Next Article in Journal
Comparative Mitogenome Analyses Uncover Mitogenome Features and Phylogenetic Implications of the Parrotfishes (Perciformes: Scaridae)
Next Article in Special Issue
The Effects of Short-Term Exposure to pH Reduction on the Behavioral and Physiological Parameters of Juvenile Black Rockfish (Sebastes schlegelii)
Previous Article in Journal
Breast Carcinogenesis during Pregnancy: Molecular Mechanisms, Maternal and Fetal Adverse Outcomes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 12
Issue 3
10.3390/biology12030409
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ammonia Stress Disturbs Moult Signaling in Juvenile Swimming Crab Portunus trituberculatus

by
Daixia Wang
1,2,
Xiaochen Liu
2,3,
Yan Shang
2,3,
Xuee Yu
2,3,
Baoquan Gao
2,3,
Jianjian Lv
2,3,
Jitao Li
2,3,
Ping Liu
2,3,
Jian Li
2,3 and
Xianliang Meng
2,3,4,*
1
National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
2
National Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
3
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, China
4
Key Laboratory of Aquatic Genomics, Ministry of Agriculture and Rural Affairs, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
*
Author to whom correspondence should be addressed.
Biology 2023, 12(3), 409; https://doi.org/10.3390/biology12030409
Submission received: 14 February 2023 / Revised: 28 February 2023 / Accepted: 1 March 2023 / Published: 6 March 2023
(This article belongs to the Special Issue The Relationship between Water Quality and Aquatic Organisms)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Ammonia is the most common contaminant in aquaculture systems, including intensive hatchery systems for crustaceans. Although it has been demonstrated that ammonia can result in abortive moulting and massive mortality of juvenile crustaceans, the underlying mechanisms are still unknown. The present work is aimed at examining the effect of ammonia exposure on the moulting process as well as molt signaling in the swimming crab Portunus trituberculatus, an important aquaculture species in China. We examined the survival rate and moulting rate of the juvenile crabs (C2) and analyzed the expression pattern of the genes in key components of molt signaling during a complete moulting cycle under different concentrations of ammonia. Our results revealed that ammonia has dose-dependent biphasic effects on moulting in juvenile swimming crab. Specifically, low levels of ammonia (5 mg/L) stimulated moulting, while high levels of ammonia (20 mg/L) suppressed the moulting process and caused moulting death syndrome (MDS). The gene expression analysis indicated that low levels of ammonia can reduce the expression of MIH, which encodes the key negative regulator of moulting, and trigger ecdysteroid biosynthesis and ecdysteroid signaling in the juvenile crabs. In contrast, though the high level of ammonia increased MIH expression, it still resulted in excessive ecdysteroids and over-activation of ecdysteroid signaling, which may contribute to the depressed moulting and MDS in the juvenile crabs. The novel findings of this study improve the understanding of ammonia toxicity in brachyura and provide valuable information for hatchery management of P. trituberculatus.

Abstract

Ammonia is a significant concern during hatchery culture in brachyuran species, and its accumulation may lead to abortive moulting and large-scale deaths of the early juveniles. To date, the underlying mechanism for ammonia-induced alteration of the moulting process is still unknown. In this study, we aimed to investigate the effects of ammonia on the moulting as well as the potential mechanisms in early juveniles of the swimming crab Portunus trituberculatus, an important aquaculture species in China. We evaluated the survival rate and moulting rate of the juvenile crabs (C2) and analyzed the expression pattern of the genes in key components of molt signaling during a complete moulting cycle under different concentrations of ammonia nitrogen (the control group: <0.1 mg/L; the LA group: 5 mg/L; and the HA group: 20 mg/L). The results showed that: (1) the survival rate in the LA and HA groups was lower than that in the control group at the end of the experiment, and moulting death syndrome (MDS) was only observed in the HA group; (2) the moulting rate was higher in the LA group and lower in the HA group compared to the control group; (3) consistent with the results of the moulting experiment, MIH showed decreased expression, and genes related to ecdysteroid synthesis, ecdysteroid receptors, and responsive effectors exhibited increased expression in the LA group compared to the control group; and (4) although MIH expression was upregulated, increased expression of the genes associated with ecdysteroid synthesis, ecdysteroid receptors and downstream effectors still observed in the HA group. Our results indicated that low levels of ammonia can promote moulting in juvenile swimming crabs by inhibiting the expression of MIH and activating moult signaling, whereas high levels of ammonia inhibit moulting and lead to MDS through impairing moult signaling.

1. Introduction

The swimming crab Portunus trituberculatus is widely distributed in the coastal waters of Korea, Japan, China, and Southeast Asian countries [1]. This species is dominant in world Portunid fisheries and supports a large aquaculture industry in China. In 2020, its production reached 100,895 tons [2]. In recent years, with rising market demand and the expansion of swimming crab farming, the production of high-quality seed has been unable to meet the needs of the aquaculture industry, which has become an important limiting factor for the sustainable development of the industry. At the larval and juvenile crab stages, individuals are very sensitive to changes in environmental factors, such as temperature, ammonia, and nitrite [3,4]. Under high-density breeding conditions in indoor hatchery ponds, residual feeds and the excretion from the crabs may lead to a rapid accumulation of ammonia [5]. Studies have shown that ammonia is toxic to crustaceans and can affect the moulting process and even cause mass mortality due to failure of proper moulting, a phenomenon known as moulting death syndrome (MDS) [6,7]. Although most existing studies showed that ammonia affects the moulting process in crustaceans, its effects on moulting seem to be controversial in different species. Liao et al. [8] found that ammonia over 16.86 mg/L can cause a significant decrease in the moulting rate of juvenile Portunus pelagicus, and all juvenile crabs died from MDS when the concentration of ammonia nitrogen reached 134.88 mg/L. A study on the mud crab Scylla serrata found that the moulting rate was significantly reduced when the ammonia concentration was too high [9]. In the tiger crab Orithyia sinica, the molt interval was found to be shortened after ammonia exposure [10]. To date, the effects of ammonia exposure on the moulting of P. trituberculatus are still unknown.
In crustaceans, moulting, the process of shedding the old exoskeleton and synthesising a new one, is required for somatic growth. This process is coordinated by a complex interplay of hormones and downstream signaling [11]. Molt-inhibiting hormone (MIH), a neuropeptide from the X-organ sinus glands (XO-SG) complex in the eyestalk, can suppress the synthesis/secretion of ecdysteroids from the Y-organs (YO) [12,13,14]. Ecdysteroids, synthesized from cholesterol through Halloween genes, are moulting hormones in crustaceans. These hormones can bind to the heterodimer receptor complex composed of the ecdysteroid receptor (EcR) and the retinoid-X receptor (RXR) [15,16,17,18]. The binding can activate the transcription of early responsive genes (e.g., the ecdysone-induced protein 75 gene (E75) and nuclear hormone receptor 3 (HR3)), and then the transcription of late responsive genes (e.g., chitinase (Chi)) that are responsible for the moulting procession [18,19,20,21].
It has been reported that numerous environmental factors, such as temperature, salinity, and photoperiod, have been shown to disrupt moult signaling steps and thus affect the moulting process in crustaceans [22,23,24]. For example, low temperature at 14 °C leads to a subdued EcR level and prevents moulting in early juvenile mud crab Scylla paramamosain. In contrast, high temperature at 32 °C, induces a significant increase in EcR expression and dramatically reduced moulting interval in juvenile crabs [25]. A low salinity of 10 psu increases EcR expression and significantly shortens the moulting interval, while a high salinity of 40 psu results in a decreased level of EcR expression and delayed moulting in Macrophthalmus Japonicus [26]. Under low salinity stress, the expression level of Chi is reduced significantly, and moulting frequency concomitantly decreases in Litopenaeus vannamei [27]. There has been no report regarding how environmental ammonia interferes with moult signaling in the swimming crab.
The present study aimed to investigate the effects of ammonia exposure on moulting in early juvenile P. trituberculatus and explore the underlying mechanisms. Here, we assessed the survival and the moulting process of juvenile swimming crabs during a complete moulting cycle under different concentrations of ammonia nitrogen (<0.1 mg/L, 5 mg/L, and 20 mg/L). In addition, we also analyzed the expression pattern of MIH and the genes related to ecdysteroid synthesis (shadow (Sad), spook (Spo), and disembodied (Dib)), ecdysteroid receptors (EcR and RXR), and downstream responsive genes (E75, HR3, and Chi) in different groups. The results of this study can provide a better understanding of ammonia-induced abortive moulting in crustaceans, and useful data for improving hatchery management of swimming crabs.

2. Materials and Methods

2.1. Experimental Animals

Because ammonia usually accumulates in indoor ponds over time and lead to mass mortality at the late stage of hatchery, the second stage juvenile swimming crabs (C2), which are in their last moulting cycle before being released to outdoor culture ponds, were chosen as the experimental animals in this study. The juvenile P. trituberculatus were obtained from Haifeng Company (Weifang, China). Newly metamorphosed C1 juvenile crabs (7.9 ± 0.6 mg) were transferred from indoor hatchery ponds to experimental tanks (40 L) and acclimated at optimum conditions for three days, where aeration was provided continuously, temperature was maintained at 26 °C ± 0.5 °C, salinity was 30.3 ± 0.3, ammonia nitrogen concentration was below 0.1 mg/L, the pH was 7.6 ± 0.2, and photoperiod was set as 12 h of light: and 12 h of dark. Seawater temperature, salinity, and pH were measured using a YSI Professional Plus multi-parameter water quality meter (Yellow Springs Instrument Co., Inc., Yellow Springs, OH, USA). Ammonia nitrogen concentration was determined using the salicylic acid method with a spectrophotometer. One third of the rearing water was exchanged every day using fresh, equivalent-temperature seawater. The juvenile swimming crabs were fed with adult Artemia ad libitum every 8 h, and the leftover feed was removed before feeding. After the three day acclimation, most of the C1 crabs moulted into C2 individuals, and the newly moulted C2 crabs were used for subsequent experiments.

2.2. Survival and Moulting Experiment

Our preliminary experiments found that ammonia exposure may have biphasic effects on juvenile crabs moulting. Therefore, we chose two typical exposure concentrations that have opposite effects on moulting. This study was conducted at three ammonia nitrogen concentrations, including natural seawater (below 0.1 mg/L, the control group), 5 mg/L (the LA group), and 20 mg/L (the HA group). The ammonia nitrogen concentration in the different experimental groups was adjusted with 1 M ammonium chloride (NH4Cl) stock solution, and the culture conditions were the same as those in the acclimation period. A total of 180 newly molted C2 crabs were equally and randomly allocated into the three groups, and there were three replicates for each experimental group. The number of surviving crabs and those that moulted successfully were recorded every 12 h during the whole moulting cycle from C2 to C3. In addition, the stages at which the individuals died and whether they died from MDS were also recorded.

2.3. Sample Collection for Gene Expression Analysis

To explore the potential mechanisms for ammonia-induced abortive moulting, crabs from different groups were collected to analyze the expression pattern of genes related to the moulting process during the moulting cycle from C2 to C3. A total of 900 newly moulted C2 juveniles were equally allocated into the three groups, and each group had three replicates. The culture conditions were the same as those during the acclimation period. For each group, 30 crabs were randomly sampled at 24 h, 48 h, 72 h, 96 h, and 120 h after ammonia exposure. The eyestalk and the remaining parts of each crab were collected, immediately frozen in liquid nitrogen, and stored at −80 °C for the subsequent gene expression analysis.

2.4. Gene Expression Analysis

Since the eyestalks of the juvenile crabs used in this study are too small to extract enough RNA, the eyestalks of ten individuals were pooled together as one replicate, there were three replicates for each group at the same sample point. Similarly, the somatic parts of ten crabs were also pooled for RNA extraction. The total RNA of the samples was isolated using the TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, China), following the manufacturer’s protocol. RNA integrity was assessed using agarose gel electrophoresis (Bio-Rad, Hercules, CA, USA), and RNA quantity was determined using Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription of the total RNA into complementary DNA (cDNA) was carried out using the Evo M-MLV RT mix kit with gDNA Clean for qPCR (Accurate Biology, Changsha, China).
Quantitative real-time PCR (qPCR) was performed to analyze the expression of MIH and the genes associated with ecdysteroid synthesis (Sad, Spo, and Dib), ecdysteroid receptors (EcR and RXR), and downstream responsive genes (E75, HR3, and Chi), using the SYBR® Green Pro Taq HS Premix qPCR Kit II (Accurate Biology, China) in the ABI 7500 fast qPCR system (Applied Biosystems, Foster City, CA, USA). The reaction system was 10 μL, containing 5.0 μL 2× SYBR Green Pro Taq HS Premix II, 0.2 μL ROX Reference Dye, 0.4 μL forward and reverse primers, 3.0 μL RNA-free water, and 1.0 μL cDNA template. The PCR reaction conditions were set as follows: initial denaturation and enzyme activation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The relative expression of moulting-related genes was calculated using the 2−ΔΔCT method [28]. The relative expression of genes was normalized to β-actin [29,30] and the fold-change from the control group CT value was calculated. The specific primers used in this study are listed in Table 1.

2.5. Statistical Analyses

The Mantel–Cox test was used to compare the survival curves of the LA and HA groups with respect to the control group. The moulting rate and gene expression among different groups at each time point were analyzed with one-way analysis of variance (one-way ANOVA) after checking for normality and homogeneity of variance in the data. If significant differences were found, Duncan’s post-hoc test was used to identify the differences between the treatments. The correlation between the expression of all the tested genes was performed using Pearson correlation analysis. The statistically significant level was set as p < 0.05.

3. Results

3.1. Survival and Molting

Survival analysis using the Mantel–Cox test showed that ammonia exposure significantly reduced the survival of the juvenile crabs during the moulting cycle from C2 to C3 (p < 0.05) (Figure 1a). As shown in Figure 1b, over half of the deaths of the juveniles in the control and LA groups occurred after successful moulting, while only 10% died after moulting to C3, and 33% died from MDS in the HA group.
The juvenile crabs in all three groups started moulting after 72 h, and all of the surviving crabs completed moulting before 120 h (Figure 2). Ammonia exposure significantly affected the moulting rate at different times (72 h, p = 0.020; 96 h, p = 0.001; and 120 h, p = 0.000). At 72 h, the moulting rate in the LA group was significantly higher than that in the other groups, which were 2.60 and 3.25 times that of the control and HA groups, respectively. At 96 h, the highest moulting rate was also observed in the LA group. The moulting rate in the HA group was significantly lower than the other two groups at 96 h and 120 h.

3.2. MIH Expression

The expression of MIH in the LA group was significantly higher than the control level only at 24 h (p < 0.05) (Figure 3) and then remained consistently lower than the control group from 48 h to 120 h. The HA group exhibited higher MIH expression than the other two groups from 48 h to 96 h.

3.3. Expression of the Halloween Genes

The expression of the Halloween genes was significantly affected by ammonia stress (Figure 4). In the LA group, the expression of Spo was higher than that of the control from 24 h to 96 h after exposure (p < 0.05) and returned to the control level at 120 h (p > 0.05). Both Dib and Sad in the LA group were significantly upregulated at 48 h and then decreased gradually. Spo in the HA group shared a similar expression pattern with that in the LA group, whereas Dib initially showed a lower expression than the control and LA groups but then exhibited a higher expression from 48 h to 96 h, compared with the control. Sad expression in the HA group was slightly upregulated at 24 h and 48 h and dramatically increased at 72 h. All three Halloween genes showed higher expression in the HA group than in the other groups at the initiation of moulting (72 h, p < 0.05).

3.4. Expression of Ecdysteroid Receptors

For the LA group, the mRNA level of EcR was significantly upregulated at 72 h and 96 h (p < 0.05) (Figure 5) and returned to the control level at 120 h (p > 0.05). For the HA group, EcR mRNA levels were upregulated at 48 h and 72 h which are higher than the control group (p < 0.05), while they were downregulated at 96 h. RXR expression in the LA group showed lower expression than the control group at most sample points except 48 h. RXR levels in the HA group were initially upregulated at 24 h and 48 h (p < 0.05), became downregulated at 72 h (p < 0.05), and then returned to the control level at 96 h and 120 h (p > 0.05).

3.5. Expression of Ecdysteroid-Responsive Genes

E75 in both the LA and HA groups downregulated at 24 h, and its expression in the LA group remained at levels similar to the control group from 48 h to 96 h, while the expression in the HA group was significantly higher than that in the control group (p < 0.05) (Figure 6). Chi in the LA and HA groups shared a similar expression pattern and showed a significant increase in expression in both groups from 48 h to 96 h (p < 0.05). HR3 expression pattern in the LA and HA groups was also similar before 96 h, but its expression in the HA group increased greatly at 120 h which was significantly higher than those in the control and LA groups (p < 0.05). All three ecdysteroid responsive genes exhibited higher expression in the HA group than the other two groups at the initiation of moulting (72 h, p < 0.05).

3.6. Correlation between the Expression of All the Detected Genes

A significantly negative correlation of gene expression was observed between MIH and the genes related to ecdysteroid synthesis (Sad, p < 0.01; Dib, p < 0.05), ecdysteroid receptors (RXR, p < 0.001), and downstream responsive genes (E75, p < 0.05; HR3, p < 0.01; Chi, p < 0.001) in the LA group (Figure 7a). In contrast, MIH only showed a positive correlation in expression with RXR (p < 0.05), while exhibiting no significant correlation with the other tested genes (p > 0.05) (Figure 7b).

4. Discussion

Ammonia is the most common environmental pollutant in aquaculture systems; in fact, it is the main limiting factor in aquaculture practice [32]. Many studies have shown that ammonia is toxic to aquatic animals, including crustaceans, and it affects survival and the moulting process in decapod species [4,33]. Almost all previous studies reported that ammonia reduces survival in decapod species; however, its effects on moulting appear to be opposite in different species [8,9,34]. For example, ammonia exposure at 16 mg/L inhibits the moulting of the mud crab S. paramamosain and causes the death of all individuals at 128 mg/L from MDS [22]. In contrast, ammonia at 50–150 mg/L can significantly reduce the intermoult period and increase moulting frequency in the tiger crab O. sinica [10]. The results of this study showed that the moulting rate was significantly higher in the LA (5 mg/L) group and lower in the HA (20 mg/L) group, compared with the control group. It is noteworthy that none of the individuals in the LA group died from MDS, while 33% of the crabs in the HA group died of MDS. These results for the first time indicated that environmental ammonia has dose-dependent, biphasic effects on the moulting of juvenile swimming crabs. Specifically, low levels of ammonia stimulate the moulting process, while high levels of ammonia suppress the moulting process and cause moulting failure.
The moulting of crustaceans is controlled by a complex signaling network involving multiple hormones and their downstream signaling pathways [35]. To explore the underlying mechanisms for the ammonia-induced alteration of the moulting process, we analyzed the expression of nine genes implicated in key components of molt signaling in juvenile P. trituberculatus during a complete moulting cycle under ammonia stress. MIH is considered to be the primary neurohormone responsible for crustacean moulting inhibition, and it works by negatively regulating ecdysteroids biosynthesis [36,37,38,39]. Recent studies have reported that injection of recombinant MIH represses expression of the Halloween genes, which are essential for ecdysteroidogenesis, and catalyzes the conversion of cholesterol to ecdysteroids. Conversely, withdrawal of MIH by eyestalk ablation or knockdown of MIH by RNAi induces expression of the Halloween genes [17,20,40,41,42]. These results indicated that the inhibitory effect of MIH on ecdysteroids biosynthesis occurs via transcriptional repression of the Halloween genes in YO [14,20]. In the present study, MIH was downregulated, and accordingly, the Halloween genes, namely Spo, Dib, and Sad, were upregulated in the LA group. In addition, Pearson’s analysis showed that MIH exhibited a significantly negative correlation in expression with Dib and Sad. The results were consistent with the moulting experiment, which showed a higher moulting rate in the LA group at the early stage after ammonia exposure, suggesting that ammonia at 5 mg/L promotes moulting in juvenile swimming crabs by inhibiting MIH expression, which in turn induces expression of the Halloween genes and stimulates ecdysteroidogenesis.
Considering that the HA group had a lower moulting rate compared to the control group, we expected increased expression of MIH and decreased expression of the Halloween genes. Unexpectedly, upregulation of both MIH and the tested Halloween genes was observed in the HA group, indicating that environmental ammonia at 20 mg/L can abolish the inhibitory activity of MIH on the transcription of the Halloween genes in juvenile P. trituberculatus. However, to date, the signaling mechanisms by which MIH regulates the Halloween genes are not well understood [43], and the MIH receptor remains unidentified [44,45]. Several studies in decapods have suggested that the receptors for MIH are GPCRs located in YO and that the signal is transduced by cyclic nucleotide second messengers [45]. It is therefore possible that high levels of ammonia may disrupt the membrane receptor-mediated signaling of MIH, thereby promoting ecdysteroid biosynthesis.
In crustaceans, ecdysteroid action is mediated via the heterodimerization of two nuclear receptors, EcR and its partner, RXR [46]. The EcR/RXR heterodimer binds to hormone response elements to induce the expression of early genes, and these early responsive gene products are transcription factors that induce ecdysteroid signaling cascade [47,48]. A number of studies in decapods such as Gecarcinus lateralis have demonstrated that EcR expression is generally in accordance with the titer of ecdysteroid in hemolymph during a moult cycle and that ecdysteroid injection upregulates expression of EcR, indicating that ecdysteroid triggers EcR expression [49,50,51]. We found that the levels of EcR were increased at both concentrations of 5 mg/L and 20 mg/L in this study. Furthermore, the early ecdysteroid-responsive genes, E75 and HR3, and the terminal gene of ecdysteroid signaling, Chi, also exhibited upregulated expression after ammonia exposure. Taken together, the results further indicated that ammonia stress can induce ecdysteroidogenesis and activate ecdysteroid downstream signaling in the juvenile swimming crabs.
Contrary to the results of the present study, our recent study in adult swimming crabs found that ammonia stress results in a significant reduction of EcR [52]. Similarly, Si et al. [53] found that expression of ecdysteroid responsive genes, Chi, and ecdysteroid-regulated-like protein, are significantly downregulated after ammonia exposure. These results suggested that the effects of ammonia on ecdysteroid signaling in the swimming crab are developmental stage specific. It is known that ecdysteroids display pleiotropic functions at different stages of the life cycle in crustaceans, and they orchestrate metamorphosis and moulting at larval and growing stages, while regulating vitellogenesis at reproductive-developmental stages [24,52]. The pleiotropic activity of ecdysteroid and the developmental stage-specific effects of ammonia on ecdysteroid signaling may lead to diverse consequences following ammonia exposure, and thus more work that focuses on the individuals at different developmental stages should be carried out to clarify the adverse effects of ammonia in the swimming crabs and the potential mechanisms.
EcR expression has been extensively used as a biomarker for accessing disruption of ecdysteroid signaling as well as the moulting-interfering effects of many environmental stressors [25,51,54] and toxicants [55], because it plays important roles in the ecdysteroid signaling pathway and is very sensitive to environmental changes [56]. In this study, expression of EcR and ecdysteroid-responsive genes in both ammonia-treated groups were significantly upregulated, confirming that EcR could be a reliable biomarker for monitoring ecdysteroid signaling in juvenile swimming crab under ammonia stress. However, EcR expression seems not to be a suitable biomarker for evaluating the moulting-interfering effect of ammonia, as moulting was induced and suppressed in the LA and HA groups, respectively, though expression of EcR in these two groups showed a similar trend after ammonia exposure.
The precise regulation of ecdysteroid levels is considered fundamental to successful moulting of crustaceans [25,56]. Previous studies showed that an injection of ecdysteroids at a low dose can accelerate moulting, but administration at a high dose may cause failure of moulting and an increase in mortality [57,58,59]. In this study, though most of the tested genes showed similar trends in the LA and HA groups, there was an obvious difference in the moulting rate and the number of individuals who died from MDS between the two groups. The difference may be associated with the levels of ecdysteroid in these groups under ammonia stress. Previous studies reported that the expression of the Halloween genes responsible for ecdysteroid biosynthesis usually showed a positive correlation with ecdysteroid levels [60]. The higher expression of all the tested Halloween genes in the HA group, particularly at the initiation of the moulting (72 h), may lead to a higher level of ecdysteroids compared with the LA group. This is supported by the higher expression of EcR and the ecdysteroid responsive genes in the HA group, as the expression of these genes is reported to be induced by ecdysteroid in a dose-dependent manner [41,50]. Thus, we propose that a high level of ammonia could result in excessive ecdysteroids and over-activation of ecdysteroid signaling in juvenile P. trituberculatus, thereby causing depression of the moulting process and death due to moulting failure. Because of the difficulty in getting hemolymph from the early juveniles, we were not able to analyze the levels of ecdysteroids in this study. More detailed studies that accurately determine the ecdysteroid levels in juvenile individuals are still required to confirm this hypothesis.
In summary, to our knowledge, this is the first study to investigate the effects of ammonia on moulting and molt signaling in juvenile P. trituberculatus, an important aquaculture species in China. The results revealed that ammonia led to a decreased survival rate in both ammonia-exposed groups. Given that even a low level of ammonia exposure (5 mg/L) can significantly reduce the survival of the juvenile crabs, particular attention should be paid to ammonia control during the intensive hatchery of P. trituberculatus. In addition, we found ammonia had dose-dependent biphasic effects on juvenile swimming crab moulting. Low concentrations of ammonia (5 mg/L) promoted moulting, while high concentrations of ammonia (20 mg/L) resulted in a decreased moulting rate and caused MDS. The gene expression analysis indicated that low levels of ammonia can reduce MIH expression, and trigger ecdysteroid biosynthesis and ecdysteroid signaling in the juvenile crabs. In contrast, while high levels of ammonia increased MIH expression it also resulted in excessive ecdysteroids and over-activation of ecdysteroid signaling, which may contribute to the depressed moulting and MDS in juvenile crabs. The findings of this study improve our understanding of the adverse effects of ammonia stress on juvenile P. trituberculatus and the underlying mechanisms, which provides useful information for aquaculture management during hatching.

Author Contributions

Conceptualization, D.W. and X.M.; data curation, B.G. and J.L. (Jian Li); formal analysis, X.M.; funding acquisition, X.M.; investigation, D.W.; methodology, D.W., X.L., Y.S., X.Y. and X.M.; project administration, B.G.; resources, P.L. and X.M.; software, D.W.; supervision, X.M.; validation, B.G., J.L. (Jianjian Lv) and J.L. (Jitao Li); visualization, D.W.; writing—original draft, D.W.; writing—review and editing, X.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Chinese National Science Foundation (42276122), National Key R&D Program of China (2019YFD0900402), the Earmarked Fund (CARS48), and the Central Public-Interest Scientific Institution Basal Research Fund, CAFS (2020TD46).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated by this study are available in this manuscript.

Conflicts of Interest

The authors declare no conflict of interest and state that the funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Dai, A.; Yang, S.; Song, Y. Marine Crabs in China Sea; Marine Press: Beijing, China, 1986; pp. 194–196. [Google Scholar]
  2. Wang, D.; Liu, X.; Zhang, J.; Gao, B.; Liu, P.; Li, J.; Meng, X. Identification of Neuropeptides Using Long-Read RNA-Seq in the Swimming Crab Portunus Trituberculatus, and Their Expression Profile Under Acute Ammonia Stress. Front. Physiol. 2022, 13, 910585. [Google Scholar] [CrossRef]
  3. Bucking, C. A Broader Look at Ammonia Production, Excretion, and Transport in Fish: A Review of Impacts of Feeding and the Environment. J. Comp. Physiol. B 2017, 187, 1–18. [Google Scholar] [CrossRef] [PubMed]
  4. Romano, N.; Zeng, C. Toxic Effects of Ammonia, Nitrite, and Nitrate to Decapod Crustaceans: A Review on Factors Influencing Their Toxicity, Physiological Consequences, and Coping Mechanisms. Rev. Fish. Sci. 2013, 21, 1–21. [Google Scholar] [CrossRef]
  5. Wang, J.F.; Jiang, L.X.; Li, Y.L.; Li, J.; Wang, R.J. The Effect of Ammonia-N and Sulfureted Hydrogen in the Growth and Ecdysis of Portunus trituberculatus Larvae. J. Qingdao Agric. Univ. Nat. Sci. 2007, 24, 257–260. [Google Scholar]
  6. Lu, Y.; Wang, F.; Zhao, Z.; Dong, S.; Ma, S. Effects of Salinity on Growth, Molt and Energy Utilization of Juvenile Swimming Crab Portunus Trituberculatus. J. Fish. Sci. China 2013, 19, 237–245. [Google Scholar] [CrossRef]
  7. Romano, N.; Zeng, C. Subchronic Exposure to Nitrite, Potassium and Their Combination on Survival, Growth, Total Haemocyte Count and Gill Structure of Juvenile Blue Swimmer Crabs, Portunus pelagicus. Ecotoxicol. Environ. Saf. 2009, 72, 1287–1295. [Google Scholar] [CrossRef]
  8. Liao, Y.Y.; Wang, H.H.; Lin, Z.G. Effect of Ammonia and Nitrite on Vigour, Survival Rate, Moulting Rate of the Blue Swimming Crab Portunus Pelagicus Zoea. Aquac. Int. 2011, 19, 339–350. [Google Scholar] [CrossRef]
  9. Neil, L.L.; Fotedar, R.; Shelley, C.C. Effects of Acute and Chronic Toxicity of Unionized Ammonia on Mud Crab, Scylla Serrata (Forsskal, 1755) Larvae. Aquac. Res. 2005, 36, 927–932. [Google Scholar] [CrossRef]
  10. Koo, J.G.; Kim, S.G.; Jee, J.H.; Kim, J.M.; Bai, S.C.; Kang, J.C. Effects of Ammonia and Nitrite on Survival, Growth and Moulting in Juvenile Tiger Crab, Orithyia Sinica (Linnaeus). Aquac. Res. 2005, 36, 79–85. [Google Scholar] [CrossRef]
  11. Cohen, S.; Ilouz, O.; Manor, R.; Sagi, A.; Khalaila, I. Transcriptional Silencing of Vitellogenesis-Inhibiting and Molt-Inhibiting Hormones in the Giant Freshwater Prawn, Macrobrachium Rosenbergii, and Evaluation of the Associated Effects on Ovarian Development. Aquaculture 2021, 538, 736540. [Google Scholar] [CrossRef]
  12. Covi, J.A.; Chang, E.S.; Mykles, D.L. Conserved Role of Cyclic Nucleotides in the Regulation of Ecdysteroidogenesis by the Crustacean Molting Gland. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2009, 152, 470–477. [Google Scholar] [CrossRef]
  13. Chung, J.S.; Zmora, N.; Katayama, H.; Tsutsui, N. Crustacean Hyperglycemic Hormone (CHH) Neuropeptides family: Functions, Titer, and Binding to Target Tissues. Gen. Comp. Endocrinol. 2010, 166, 447–454. [Google Scholar] [CrossRef]
  14. Asazuma, H.; Nagata, S.; Nagasawa, H. Inhibitory Effect of Molt-Inhibiting Hormone on Phantom Expression in the Y-Organ of the Kuruma Prawn, Marsupenaeus japonicus. Arch. Insect Biochem. Physiol. 2009, 72, 220–233. [Google Scholar] [CrossRef]
  15. Han, T.; Wang, J.; Li, X.; Yang, Y.; Wang, J.; Hu, S.; Jiang, Y.; Mu, C.; Wang, C. Effects of Dietary Cholesterol Levels on the Growth, Molt Performance, and Immunity of Juvenile Swimming Crab, Portunus trituberculatus. Isr. J. Aquac.-Bamidgeh 2015, 67. [Google Scholar] [CrossRef]
  16. Niwa, R.; Niwa, Y.S. Enzymes for Ecdysteroid Biosynthesis: Their Biological Functions in Insects and Beyond. Biosci. Biotechnol. Biochem. 2014, 78, 1283–1292. [Google Scholar] [CrossRef]
  17. Schumann, I.; Kenny, N.; Hui, J.; Hering, L.; Mayer, G. Halloween Genes in Panarthropods and the Evolution of the Early Moulting Pathway in Ecdysozoa. R. Soc. Open Sci. 2018, 5, 180888. [Google Scholar] [CrossRef] [PubMed]
  18. Cui, X.; Zhu, D.; Tang, J.; Xie, X.; Qiu, X. Cloning and expression analysis of ecdysteroid receptor(EcR) in Portunus trituberculatus. J. Fish. China 2013, 37, 48–57. [Google Scholar] [CrossRef]
  19. Xu, Y.; Wang, J.J.; Ge, Q.Q.; Cui, Y.T.; Ma, L.; Li, J. Cloning of E75 Gene and Expression Analysis of E75, ECR and RXR During Different Molting Stages of Exopalaemon carinicauda. Prog. Fish. Sci. 2018, 39, 110–117. [Google Scholar] [CrossRef]
  20. Xie, X.; Liu, Z.; Liu, M.; Tao, T.; Shen, X.; Zhu, D. Role of Halloween Genes in Ecdysteroids Biosynthesis of the Swimming Crab (Portunus Trituberculatus): Implications from RNA Interference and Eyestalk Ablation. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2016, 199, 105–110. [Google Scholar] [CrossRef]
  21. Rocha, J.; Garcia-Carreño, F.L.; Muhlia-Almazán, A.; Peregrino-Uriarte, A.B.; Yépiz-Plascencia, G.; Córdova-Murueta, J.H. Cuticular Chitin Synthase and Chitinase mRNA of Whiteleg Shrimp Litopenaeus Vannamei during the Molting Cycle. Aquaculture 2012, 330–333, 111–115. [Google Scholar] [CrossRef]
  22. Huang, H.T. Effects of Temperature, Salinity, Dissolved Oxygen, Ammonia-N and Nitrite-N on the Molting of Scylla paramamosain. Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2012. [Google Scholar]
  23. He, B.F. Chronic Toxicity of Ammonia-N, Nitrire-N and Salinity on Development of the Embryo and Larva of Portunus trituberculatus. Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2013. [Google Scholar]
  24. Mykles, D.L. Ecdysteroid Metabolism in Crustaceans. J. Steroid Biochem. Mol. Biol. 2011, 127, 196–203. [Google Scholar] [CrossRef]
  25. Gong, J.; Yu, K.; Shu, L.; Ye, H.; Li, S.; Zeng, C. Evaluating the Effects of Temperature, Salinity, Starvation and Autotomy on Molting Success, Molting Interval and Expression of Ecdysone Receptor in Early Juvenile Mud Crabs, Scylla paramamosain. J. Exp. Mar. Biol. Ecol. 2015, 464, 11–17. [Google Scholar] [CrossRef]
  26. Nikapitiya, C.; Kim, W.S.; Park, K.; Kwak, I.S. Identification of Potential Markers and Sensitive Tissues for Low or High Salinity Stress in an Intertidal Mud Crab (Macrophthalmus Japonicus). Fish Shellfish Immunol. 2014, 41, 407–416. [Google Scholar] [CrossRef]
  27. Gao, W.H.; Tan, B.P.; Mai, K.S.; Chi, K.S.; Liu, H.Y.; Dong, X.H.; Yang, Q.H. Dentification of Differentially Expressed Genes in Hepatopancreas of White Shrimp Litopenaeus Vannamei Induced by Long-Term Low-Salinity Stress. Period. Ocean Univ. China 2013, 43, 39–46. [Google Scholar]
  28. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  29. Yue, F.; Pan, L.; Xie, P.; Zheng, D.; Li, J. Immune Responses and Expression of Immune-Related Genes in Swimming Crab Portunus Trituberculatus Exposed to Elevated Ambient Ammonia-N Stress. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2010, 157, 246–251. [Google Scholar] [CrossRef]
  30. Zhang, J.; Zhang, M.; Jayasundara, N.; Ren, X.; Gao, B.; Liu, P.; Li, J.; Meng, X. Physiological and Molecular Responses in the Gill of the Swimming Crab Portunus Trituberculatus During Long-Term Ammonia Stress. Front. Mar. Sci. 2021, 8, 797241. [Google Scholar] [CrossRef]
  31. Xie, X.; Zhou, Y.; Liu, M.; Tao, T.; Jiang, Q.; Zhu, D. The Nuclear Receptor E75 from the Swimming Crab, Portunus Trituberculatus: CDNA Cloning, Transcriptional Analysis, and Putative Roles on Expression of Ecdysteroid-Related Genes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2016, 200, 69–77. [Google Scholar] [CrossRef] [PubMed]
  32. Zhao, M.; Yao, D.; Li, S.; Zhang, Y.; Aweya, J.J. Effects of Ammonia on Shrimp Physiology and Immunity: A Review. Rev. Aquac. 2020, 12, 2194–2211. [Google Scholar] [CrossRef]
  33. González-Peña, M.D.C.; Moreira, M.D.G.B.S. Effect of Dietary Cellulose Level on Specific Dynamic Action and Ammonia Excretion of the Prawn Macrobrachium Rosenbergii (De Man 1879): Cellulose on SDA M. Rosenbergii. Aquac. Res. 2003, 34, 821–827. [Google Scholar] [CrossRef]
  34. Chen, J.C.; Kou, Y.Z. Effects of Ammonia on Growth and Molting of Penaeus Japonicus Juveniles. Aquaculture 1992, 104, 249–260. [Google Scholar] [CrossRef]
  35. Du, J.L. A Preliminary Study on the Structure and Function of the Ecdysone Response Genes of the Pacific White Shrimp Litopenaeus vannamei and Their Regulation to Wnt Signal Pathway. Master’s Thesis, University of Chinese Academy of Sciences, Beijing, China, 2018. [Google Scholar]
  36. Zhang, M.; Liu, P.; Li, J.T.; Li, J. Cloning and Expression of Molt-inhibiting Hormone Gene from Exopalaemon carinicauda under Environmental Stresses. Oceanol. Limnol. Sin. 2015, 46. [Google Scholar] [CrossRef]
  37. Chung, J.S.; Webster, S.G. Dynamics of in Vivo Release of Molt-Inhibiting Hormone and Crustacean Hyperglycemic Hormone in the Shore Crab, Carcinus maenas. Endocrinology 2005, 146, 5545–5551. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, M.; Pan, L.; Li, L.; Zheng, D. Molecular Cloning, Characterization and Recombinant Expression of Crustacean Hyperglycemic Hormone in White Shrimp Litopenaeus vannamei. Peptides 2014, 53, 115–124. [Google Scholar] [CrossRef]
  39. Wang, C.; Zhu, D.; Qi, Y.; Hu, Z.; Xie, X.; Shen, J. Molt-inhibiting hormone levels and ecdysteroid titer during a molt cycle of Portunus trituberculatus. ACTA Hydrobiol. Sin. 2013, 37, 22–28. [Google Scholar] [CrossRef]
  40. Rewitz, K.F.; Gilbert, L.I. Daphnia Halloween Genes That Encode Cytochrome P450s Mediating the Synthesis of the Arthropod Molting Hormone: Evolutionary Implications. BMC Evol. Biol. 2008, 8, 60. [Google Scholar] [CrossRef]
  41. Iga, M.; Smagghe, G. Identification and Expression Profile of Halloween Genes Involved in Ecdysteroid Biosynthesis in Spodoptera littoralis. Peptides 2010, 31, 456–467. [Google Scholar] [CrossRef]
  42. Marchal, E.; Badisco, L.; Verlinden, H.; Vandersmissen, T.; Van Soest, S.; Van Wielendaele, P.; Vanden Broeck, J. Role of the Halloween Genes, Spook and Phantom in Ecdysteroidogenesis in the Desert Locust, Schistocerca gregaria. J. Insect Physiol. 2011, 57, 1240–1248. [Google Scholar] [CrossRef]
  43. Weiner, A.C.; Chen, H.-Y.; Roegner, M.E.; Watson, R.D. Calcium Signaling and Regulation of Ecdysteroidogenesis in Crustacean Y-Organs. Gen. Comp. Endocrinol. 2021, 314, 113901. [Google Scholar] [CrossRef]
  44. Mykles, D.L. Signaling Pathways That Regulate the Crustacean Molting Gland. Front. Endocrinol. 2021, 12, 1–21. [Google Scholar] [CrossRef]
  45. Priya, T.A.J.; Li, F.; Zhang, J.; Wang, B.; Zhao, C.; Xiang, J. Molecular Characterization and Effect of RNA Interference of Retinoid X Receptor (RXR) on E75 and Chitinase Gene Expression in Chinese Shrimp Fenneropenaeus chinensis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2009, 153, 121–129. [Google Scholar] [CrossRef]
  46. Kim, H.W.; Lee, S.G.; Mykles, D.L. Ecdysteroid-Responsive Genes, RXR and E75, in the Tropical Land Crab, Gecarcinus Lateralis: Differential Tissue Expression of Multiple RXR Isoforms Generated at Three Alternative Splicing Sites in the Hinge and Ligand-Binding Domains. Mol. Cell. Endocrinol. 2005, 242, 80–95. [Google Scholar] [CrossRef] [PubMed]
  47. Tiu, S.H.K.; Hult, E.F.; Yagi, K.J.; Tobe, S.S. Farnesoic Acid and Methyl Farnesoate Production during Lobster Reproduction: Possible Functional Correlation with Retinoid X Receptor Expression. Gen. Comp. Endocrinol. 2012, 175, 259–269. [Google Scholar] [CrossRef] [PubMed]
  48. Kim, H.-W.; Chang, E.S.; Mykles, D.L. Three Calpains and Ecdysone Receptor in the Land Crab Gecarcinus Lateralis: Sequences, Expression and Effects of Elevated Ecdysteroid Induced by Eyestalk Ablation. J. Exp. Biol. 2005, 208, 3177–3197. [Google Scholar] [CrossRef]
  49. Hannas, B.R.; LeBlanc, G.A. Expression and Ecdysteroid Responsiveness of the Nuclear Receptors HR3 and E75 in the Crustacean Daphnia Magna. Mol. Cell. Endocrinol. 2010, 315, 208–218. [Google Scholar] [CrossRef]
  50. Shechter, A.; Tom, M.; Yudkovski, Y.; Weil, S.; Chang, S.A.; Chang, E.S.; Chalifa-Caspi, V.; Berman, A.; Sagi, A. Search for Hepatopancreatic Ecdysteroid-Responsive Genes during the Crayfish Molt Cycle: From a Single Gene to Multigenicity. J. Exp. Biol. 2007, 210, 3525–3537. [Google Scholar] [CrossRef] [PubMed]
  51. Meng, X.; Jayasundara, N.; Zhang, J.; Ren, X.; Gao, B.; Li, J.; Liu, P. Integrated Physiological, Transcriptome and Metabolome Analyses of the Hepatopancreas of the Female Swimming Crab Portunus Trituberculatus under Ammonia Exposure. Ecotoxicol. Environ. Saf. 2021, 228, 113026. [Google Scholar] [CrossRef]
  52. Si, L.; Pan, L.; Wang, H.; Zhang, X. Transcriptomic Response to Ammonia-N Stress in the Hepatopancreas of Swimming Crab Portunus trituberculatus. Mar. Life Sci. Technol. 2020, 2, 135–145. [Google Scholar] [CrossRef]
  53. Huang, Y.; Zhang, M.; Li, Y.; Wu, D.; Liu, Z.; Jiang, Q.; Zhao, Y. Effects of Salinity Acclimation on the Growth Performance, Osmoregulation and Energy Metabolism of the Oriental River Prawn, Macrobrachium Nipponense (De Haan). Aquac. Res. 2019, 50, 685–693. [Google Scholar] [CrossRef]
  54. Mugnier, C.; Justou, C. Combined Effect of External Ammonia and Molt Stage on the Blue Shrimp Litopenaeus Stylirostris Physiological Response. J. Exp. Mar. Biol. Ecol. 2004, 309, 35–46. [Google Scholar] [CrossRef]
  55. Riddiford, L.M.; Cherbas, P.; Truman, J.W. Ecdysone Receptors and Their Biological Actions. Vitam. Horm. 2000, 60, 1–73. [Google Scholar]
  56. Cheng, J.H.; Chang, E.S. Ecdysteroid Treatment Delays Ecdysis in the Lobster, Homarus americanus. Biol. Bull. 1991, 181, 169–174. [Google Scholar] [CrossRef] [PubMed]
  57. Chang, E.S.; Mykles, D.L. Regulation of Crustacean Molting: A Review and Our Perspectives. Gen. Comp. Endocrinol. 2011, 172, 323–330. [Google Scholar] [CrossRef] [PubMed]
  58. Chang, E.S. Comparative Endocrinology of Molting and Reproduction: Insects and Crustaceans. Annu. Rev. Entomol. 1993, 38, 161–180. [Google Scholar] [CrossRef] [PubMed]
  59. Gilbert, L.I. Halloween Genes Encode P450 Enzymes That Mediate Steroid Hormone Biosynthesis in Drosophila Melanogaster. Mol. Cell. Endocrinol. 2004, 215, 1–10. [Google Scholar] [CrossRef] [PubMed]
  60. Nakagawa, Y.; Henrich, V.C. Arthropod Nuclear Receptors and Their Role in Molting: Arthropod Nuclear Receptors. FEBS J. 2009, 276, 6128–6157. [Google Scholar] [CrossRef] [PubMed]
Biology 12 00409 g001 550
Figure 1. Survival rate (a) and mortality composition (b) of P. trituberculatus in different groups.
Figure 1. Survival rate (a) and mortality composition (b) of P. trituberculatus in different groups.
Biology 12 00409 g001
Biology 12 00409 g002 550
Figure 2. Molting rate of juvenile P. trituberculatus at different ammonia nitrogen concentrations. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Figure 2. Molting rate of juvenile P. trituberculatus at different ammonia nitrogen concentrations. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Biology 12 00409 g002
Biology 12 00409 g003 550
Figure 3. MIH mRNA expression in juvenile crabs exposed to ammonia nitrogen stress. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Figure 3. MIH mRNA expression in juvenile crabs exposed to ammonia nitrogen stress. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Biology 12 00409 g003
Biology 12 00409 g004 550
Figure 4. Expression patterns of Halloween family genes in juvenile crabs exposed to ammonia nitrogen stress. (a) Spo, (b) Dib, and (c) Sad. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Figure 4. Expression patterns of Halloween family genes in juvenile crabs exposed to ammonia nitrogen stress. (a) Spo, (b) Dib, and (c) Sad. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Biology 12 00409 g004
Biology 12 00409 g005 550
Figure 5. Expression patterns of receptors in the moulting signal pathway from juvenile crabs under ammonia nitrogen stress. (a) EcR, (b) RXR. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Figure 5. Expression patterns of receptors in the moulting signal pathway from juvenile crabs under ammonia nitrogen stress. (a) EcR, (b) RXR. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Biology 12 00409 g005
Biology 12 00409 g006 550
Figure 6. Gene expression pattern of downstream regulators in juvenile crabs exposed to ammonia nitrogen stress. (a) E75, (b) HR3, and (c) Chi. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Figure 6. Gene expression pattern of downstream regulators in juvenile crabs exposed to ammonia nitrogen stress. (a) E75, (b) HR3, and (c) Chi. At the same time, the letters indicate significant differences between experimental groups (p < 0.05).
Biology 12 00409 g006
Biology 12 00409 g007 550
Figure 7. Correlation analysis of the moulting signals in the juvenile crabs under ammonia nitrogen stress. (a) correlation analysis for the LA group; (b) correlation analysis for the HA group. * represents a significant difference between two genes (p < 0.05), ** represents p < 0.01, and *** represents p < 0.001.
Figure 7. Correlation analysis of the moulting signals in the juvenile crabs under ammonia nitrogen stress. (a) correlation analysis for the LA group; (b) correlation analysis for the HA group. * represents a significant difference between two genes (p < 0.05), ** represents p < 0.01, and *** represents p < 0.001.
Biology 12 00409 g007
Table
Table 1. Primer sequence used in the research.
Table 1. Primer sequence used in the research.
GeneForward PrimerReverse Primer
β-actinCGAAACCTTCAACACTCCCGGGGACAGTGTGTGAAACGCC
MIHCCGCTGAATCTCACACCGATAAGGTTCCGCTGAGTTCCTG
E751CGAGAGCCTAGTGATGTAATGAGTGATGAGCGAGTA
HR3CTCACGAGGAGCTCTGGTTCTGCGAGAATTTCCTGAATCC
EcR1TAAGTGATGACGACTCGGATGCACGAGCAAGCCTTTAGCAGTG
RXR 1AGCGTCAGAGGACAAAAGGCTGGTCCAGTGGCTGCTCAT
Chi1CCCAGCCGATAGGAAGACCCGCTGTCAGTATCATTCCGTTAG
Sad1CACGGCATTTTCAAGGAGAAAGGCGTCATCCAGGCACT
Dib1TGCGAGTCTGCTTGAGGTGAGCCATTGTCAGTGGGGAG
Spo1GGGACGAGCCCAATAAGTTCTGGTGCTGAAAGGGATGA
1 The primers for E75, EcR, RXR, Chi, Sad, Dib, and Spo were from Xie et al. (2016) [31] and Xie et al. (2016) [20].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, D.; Liu, X.; Shang, Y.; Yu, X.; Gao, B.; Lv, J.; Li, J.; Liu, P.; Li, J.; Meng, X. Ammonia Stress Disturbs Moult Signaling in Juvenile Swimming Crab Portunus trituberculatus. Biology 2023, 12, 409. https://doi.org/10.3390/biology12030409

AMA Style

Wang D, Liu X, Shang Y, Yu X, Gao B, Lv J, Li J, Liu P, Li J, Meng X. Ammonia Stress Disturbs Moult Signaling in Juvenile Swimming Crab Portunus trituberculatus. Biology. 2023; 12(3):409. https://doi.org/10.3390/biology12030409

Chicago/Turabian Style

Wang, Daixia, Xiaochen Liu, Yan Shang, Xuee Yu, Baoquan Gao, Jianjian Lv, Jitao Li, Ping Liu, Jian Li, and Xianliang Meng. 2023. "Ammonia Stress Disturbs Moult Signaling in Juvenile Swimming Crab Portunus trituberculatus" Biology 12, no. 3: 409. https://doi.org/10.3390/biology12030409

APA Style

Wang, D., Liu, X., Shang, Y., Yu, X., Gao, B., Lv, J., Li, J., Liu, P., Li, J., & Meng, X. (2023). Ammonia Stress Disturbs Moult Signaling in Juvenile Swimming Crab Portunus trituberculatus. Biology, 12(3), 409. https://doi.org/10.3390/biology12030409

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop