developments in aquaculture and fisheries science. In Biology of Oysters; Academic Press: London, UK, 2017; p. 844. [Google Scholar]
  2. Guo, X. Use and exchange of genetic resources in molluscan aquaculture. Rev. Aquac. 2009, 1, 251–259. [Google Scholar] [CrossRef]
  3. Zhang, G.; Li, L.; Que, H. An evolution of oyster mariculture industry in china: New knowledge, variety and product. Oceanol. Limnol. Sin. 2020, 51, 740–749. [Google Scholar] [CrossRef]
  4. Botta, R.; Asche, F.; Borsum, J.S.; Camp, E.V. A review of global oyster aquaculture production and consumption. Mar. Policy 2020, 117, 103952. [Google Scholar] [CrossRef]
  5. FAO. Fishery and Aquaculture Statistics. Global Aquaculture Production 1950–2020 (FishstatJ). Available online: https://www.fao.org/fishery/statistics-query/en/aquaculture/aquaculture_quantity (accessed on 16 September 2022).
  6. China Mollusk Research System. Developemnt report of oyster industry in China. China Fish 2021, 6, 20–31. [Google Scholar]
  7. Jiang, R.; Mu, Y. Analysis of agglomeration characteristics of Chinese oyster breeding industry. Chin. Fish. Econ. 2021, 39, 55–61. [Google Scholar]
  8. Carnegie, R.B.; Arzul, I.; Bushek, D. Managing marine mollusc diseases in the context of regional and international commerce: Policy issues and emerging concerns. Philos. Trans. R. Soc. B 2016, 371, 20150215. [Google Scholar] [CrossRef]
  9. Ventilla, R.F. Recent developments in the Japanese oyster culture industry. Adv. Mar. Biol. 1984, 21, 1–57. [Google Scholar] [CrossRef]
  10. Samain, J. Review and perspectives of physiological mechanisms underlying genetically-based resistance of the Pacific oyster Crassostrea gigas to summer mortality. Aquat. Living Resour. 2011, 24, 227–236. [Google Scholar] [CrossRef]
  11. Cowan, M. Exploring the Mechanisms of Pacific Oyster Summer Mortality in Baynes Sound Aquaculture. Master’s Thesis, University of Victoria, Victoria, BC, Canada, 2020. [Google Scholar]
  12. Lang, R.P.; Langdon, C.J.; Taris, N.G.; Camara, M.D. Use of laboratory assays to predict subsequent growth and survival of Pacific oyster (Crassostrea gigas) families planted in coastal waters. Aquaculture 2010, 306, 68–79. [Google Scholar] [CrossRef]
  13. Soletchnik, P.; Ropert, M.; Mazurié, J.; Fleury, P.G.; Le Coz, F. Relationships between oyster mortality patterns and environmental data from monitoring databases along the coasts of France. Aquaculture 2007, 271, 384–400. [Google Scholar] [CrossRef]
  14. Yang, B.; Zhai, S.; Li, X.; Tian, J.; Li, Q.; Shan, H.; Liu, S. Identification of Vibrio alginolyticus as a causative pathogen associated with mass summer mortality of the Pacific Oyster (Crassostrea gigas) in China. Aquaculture 2021, 535, 736363. [Google Scholar] [CrossRef]
  15. Cotter, E.; Malham, S.K.; O’Keeffe, S.; Lynch, S.A.; Latchford, J.W.; King, J.W.; Beaumont, A.R.; Culloty, S.C. Summer mortality of the Pacific oyster, Crassostrea gigas, in the Irish Sea: The influence of growth, biochemistry and gametogenesis. Aquaculture 2010, 303, 8–21. [Google Scholar] [CrossRef]
  16. Malham, S.K.; Cotter, E.; O’Keeffe, S.; Lynch, S.; Culloty, S.C.; King, J.W.; Latchford, J.W.; Beaumont, A.R. Summer mortality of the Pacific oyster, Crassostrea gigas, in the Irish Sea: The influence of temperature and nutrients on health and survival. Aquaculture 2009, 287, 128–138. [Google Scholar] [CrossRef]
  17. Petton, B.; Boudry, P.; Alunno-Bruscia, M.; Pernet, F. Factors influencing disease-induced mortality of Pacific oysters Crassostrea gigas. Aquac. Environ. Interact. 2015, 6, 205–222. [Google Scholar] [CrossRef]
  18. Arzul, I.; Corbeil, S.; Morga, B.; Renault, T. Viruses infecting marine molluscs. J. Invertebr. Pathol. 2017, 147, 118–135. [Google Scholar] [CrossRef]
  19. Pernet, F.; Lupo, C.; Bacher, C.; Whittington, R.J. Infectious diseases in oyster aquaculture require a new integrated approach. Philos. Trans. R. Soc. B 2016, 371, 20150213. [Google Scholar] [CrossRef]
  20. Carnegie, R.B. Effects in mollusc culture. In Marine Parasitology; Rohde, K., Ed.; CSIRO PUBLISHING: Collingwood, Australia, 2005; Chapter 10; pp. 391–398. ISBN 0 643 09025 8. [Google Scholar]
  21. Hine, P.M.; Wesney, B.; Hay, B.E. Herpesviruses associated with mortalities among hatchery-reared larval Pacific oysters Crassostrea gigas. Dis. Aquat. Org. 1992, 12, 135–142. [Google Scholar] [CrossRef]
  22. Renault, T.; Cochennec, N.; Le Deuff, R.; Chollet, B. Herpes-like virus infecting Japanese oyster (Crassostrea gigas) spat. Bull. Eur. Assoc. Fish. Pathol. 1994, 14, 64–66. [Google Scholar]
  23. Da Silva, P.M.; Renault, T.; Fuentes, J.; Villalba, A. Herpesvirus infection in European flat oysters Ostrea edulis obtained from brood stocks of various geographic origins and grown in Galicia (NW Spain). Dis. Aquat. Org. 2008, 78, 181–188. [Google Scholar] [CrossRef]
  24. Friedman, C.S.; Estes, R.M.; Stokes, N.A.; Burge, C.A.; Hargove, J.S.; Barber, B.J.; Elston, R.A.; Burreson, E.M.; Reece, K.S. Herpes virus in juvenile Pacific oysters Crassostrea gigas from Tomales Bay, California, coincides with summer mortality episodes. Dis. Aquat. Org. 2005, 63, 33–41. [Google Scholar] [CrossRef]
  25. Vasquez-Yeomans, R.; Caceres-Martinez, J.; Huerta, A.F. Herpes-like virus associated with eroded gills of the Pacific oyster Crassostrea gigas in Mexico. J. Shellfish Res. 2004, 23, 417–420. [Google Scholar]
  26. Segarra, A.; Pepin, J.F.; Arzul, I.; Morga, B.; Faury, N.; Renault, T. Detection and description of a particular Ostreid herpesvirus 1 genotype associated with massive mortality outbreaks of Pacific oysters, Crassostrea gigas, in France in 2008. Virus Res. 2010, 153, 92–99. [Google Scholar] [CrossRef] [PubMed]
  27. Barbosa Solomieu, V.; Renault, T.; Travers, M. Mass mortality in bivalves and the intricate case of the Pacific oyster, Crassostrea gigas. J. Invertebr. Pathol. 2015, 131, 2–10. [Google Scholar] [CrossRef] [PubMed]
  28. Garnier, M.; Labreuche, Y.; Garcia, C.; Robert, M.; Nicolas, J.L. Evidence for the involvement of pathogenic bacteria in summer mortalities of the Pacific oyster Crassostrea gigas. Microb. Ecol. 2007, 53, 187–196. [Google Scholar] [CrossRef] [PubMed]
  29. Gay, M.; Berthe, F.C.; Le Roux, F. Screening of Vibrio isolates to develop an experimental infection model in the Pacific oyster Crassostrea gigas. Dis. Aquat. Org. 2004, 59, 49–56. [Google Scholar] [CrossRef]
  30. Sugumar, G.; Nakai, T.; Hirata, Y.; Matsubara, D.; Muroga, K. Vibrio splendidus biovar II as the causative agent of bacillary necrosis of Japanese oyster Crassostrea gigas larvae. Dis. Aquat. Org. 1998, 33, 111–118. [Google Scholar] [CrossRef]
  31. de Lorgeril, J.; Lucasson, A.; Petton, B.; Toulza, E.; Montagnani, C.; Clerissi, C.; Vidal-Dupiol, J.; Chaparro, C.; Galinier, R.; Escoubas, J.M.; et al. Immune-suppression by OsHV-1 viral infection causes fatal bacteraemia in Pacific oysters. Nat. Commun. 2018, 9, 4215. [Google Scholar] [CrossRef]
  32. Pathirana, E.; Fuhrmann, M.; Whittington, R.; Hick, P. Influence of environment on the pathogenesis of Ostreid herpesvirus-1 (OsHV-1) infections in Pacific oysters (Crassostrea gigas) through differential microbiome responses. Heliyon 2019, 5, e2101. [Google Scholar] [CrossRef]
  33. Howard, D.W.; Lewis, E.J.; Keller, B.J.; Smith, C.S. Histological Techniques for Marine Bivalve Mollusks and Crustaceans, 2nd ed.; NOAA, National Ocean Service, National Centers for Coastal Ocean Service, Cooperative Oxford Laboratory: Oxford, MD, USA, 2004; Chapter 2; pp. 7–9.
  34. Martenot, C.; Oden, E.; Travaillé, E.; Malas, J.P.; Houssin, M. Comparison of two real-time PCR methods for detection of ostreid herpesvirus 1 in the Pacific oyster Crassostrea gigas. J. Virol. Methods 2010, 170, 86–89. [Google Scholar] [CrossRef]
  35. Audemard, C.; Reece, K.S.; Burreson, E.M. Real-Time PCR for Detection and Quantification of the Protistan Parasite Perkinsus marinus in Environmental Waters. Appl. Environ. Microb. 2004, 70, 6611–6618. [Google Scholar] [CrossRef]
  36. Canier, L.; Dubreuil, C.; Noyer, M.; Serpin, D.; Chollet, B.; Garcia, C.; Arzul, I. A new multiplex real-time PCR assay to improve the diagnosis of shellfish regulated parasites of the genus Marteilia and Bonamia. Prev. Vet. Med. 2020, 183, 105126. [Google Scholar] [CrossRef] [PubMed]
  37. DeLong, E.F. Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 1992, 89, 5685–5689. [Google Scholar] [CrossRef] [PubMed]
  38. Thompson, C.C.; Thompson, F.L.; Vicente, A.C.P.; Swings, J. Phylogenetic analysis of vibrios and related species by means of atpA gene sequences. Int. J. Syst. Evol. Microbiol. 2007, 57, 2480–2484. [Google Scholar] [CrossRef] [PubMed]
  39. Sawabe, T.; Kita-Tsukamoto, K.; Thompson, F.L. Inferring the Evolutionary History of Vibrios by Means of Multilocus Sequence Analysis. J. Bacteriol. 2007, 189, 7932–7936. [Google Scholar] [CrossRef] [PubMed]
  40. Pascual, J.; Macián, M.C.; Arahal, D.R.; Garay, E.; Pujalte, M.J. Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA, pyrH, rpoD, gyrB, rctB and toxR genes. Int. J. Syst. Evol. Microbiol. 2010, 60, 154–165. [Google Scholar] [CrossRef]
  41. Thompson, F.L.; Gevers, D.; Thompson, C.C.; Dawyndt, P.; Naser, S.; Hoste, B.; Munn, C.B.; Swings, J. Phylogeny and Molecular Identification of Vibrios on the Basis of Multilocus Sequence Analysis. Appl. Environ. Microb. 2005, 71, 5107–5115. [Google Scholar] [CrossRef]
  42. Le Roux, F.; Gay, M.; Lambert, C.; Nicolas, J.L.; Gouy, M.; Berthe, F. Phylogenetic study and identification of Vibrio splendidus-related strains based on gyrB gene sequences. Dis. Aquat. Org. 2004, 58, 143–150. [Google Scholar] [CrossRef]
  43. Pérez-Cataluña, A.; Lucena, T.; Tarazona, E.; Arahal, D.R.; Macián, M.C.; Pujalte, M.J. An MLSA approach for the taxonomic update of the Splendidus clade, a lineage containing several fish and shellfish pathogenic Vibrio spp. Syst. Appl. Microbiol. 2016, 39, 361–369. [Google Scholar] [CrossRef]
  44. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  45. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  46. Schwyn, B.; Neilands, J.B. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 1987, 160, 47–56. [Google Scholar] [CrossRef] [PubMed]
  47. Takeuchi, T.; Takemoto, Y.; Matsubara, T. Haematological study of bacteria affected oysters. Hiroshima-Ken Suisan Shikenjo Hokoku (Hiroshima Prefect. Fish. Exp. Stn.) 1960, 22, 1–7. [Google Scholar]
  48. Elston, R.A. Infectious diseases of the Pacific oyster, Crassostrea gigas. Annu. Rev. Fish Dis. 1993, 3, 259–276. [Google Scholar] [CrossRef]
  49. Moore, J.D.; Juhasz, C.I.; Robbins, T.T. A histopathology survey of California oysters. Calif. Fish Game Rep. 2011, 97, 68–83. [Google Scholar]
  50. Samain, J.; Degremont, L.; Soletchnik, P.; Haure, J.; Bédier, E.; Ropert, M.; Moal, J.; Huvet, A.; Bacca, H.; Van Wormhoudt, A. Genetically based resistance to summer mortality in the Pacific oyster (Crassostrea gigas) and its relationship with physiological, immunological characteristics and infection processes. Aquaculture 2007, 268, 227–243. [Google Scholar] [CrossRef]
  51. Saulnier, D.; De Decker, S.; Haffner, P.; Cobret, L.; Robert, M.; Garcia, C. A large-scale epidemiological study to identify bacteria pathogenic to Pacific oyster Crassostrea gigas and correlation between virulence and metalloprotease-like activity. Microb. Ecol. 2010, 59, 787–798. [Google Scholar] [CrossRef] [PubMed]
  52. Travers, M.; Miller, K.B.; Roque, A.; Friedman, C.S. Bacterial diseases in marine bivalves. J. Invertebr. Pathol. 2015, 131, 11–31. [Google Scholar] [CrossRef]
  53. Renault, T.; Qin, J.G. Pacific cupped oyster, Crassostrea gigas, mortality outbreaks and infectious diseases. Oysters Physiol. Ecol. Distrib. Mortal. 2012, 203, 225. [Google Scholar]
  54. Green, T.J.; Siboni, N.; King, W.L.; Labbate, M.; Seymour, J.R.; Raftos, D. Simulated marine heat wave alters abundance and structure of Vibrio populations associated with the Pacific Oyster resulting in a mass mortality event. Microb. Ecol. 2019, 77, 736–747. [Google Scholar] [CrossRef]
  55. Wendling, C.C.; Wegner, K.M. Relative contribution of reproductive investment, thermal stress and Vibrio infection to summer mortality phenomena in Pacific oysters. Aquaculture 2013, 412–413, 88–96. [Google Scholar] [CrossRef]
  56. Wang, H.; Yang, B.; Li, X.; Li, Q.; Liu, S. Screening of bacterial pathogens associated with mass summer mortality of the Pacific oyster, Crassostrea gigas, in China. Aquac. Rep. 2021, 20, 100672. [Google Scholar] [CrossRef]
  57. Fang, H. Epidemiological Investigation and Virulence Gene Detection of Shellfish Vibrio in Shandong Province. Master’s Thesis, Shandong Agricultural University, Tai’an, China, 2019. [Google Scholar]
  58. Wei, Y. Study on Molecular Response to Heat Stress and Vibrio alginolytic Infection in the Immature and Post-Spawning Populations of Pacific Oyster (Crassostrea gigas). Master’s Thesis, Guangxi University, Nanning, China, 2020. [Google Scholar]
  59. Kahla-Nakbi, A.B.; Chaieb, K.; Besbes, A.; Zmantar, T.; Bakhrouf, A. Virulence and enterobacterial repetitive intergenic consensus PCR of Vibrio alginolyticus strains isolated from Tunisian cultured gilthead sea bream and sea bass outbreaks. Vet. Microbiol. 2006, 117, 321–327. [Google Scholar] [CrossRef]
  60. Liu, C.; Cheng, W.; Hsu, J.; Chen, J. Vibrio alginolyticus infection in the white shrimp Litopenaeus vannamei confirmed by polymerase chain reaction and 16S rDNA sequencing. Dis. Aquat. Org. 2004, 61, 169–174. [Google Scholar] [CrossRef] [PubMed]
  61. Gómez-León, J.; Villamil, L.; Lemos, M.L.; Novoa, B.; Figureueras, A. Isolation of Vibrio alginolyticus and Vibrio splendidus from aquacultured carpet shell clam (Ruditapes decussatus) larvae associated with mass mortalities. Appl. Environ. Microb. 2005, 71, 98–104. [Google Scholar] [CrossRef] [PubMed]
  62. Burge, C.A.; Mark Eakin, C.; Friedman, C.S.; Froelich, B.; Hershberger, P.K.; Hofmann, E.E.; Petes, L.E.; Prager, K.C.; Weil, E.; Willis, B.L. Climate change influences on marine infectious diseases: Implications for management and society. Annu. Rev. Mar. Sci. 2014, 6, 249–277. [Google Scholar] [CrossRef] [PubMed]
  63. Oberbeckmann, S.; Fuchs, B.M.; Meiners, M.; Wichels, A.; Wiltshire, K.H.; Gerdts, G. Seasonal dynamics and modeling of a Vibrio community in coastal waters of the North Sea. Microb. Ecol. 2012, 63, 543–551. [Google Scholar] [CrossRef]
  64. Darshanee Ruwandeepika, H.A.; Sanjeewa Prasad Jayaweera, T.; Paban Bhowmick, P.; Karunasagar, I.; Bossier, P.; Defoirdt, T. Pathogenesis, virulence factors and virulence regulation of vibrios belonging to the Harveyi clade. Rev. Aquac. 2012, 4, 59–74. [Google Scholar] [CrossRef]
  65. Gundogan, N.; Yakar, U.A. Siderophore production, serum resistance, hemolytic activity and extended-spectrum β-lactamase-producing Klebsiella species isolated from milk and milk products. J. Food Saf. 2007, 27, 251–264. [Google Scholar] [CrossRef]
  66. Huang, B.; Zhang, X.; Wang, C.; Bai, C.; Li, C.; Li, C.; Xin, L. Isolation and Characterization of Vibrio kanaloae as a Major Pathogen Associated with Mass Mortalities of Ark Clam, Scapharca broughtonii, in Cold Season. Microorganisms 2021, 9, 2161. [Google Scholar] [CrossRef] [PubMed]
  67. Santos, J.A.; González, C.J.; Otero, A.; García-López, M. Hemolytic activity and siderophore production in different Aeromonas species isolated from fish. Appl. Environ. Microb. 1999, 65, 5612–5614. [Google Scholar] [CrossRef] [PubMed]
  68. Le Roux, F.; Wegner, K.M.; Baker-Austin, C.; Vezzulli, L.; Osorio, C.R.; Amaro, C.; Ritchie, J.M.; Defoirdt, T.; Destoumieux-Garzón, D.; Blokesch, M. The emergence of Vibrio pathogens in Europe: Ecology, evolution, and pathogenesis (Paris, 11–12th March 2015). Front. Microbiol. 2015, 6, 830. [Google Scholar] [CrossRef] [PubMed]
  69. Paul-Pont, I.; Dhand, N.K.; Whittington, R.J. Influence of husbandry practices on OsHV-1 associated mortality of Pacific oysters Crassostrea gigas. Aquaculture 2013, 412, 202–214. [Google Scholar] [CrossRef]
  70. Azéma, P.; Lamy, J.; Boudry, P.; Renault, T.; Travers, M.; Dégremont, L. Genetic parameters of resistance to Vibrio aestuarianus, and OsHV-1 infections in the Pacific oyster, Crassostrea gigas, at three different life stages. Genet. Sel. Evol. 2017, 49, 1–16. [Google Scholar] [CrossRef] [PubMed]
  71. Le Roux, F.; Wegner, K.M.; Polz, M.F. Oysters and vibrios as a model for disease dynamics in wild animals. Trends Microbiol. 2016, 24, 568–580. [Google Scholar] [CrossRef]
  72. Pernet, F.; Tamayo, D.; Fuhrmann, M.; Petton, B. Deciphering the effect of food availability, growth and host condition on disease susceptibility in a marine invertebrate. J. Exp. Biol. 2019, 222, b210534. [Google Scholar] [CrossRef]
  73. Nicolas, J.L.; Comps, M.; Cochennec, N. Herpes-like virus infecting Pacific oyster larvae. Bull. Eur. Ass. Fish Pathol. 1992, 12, 11. [Google Scholar]
  74. Abbadi, M.; Zamperin, G.; Gastaldelli, M.; Pascoli, F.; Rosani, U.; Milani, A.; Schivo, A.; Rossetti, E.; Turolla, E.; Gennari, L. Identification of a newly described OsHV-1 µvar from the North Adriatic Sea (Italy). J. Gen. Virol. 2018, 99, 693. [Google Scholar] [CrossRef]
  75. Bai, C.; Morga, B.; Rosani, U.; Shi, J.; Li, C.; Xin, L.; Wang, C. Long-range PCR and high-throughput sequencing of Ostreid herpesvirus 1 indicate high genetic diversity and complex evolution process. Virology 2019, 526, 81–90. [Google Scholar] [CrossRef]
  76. Martenot, C.; Oden, E.; Travaillé, E.; Malas, J.; Houssin, M. Detection of different variants of Ostreid Herpesvirus 1 in the Pacific oyster, Crassostrea gigas between 2008 and 2010. Virus Res. 2011, 160, 25–31. [Google Scholar] [CrossRef]
  77. Peeler, E.J.; Reese, R.A.; Cheslett, D.L.; Geoghegan, F.; Power, A.; Thrush, M.A. Investigation of mortality in Pacific oysters associated with Ostreid herpesvirus-1 μVar in the Republic of Ireland in 2009. Prev. Vet. Med. 2012, 105, 136–143. [Google Scholar] [CrossRef]
  78. Song, W.; Wang, C. New Research Porgress on Massive Mortality of Cultured Scallop Chlamys farreri. Mar. Sci. Qingdao Chin. Ed. 2001, 25, 23–29. [Google Scholar]
  79. Wang, C.; Wang, X.; Song, X.; Huang, J.; Song, W. Purification and ultrastructure of a spherical virus in cultured scallop Chlamys farreri. Shuichan Xuebao 2002, 26, 180–183. [Google Scholar]
  80. Bai, C.; Xin, L.; Wang, C. Malacoherpesviruses and their associated damages to mollusk aquaculture industry. Prog. Fish. Sci. 2021, 42, 214–226. [Google Scholar] [CrossRef]
  81. Yao, S.; Li, L.; Guan, X.; He, Y.; Jouaux, A.; Xu, F.; Guo, X.; Zhang, G.; Zhang, L. Pooled resequencing of larvae and adults reveals genomic variations associated with Ostreid herpesvirus 1 resistance in the Pacific oyster Crassostrea gigas. Front. Immunol. 2022, 13, 928628. [Google Scholar] [CrossRef] [PubMed]
  82. Bai, C.; Wang, C.; Xia, J.; Sun, H.; Zhang, S.; Huang, J. Emerging and endemic types of Ostreid herpesvirus 1 were detected in bivalves in China. J. Invertebr. Pathol. 2015, 124, 98–106. [Google Scholar] [CrossRef]
  83. Xia, J.; Bai, C.; Wang, C.; Song, X.; Huang, J. Complete genome sequence of Ostreid herpesvirus-1 associated with mortalities of Scapharca broughtonii broodstocks. Virol. J. 2015, 12, 1–9. [Google Scholar] [CrossRef]
  84. Hwang, J.Y.; Park, J.J.; Yu, H.J.; Hur, Y.B.; Arzul, I.; Couraleau, Y.; Park, M.A. Ostreid herpesvirus 1 infection in farmed Pacific oyster larvae Crassostrea gigas (Thunberg) in Korea. J. Fish Dis. 2013, 36, 969–972. [Google Scholar] [CrossRef]
  85. Jee, B.Y.; Lee, S.J.; Cho, M.Y.; Lee, S.J.; Kim, J.W.; Choi, S.H.; Jeong, H.D.; Kim, K.H. Detection of Ostreid Herpesvirus 1 from adult Pacific oysters Crassostrea gigas cultured in Korea. Fish. Aquat. Sci. 2013, 16, 131–135. [Google Scholar] [CrossRef]
  86. Shimahara, Y.; Kurita, J.; Kiryu, I.; Nishioka, T.; Yuasa, K.; Kawana, M.; Kamaishi, T.; Oseko, N. Surveillance of Type 1 Ostreid Herpesvirus (OsHV-1) Variants in Japan. Gyobyō Kenkyu 2012, 47, 129–136. [Google Scholar] [CrossRef]
  87. Tun, K.L.; Itoh, N.; Shimizu, Y.; Yamanoi, H.; Yoshinaga, T.; Ogawa, K. Pathogenicity of the protozoan parasite Marteilioides chungmuensis in the Pacific oyster Crassostrea gigas. Int. J. Parasitol. 2008, 38, 211–217. [Google Scholar] [CrossRef]
  88. Enriquez-Espinoza, T.L.; Grijalva-Chon, J.M.; Castro-Longoria, R.; Ramos-Paredes, J. Perkinsus marinus in Crassostrea gigas in the Gulf of California. Dis. Aquat. Org. 2010, 89, 269–273. [Google Scholar] [CrossRef] [PubMed]
  89. Wu, L. Studies on Distribution and Detection Methods of Perkinsus spp. in Mollusk along the Coast of China. Master’s Thesis, Shanghai Ocean Universtiy, Shanghai, China, 2019. [Google Scholar]
  90. Arzul, I.; Garcia, C.; Chollet, B.; Serpin, D.; Lupo, C.; Noyer, M.; Tourbiez, D.; Berland, C.; Dégremont, L.; Travers, M.A. First characterization of the parasite Haplosporidium costale in France and development of a real-time PCR assay for its rapid detection in the Pacific oyster, Crassostrea gigas. Transbound. Emerg. Dis. 2022, 69, e2041–e2058. [Google Scholar] [CrossRef] [PubMed]
  91. Bower, S.M.; Hervio, D.; Meyer, G.R. Infectivity of Mikrocytos mackini, the causative agent of Denman Island disease in Pacific oysters Crassostrea gigas, to various species of oysters. Dis. Aquat. Org. 1997, 29, 111–116. [Google Scholar] [CrossRef]
  92. Grijalva-Chon, J.M.; Castro-Longoria, R.; Enríquez-Espinoza, T.L.; Maeda-Martínez, A.N.; Mendoza-Cano, F. Molecular evidence of the protozoan parasite Marteilia refringens in Crassostrea gigas and Crassostrea corteziensis from the Gulf of California. Lat. Am. J. Aquat. Res. 2015, 43, 776–780. [Google Scholar] [CrossRef]
  93. OIE Ad Hoc Group. Report of the OIE ad Hoc Group on Susceptibility; OIE: Paris, France, 2020; pp. 1–23. [Google Scholar]
Figure 1. Sampling sites in northern China where the survey was conducted. ■ Indicate farms; ● indicate hatcheries.
Figure 1. Sampling sites in northern China where the survey was conducted. ■ Indicate farms; ● indicate hatcheries.
Biology 12 00759 g001
Figure 2. Clinical and histopathological characteristics of oysters infected with CgA1-1 and CgA1-2. (A) Healthy Pacific oyster. (B) Diseased Pacific oyster characterized by extreme emaciation. Arrowheads mark the thinned and shrunken mantle, the black arrow marks the atrophy of the gill, and the star marks the emaciated visceral mass. (C) Digestive gland of healthy Pacific oyster. (D) Digestive gland of diseased Pacific oyster. Black arrows mark the connective tissue necrosis and haemocyte infiltration, stars mark the enlarged and vacuolated digestive tubules, and arrowheads mark the sloughing of epithelial cells of digestive tubules. Scale bars in C and D = 50 μm (400× magnification).
Figure 2. Clinical and histopathological characteristics of oysters infected with CgA1-1 and CgA1-2. (A) Healthy Pacific oyster. (B) Diseased Pacific oyster characterized by extreme emaciation. Arrowheads mark the thinned and shrunken mantle, the black arrow marks the atrophy of the gill, and the star marks the emaciated visceral mass. (C) Digestive gland of healthy Pacific oyster. (D) Digestive gland of diseased Pacific oyster. Black arrows mark the connective tissue necrosis and haemocyte infiltration, stars mark the enlarged and vacuolated digestive tubules, and arrowheads mark the sloughing of epithelial cells of digestive tubules. Scale bars in C and D = 50 μm (400× magnification).
Biology 12 00759 g002
Figure 3. Phylogenetic tree of strain CgA1-1, CgA1-2, and representatives of Vibrio spp. The tree was constructed based on concatenated sequences of atpA, mreB, pyrH, recA, rpoA, rpoD, and gyrB genes using the NJ method. The coloured sectors indicate distinct Vibrio clades. The Harveyi clade is marked with a red line. The scale bar corresponds to 0.05 substitutions per site.
Figure 3. Phylogenetic tree of strain CgA1-1, CgA1-2, and representatives of Vibrio spp. The tree was constructed based on concatenated sequences of atpA, mreB, pyrH, recA, rpoA, rpoD, and gyrB genes using the NJ method. The coloured sectors indicate distinct Vibrio clades. The Harveyi clade is marked with a red line. The scale bar corresponds to 0.05 substitutions per site.
Biology 12 00759 g003
Figure 4. Morphological and growth characteristics of CgA1-1 and CgA1-2. (A) CgA1-1 cells were oval-shaped with one polar flagellum approximately 4.5 μm in length. (B) CgA1-2 cells were rod-shaped with lateral flagella observed at the surface of the cell. (C,D) Both CgA1-1 and CgA1-2 colonies were rounded on TCBS agar, with smooth edges and raised surfaces showing orange colour. (E,F) Growth dynamics of CgA1-1 and CgA1-2. Growth was assayed in 2216E medium by measuring OD600 for 24 h at 15 °C and 25 °C.
Figure 4. Morphological and growth characteristics of CgA1-1 and CgA1-2. (A) CgA1-1 cells were oval-shaped with one polar flagellum approximately 4.5 μm in length. (B) CgA1-2 cells were rod-shaped with lateral flagella observed at the surface of the cell. (C,D) Both CgA1-1 and CgA1-2 colonies were rounded on TCBS agar, with smooth edges and raised surfaces showing orange colour. (E,F) Growth dynamics of CgA1-1 and CgA1-2. Growth was assayed in 2216E medium by measuring OD600 for 24 h at 15 °C and 25 °C.
Biology 12 00759 g004
Figure 5. Haemolytic activity and siderophore production analysis. (A) Growth of strains CgA1-1 and CgA1-2 on sheep blood plate under high and low temperature, scale bar showing 1 cm. (B) Growth of strains CgA1-1 and CgA1-2 on CAS plate under high and low temperature, scale bar showing 1 cm.
Figure 5. Haemolytic activity and siderophore production analysis. (A) Growth of strains CgA1-1 and CgA1-2 on sheep blood plate under high and low temperature, scale bar showing 1 cm. (B) Growth of strains CgA1-1 and CgA1-2 on CAS plate under high and low temperature, scale bar showing 1 cm.
Biology 12 00759 g005
Figure 6. Cumulative mortality curve and histopathological features of experimentally infected Pacific oyster. (A,B) Cumulative mortality curve after exposure to CgA1-1 and CgA1-2 at 15 °C and 25 °C, respectively. (C) Histological features of oysters in the control group. (D,E) Histopathological features of oysters in experimental groups. Black arrows mark the connective tissue necrosis and haemocyte infiltration, stars mark the enlarged and vacuolated digestive tubules, and arrowheads mark the sloughing of epithelial cells of digestive tubules. Scale bar in (CE) = 50 μm. H&E-stained histological sections viewed with 10× eyepiece and 40× objective.
Figure 6. Cumulative mortality curve and histopathological features of experimentally infected Pacific oyster. (A,B) Cumulative mortality curve after exposure to CgA1-1 and CgA1-2 at 15 °C and 25 °C, respectively. (C) Histological features of oysters in the control group. (D,E) Histopathological features of oysters in experimental groups. Black arrows mark the connective tissue necrosis and haemocyte infiltration, stars mark the enlarged and vacuolated digestive tubules, and arrowheads mark the sloughing of epithelial cells of digestive tubules. Scale bar in (CE) = 50 μm. H&E-stained histological sections viewed with 10× eyepiece and 40× objective.
Biology 12 00759 g006
Table 1. Sequences and references of the primers and probes employed in the present study.
Table 1. Sequences and references of the primers and probes employed in the present study.
Primer NameProductPrimer Sequence (5′–3′)References
OsHV-1 [34]
BF GTCGCATCTTTGGATTTAACAA
B4 ACTGGGATCCGACTGACAAC
BP FAM-TGCCCCTGTCATCTTGAGGTATAGACAATC-BHQ
Perkinsus spp. [35]
PERK-F TCCGTGAACCAGTAGAAATCTCAAC
PERK-R GGAAGAAGAGCGACACTGATATGTA
PERK-P FAM-CCCTTTGTGCAGTATGC-MGB
Marteili spp. and Bonamia spp. [36]
Mar-18S-F ACGATCAAAGTGAGCTCGTG
Mar-18S-R CAGTTCCCTCACCCCTGAT
Mar18S-IN FAM-GCATGGAATCGTGGAACGGG-BHQ
Bosp2-18S-F CAGGATGCCCTTAGATGCTC
Bosp2-18S-R GTACAAAGGGCAGGGACGTA
Bosp2-18S-IN HEX-TTGACCCGGCTTGACAAGGC-BHQ
Vibrio housekeeping gene
27F16S rDNAAGAGTTTGATCCTGGCTCAG[37]
1492R GGTTACCTTGTTACGACTT
atpA-FATP synthase alpha subunitCTDAATTCHACNGAAATYAGYG[38]
atpA-R TTACCARGWYTGGGTTGC
mreB-FRod shaping protein B subunitACTTCGTGGCATGTTTTC[39]
mreB-R CCGTGCATATCGATCATTTC
pyrH-FUridylate kinaseATGASNACBAAYCCWAAACC[40]
pyrH-R GTRAABGCNGMYARRTCCA
recA-FRecombinase ATGARAARCARTTYGGTAAAGG[40]
recA-R TCRCCNTTRTAGCTRTACC
rpoA-FRNA polymerase alpha subunitATGCAGGGTTCTGTDACAG[41]
rpoA-R GHGGCCARTTTTCHARRCGC
rpoD-FFactor σ70 RNA polymeraseACGACTGACCCGGTACGCATGTAYATGMGNGARATGGGNACNGT[40]
rpoD-R ATAGAAATAACCAGACGTAAGTTNGCYTCNACCATYTCYTTYT
gyrB-FGyrase B subunitGAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYRA[42]
gyrB-R AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGYCAT
Table 2. Mortality events and dominant bacteria identified over 2 years in Northern China.
Table 2. Mortality events and dominant bacteria identified over 2 years in Northern China.
Sampling DateSampling SiteMonth AgeTemp. (°C)No. of Samples aShell Height (mm)Mortality (%)Dominant Bacteria
2020.03HaiY106.820 (3)90.5 ± 8.660Vibrio alginolyticus
2020.05LaiZ clarvae25.35 tubes (0)/>80/
2020.05RiZ1218.642 (3)118.6 ± 9.540Vibrio alginolyticus
2020.07RongC319.826 (0)35.9 ± 3.370/
2020.08JiM b227.230 (0)14.6 ± 2.1>70/
2020.09DaL524.620 (3)55.3 ± 5.180Vibrio natriegens
2020.09DaL425.18 (2)53.7 ± 4.885Vibrio natriegens
Vibrio alginolyticus
2020.12ChangD b89.524 (3)88.9 ± 7.840–50Pseudoalteromonas nigrifaciens
2020.12ChangD89.432 (3)94.3 ± 8.350Pseudoalteromonas elyakovii
2021.04LaiZlarvae25.23 tubes (0)/80/
2021.05LaiZlarvae2513 tubes (3)/50Pseudoalteromonas piratica
Vibrio alginolyticus
2021.05LaiZlarvae267 tubes (1)/70–80Vibrio harveyi
2021.06RuS1312.312 (3)122.6 ± 9.650Vibrio aestuarianus
2021.07YanT323.530 (3)35.4 ± 3.575Vibrio natriegens
Vibrio alginolyticus
2021.08DaL422.130 (0)56.8 ± 5.170/
2021.08QinHD428.320 (3)52.3 ± 4.460–70Vibrio natriegens
Vibrio alginolyticus
2021.10JiaoN618.230 (5)64.3 ± 5.250–60Vibrio fortis
Vibrio alginolyticus
2021.10JiaoN b618.330 (5)56.4 ± 4.750Vibrio alginolyticus
a Numbers in parentheses represent the number of samples used for bacterial isolation. b The three batches marked are diploid oysters, the rest are triploid oysters. c The one batch of samples tested positive for OsHV-1 infection.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, X.; Huang, B.-W.; Zheng, Y.-D.; Xin, L.-S.; Chen, W.-B.; Yu, T.; Li, C.; Wang, C.-M.; Bai, C.-M. Identification and Characterization of Infectious Pathogens Associated with Mass Mortalities of Pacific Oyster (Crassostrea gigas) Cultured in Northern China. Biology 2023, 12, 759. https://doi.org/10.3390/biology12060759

AMA Style

Zhang X, Huang B-W, Zheng Y-D, Xin L-S, Chen W-B, Yu T, Li C, Wang C-M, Bai C-M. Identification and Characterization of Infectious Pathogens Associated with Mass Mortalities of Pacific Oyster (Crassostrea gigas) Cultured in Northern China. Biology. 2023; 12(6):759. https://doi.org/10.3390/biology12060759

Chicago/Turabian Style

Zhang, Xiang, Bo-Wen Huang, Yu-Dong Zheng, Lu-Sheng Xin, Wen-Bo Chen, Tao Yu, Chen Li, Chong-Ming Wang, and Chang-Ming Bai. 2023. "Identification and Characterization of Infectious Pathogens Associated with Mass Mortalities of Pacific Oyster (Crassostrea gigas) Cultured in Northern China" Biology 12, no. 6: 759. https://doi.org/10.3390/biology12060759

APA Style

Zhang, X., Huang, B.-W., Zheng, Y.-D., Xin, L.-S., Chen, W.-B., Yu, T., Li, C., Wang, C.-M., & Bai, C.-M. (2023). Identification and Characterization of Infectious Pathogens Associated with Mass Mortalities of Pacific Oyster (Crassostrea gigas) Cultured in Northern China. Biology, 12(6), 759. https://doi.org/10.3390/biology12060759

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop