Next Article in Journal
Advances in Mass Spectrometry-Based Single Cell Analysis
Previous Article in Journal
Genetic Variants in Protein Tyrosine Phosphatase Non-Receptor Type 23 Are Responsible for Mesiodens Formation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Arthropod Ectoparasites of Two Rodent Species Occurring in Varied Elevations on Tanzania’s Second Highest Mountain

by
Genet B. Gebrezgiher
1,2,3,4,*,
Rhodes H. Makundi
1,2,
Abdul A. S. Katakweba
1,2,
Steven R. Belmain
5,
Charles M. Lyimo
6 and
Yonas Meheretu
4,7,8
1
African Centre of Excellence for Innovative Rodent Pest Management and Biosensor Technology Development, Sokoine University of Agriculture, Morogoro P.O. Box 3110, Tanzania
2
Institute of Pest Management, Sokoine University of Agriculture, Morogoro P.O. Box 3110, Tanzania
3
Department of Wildlife Management, Sokoine University of Agriculture, Morogoro P.O. Box 3073, Tanzania
4
Department of Biology, Mekelle University, Mekelle P.O. Box 231, Ethiopia
5
Natural Resources Institute, University of Greenwich, Chatham Maritime ME4 4TB, UK
6
Department of Animal, Aquaculture and Range Sciences, Sokoine University of Agriculture, Morogoro P.O. Box 3004, Tanzania
7
Institute of Mountain Research and Development, Mekelle University, Mekelle P.O. Box 3102, Ethiopia
8
Department of Wildlife, Fish and Environmental Studies, Swedish University of Agricultural Sciences, 901 83 Umea, Sweden
*
Author to whom correspondence should be addressed.
Biology 2023, 12(3), 394; https://doi.org/10.3390/biology12030394
Submission received: 2 January 2023 / Revised: 23 February 2023 / Accepted: 24 February 2023 / Published: 2 March 2023
(This article belongs to the Section Infection Biology)

Abstract

Simple Summary

The interaction of small mammals in the ecosystem is not limited to humans and other wildlife; it also includes organisms that inhibit their bodies, so-called “parasites”. Arthropod ectoparasites are a diverse and well-adapted group of invertebrates that live on the body surfaces of their hosts, typically vertebrates but rarely other invertebrates. Ectoparasites such as fleas and some mite species are of veterinary and medical importance because they are associated with the transmission of zoonotic diseases. The study determined factors influencing ectoparasite infestation on two rodent species on Mount Meru, one of Tanzania’s most popular research and ecotourism sites. Host sex, species, and environmental temperature predicted ectoparasite infestation patterns in the two rodent species. We expected host density to predict parasite prevalences and abundances, because hosts in higher densities should have more parasites due to increased contact between individuals. However, temperature, not host density, affected ectoparasite distribution. Since temperatures decrease with elevation, parasite prevalences and abundances were lower at higher elevations, highlighting that cold conditions at higher elevations limit reproduction and development—this shows that higher elevation zones are ideal for conservation.

Abstract

Climate change causes organisms, including species that act as parasite reservoirs and vectors, to shift their distribution to higher altitudes, affecting wildlife infestation patterns. We studied how ectoparasite distributions varied with altitude using two rodent species, Montemys delectorum and Rhabdomys dilectus, at different elevations (1500–3500 m). The ectoparasites infesting the two rodent species were influenced by the host sex, species, and temperature. We expected host density to predict parasite infestation patterns, because hosts in higher densities should have more parasites due to increased contact between individuals. However, temperature, not host density, affected ectoparasite distribution. Since temperatures decrease with elevation, parasite prevalences and abundances were lower at higher elevations, highlighting that the cold conditions at higher elevations limit reproduction and development—this shows that higher elevation zones are ideal for conservation. The rodents and ectoparasite species described in this study have been reported as vectors of diseases of medical and veterinary importance, necessitating precautions. Moreover, Mount Meru is a refuge for a number of endemic and threatened species on the IUCN Red List. Thus, the parasitic infection can also be an additional risk to these critical species as well as biodiversity in general. Therefore, our study lays the groundwork for future wildlife disease surveillance and biodiversity conservation management actions. The study found a previously uncharacterized mite species in the Mesostigmata group that was previously known to be a parasite of honeybees. Further investigations may shed light into the role of this mite species on Mount Meru.

1. Introduction

The interaction of small mammals in the ecosystem is not limited to humans and other wildlife; it also includes organisms that inhibit their bodies, so-called “parasites”. This implies that the host serves as a habitat for the parasite, providing it with food, space to live, and mating opportunities, regardless of whether they reside inside or outside the body of the host [1,2]. Arthropod ectoparasites are a diverse and well-adapted group of invertebrates, ranging from obligatory to facultative, and permanent to intermittent; they live on the body surfaces of their hosts, particularly vertebrates [2]. Some arthropod ectoparasites are also known to parasitize invertebrates. For instance, the Varroa spp. (Mesostigmata mite) is a known parasite of honeybees [3,4,5,6,7]. Ectoparasites can harm hosts by feeding on their tissues and causing dermatitis, and some of them are vectors of pathogenic and life-threatening diseases. As an example, plague is a flea-borne zoonosis of mammalian hosts that causes significant human mortality throughout the world, including Africa [8,9,10,11]. Parasite infections impair host fitness, because the development of antiparasitic defenses needs resources which are depleted from those needed for life-history processes [12]. Parasites slow host growth, survival, and fecundity, which have the potential to reduce host density [13]. High ectoparasite loads, for example, resulted in lower reproduction and overwinter survival in yellow-bellied marmots (Marmota flaviventer) in the Italian Alps [12], hare populations (Lepus spp.) in the Scottish mountains [14], and red grouse (Lagopus lagopus scoticus) in England, which may affect host fitness and make population dynamics unstable. However, the risk of parasitic infection transmission varies with the movement and dispersal behavior of the host species across a landscape, which may alter their parasite community and increase transmission to other species [15].
The distribution of parasites among host individuals is uneven, due to host- and parasite-related characteristics and environmental factors that affect host exposure and susceptibility to parasites [16]. Host-related factors include, but are not limited to, age, body size, sex, and breeding status [17]. Parasite load may vary between age groups. Adults provide greater dietary resources for parasites than juveniles [18,19], and have a prolonged period of exposure to parasites. Additionally, parasitism may be sex-biased, with males being more heavily parasitized than females, which could be due to their larger body sizes [20], as well as their greater mobility and social contact patterns [21] in males. Parasite infection is also often higher in breeding individuals than in non-breeding individuals because reproduction is linked with increased body contact, food acquisition to meet increased nutritional and energetic demands, a change in physiology, and thus increased vulnerability to parasites [22]. However, other factors, including reduced mobility of females during pregnancy and lactation to take care of juveniles, may reduce the risk of encountering ectoparasites [23].
Parasites are not only dependent on their host, but also on favorable environmental conditions for transmission and infestation. Environmental factors that have an important regulating role in the distribution and developmental success of parasites in mammals include precipitation [24], temperature [25,26], and elevation [27,28]. Parasite distributions are anticipated to shift northward and to higher altitudes, as a result of climate change [29]. In fact, rising temperatures associated with climate change are increasing parasite abundance over time [30,31,32,33]. These distribution changes may lead to new host–parasite encounters, forcing host populations to deal with parasites with which they have not co-evolved, which could eventually result in local host population extinctions [34].
Steep mountain ranges provide a natural experimental background for studying how species distribution varies across climatic gradients [35]. Altitudinal gradients reflect substantial changes in precipitation, temperature, humidity, soil, and vegetation, with extreme environmental conditions strongly influencing the physiology and survival rate of organisms [36]. These variations have been demonstrated to affect faunal distribution across different altitudes in different geographic regions worldwide [36,37,38,39,40,41]. For example, small mammals’ distribution along elevation has been extensively studied throughout the world, and often shows a hump-shaped distribution pattern in which species richness and abundance peak at the mid-level elevations where the conditions are not too extreme (i.e., hot or cold) [37,38,39]. Studies indicate that the spatial and numerical distribution of the host population determines the distribution patterns of their parasites [42]. Thus, hosts in high densities contain a greater parasite load than hosts in low densities, because of the increased contact between individuals, making contagious parasite transmission easier [42,43]. Accordingly, we hypothesized that ectoparasite distributions follow the distribution patterns of their hosts; ectoparasites should peak at the mid-elevation. Yet, the assumption regarding parasite distribution along elevational gradients is still being debated. On the other hand, the number of feather mites in birds [44] and fleas in rodents [45] has been shown to decline as elevation increases.
This study determined the distribution of arthropod ectoparasites on the East African soft-furred mouse (Montemys delectorum) and the mesic four-striped grass rat (Rhabdomys dilectus) at different elevations on Mount Meru, the centerpiece of Arusha National Park, a popular ecotourism destination in Tanzania. Rhabdomys has traditionally been seen as a single species, Rhabdomys pumilio. However, karyotype and mtDNA evidence suggests that it includes a second species, Rhabdomys dilectus, which is found all over Africa [46]. M. delectorum is the only member of the genus Montemys within the family Muridae. It was formerly classified in the genus Praomys (i.e., Praomys delectorum), and was recently taxonomically revised [47]. M. delectorum is an endemic mammal to the East African Highlands. It is a threatened species throughout its range due to habitat loss, and its IUCN conservation status is uncertain [48]. We examined which traits of the host (sex, species, density) and environmental factors (elevation, temperature) determined the prevalence and abundance of arthropod ectoparasite vectors, which is important to understand the patterns of parasitic infectious disease. We also tested the hypothesis that ectoparasite distribution follows the distribution patterns of their host. The distribution pattern of rodents and shrews on Mount Meru is greater at intermediate elevation levels [39,41]; hence, if host density predicts the occurrence of the ectoparasites, we particularly expected rodent individuals at the middle elevations to suffer a high risk of being infested. Furthermore, the two rodent species have been identified as hosts of ectoparasites, including as potential vectors and reservoirs of pathogens [49]. Given the 65% increase in zoonotic outbreaks in Africa over the past decade [50], recognizing the patterns of parasite distribution among wildlife hosts is of major importance. Our study contributes to a better understanding of the ecology of host-ectoparasite relationships along elevational gradients, which is important not only for identifying potential ectoparasite vectors, but also for designing and implementing vector-borne disease management programs for wildlife conservation and human health.

2. Materials and Methods

2.1. Study Area and Trapping Sites

Mount Meru is located in northeastern Tanzania at 3°14′48′′ and 36°44′54′′, about 35 km northeast of the town of Arusha (Figure 1). The topography rises from the Momela Lakes, lying at 1400 m above sea level, to the summit at 4566 m. The rainy season extends from November to May with relatively lower rain in January and February. June through October is characterized as the dry and cold season. Annual atmospheric temperatures range between 15 °C and 34 °C [51]. Details of the vegetation types of the sites from which the rodents were trapped are outlined in Gebrezgiher et al. [39] and Bussmann [52], and all trapping locations were within Arusha National Park (Figure 1). The study was conducted between February 2021 and June 2022. The sampling sites were across five elevations from 1500 to 3500 m as follows:
(1)
Elevation 1500 m (3°13′20.766′′ S, 36°52′50.076′′ E)—This trapping site was located at the base of Mount Meru, and vegetation cover ranges from grassland, thicket, and bushland to woodland. Caesalpinia decapetala, Croton macrostachyus, Jacaranda mimosifolia, Ocimum gratissimum, Solanum incanum, Aerva lanata, Lantana trifoliata, and tussock grasses are among the notable plant species. Patches of Acacia trees are also prevalent.
(2)
Elevation 2000 m (3°14′33.102″ S, 36°49′15.528″ E)—This site was situated in a lower montane forest, with a dense canopy of trees of various species, including Diospyros abyssinica, Olea hochstetteri, Rhamnus prinoides, and Ficus thonningii.
(3)
Elevation 2500 m (3° 14′ 32.892′′ S, 36° 47′ 25.644′′ E)—This site was in the upper montane forest dominated by Juniperus procera and Podocarpus gracilior. Herbaceous plants, various lianas, and shrubs formed a thick understory, and the trees were often covered with epiphytes.
(4)
Elevation 2950 m (3°13′28.724′′ S, 36°47′7.782″ E) —This site was characterized as a transitional zone between habitats of higher montane forest and ericaceous heath.
(5)
Elevation 3500 m (3°13′6.192′′ S, 36°46′24.042′′ E)—This highest trapping site was located in the ericaceous heathland habitats dominated by Erica spp.

2.2. Rodent Trapping

Sherman is a foldable metal trap designed to capture live animals. Four trap lines were established at a distance of 30 to 50 m, each with 50 traps separated by 10 m. Sites received six days of trapping with a total of 200 traps. All traps were equipped with bait (peanut butter mixed with maize flour and avocado) and placed in the shade to avoid being too hot. Traps were inspected and re-baited (i.e., if the bait was found eaten by insects) every morning between 07:00 and 08:00 h. Each Sherman trap that captured an animal was replaced with a new one (i.e., previously washed). Each individual trapped rodent was first placed in a cotton bag and humanely anesthetized using diethyl ether (LOBA CHEMIEPVT. LTD.) on cotton wool, then placed in a bucket with a lid. Standard external body measurements (body, tail, hindfoot, and left ear), sex, and weight of the trapped hosts were recorded. Species identification followed Happold and Kingdon [53], and sex identification followed Hoffmann et al. [54]. The rodent species identification was confirmed using molecular (Cytochrome b) techniques.

2.3. Ectoparasite Collection and Identification

The ectoparasites were combed out of the rodents, using a small shoe-like brush, into a clean, wide, and long aluminum pan. A different brush was used for each host individual to make sure ectoparasites were not spread from one to another through sharing a brush. The softer body parts of the rodents, such as the belly, ear, and tail regions, were further examined. The ectoparasites were collected with fine brushes, and each host was separately counted and preserved in a labeled Eppendorf tube (Inqaba Biotec East Africa Ltd., Nairobi, Kenya) containing 70% ethanol. Each ectoparasite was identified morphologically using a compound microscope, with the aid of available dichotomous taxonomic keys [55,56,57]. Existing procedures were employed for the microscopic examination of specimens [58,59]. The specimens were temporarily mounted in glycerol, covered with a cover slip, and viewed under a compound microscope. Moreover, to allow internal structures to be clearly visible, and for external features to be more distinct, the specimens were cleared in a 10% KOH solution, boiled for 10 min for fleas, and maintained for 24 h for mite specimens. The alkaline solution was neutralized with 10% acetic acid for 30 min. After dehydrating the specimens using a series of ethanol washes (70%, 80%, and 100%), each for 1 h, they were transferred to clove oil overnight to rehydrate prior to mounting. Dibutyl phthalate-polystyrene-xylene (DPX) was used to mount the flea specimen on a microscope slide [59]. The flea and mite species identification was further confirmed using molecular techniques.

2.4. Molecular Identification of Fleas and Mites

DNA was extracted from the whole body of individual fleas (16 samples) and mites (4 samples) using the Quick-DNA™ Miniprep Plus Kit (Zymo Research), according to the manufacturer’s instructions. The purity and concentration of the DNA was determined using a Nano spectrophotometer at 260 and 280 nm wavelengths.
To identify the fleas, the cytochrome oxidase subunit II (cox2) gene was amplified using the following primer sequences: forward primer (F-Leu: TCTAATATGGGCAGATTAGTGC) and reverse primer (R-Lys: GAGACCAGTACTTGCTTTCAGTCATC) [60]. PCR amplification was performed using AccuPower® PCR PreMix from Bioneer (Bioneer Corporation, Daejeon, Republic of Korea). The PCR reaction mixture for the fleas consisted of 2 μL of template DNA, 0.5 μL of forward primer, 0.5 μL of reverse primer, and 17 μL of nuclease free water in a micro-tube containing AccuPower® PCR PreMix concentrate, making a total reaction volume of 20 μL. Cycling conditions consisted of an initial denaturation at 95 °C for 5 min followed by 40 cycles of 94 °C for 40 s, 56 °C for 45 s, and 72 °C for 45 s. A final extension at 72 °C for 5 min was performed to complete the extension.
For the mites, the cytochrome oxidase subunit I (cox1) gene was amplified using primer sequences as follows: forward primer (cox1-F: GTTTTGGGATATCTCTCATAC) and reverse primer (cox1-R: GAGCAACAACATAATAAGTAT) [61]. A total of 20 μL of PCR reaction mixture consisted of 2 μL of extracted DNA, 1 μL of forward primer, 1 μL of reverse primer, and 16μL of nuclease-free water in a micro-tube containing AccuPower® PCR PreMix concentrate. Cycling conditions consisted of initial denaturation at 95 °C for 5 min followed by 40 cycles of 95 °C for 40 s, 47 °C for 40 s, and 72 °C for 30 s. A final extension at 72 °C for 5 min was performed to complete the extension.
Once the PCR reaction was carried out, a 1.5% agarose gel was prepared by dissolving 1.5 g of agarose into 100 mL of sodium borate buffer and heated until the agarose had dissolved completely, and was stained with 4 μL of EZ-Vision® In-Gel Solution. A volume of 4 μL of each sample was loaded into each well of the gel, and 4 μL of DNA ladder was loaded into the first well in order to indicate the size of any fragments. The voltage was set to 100 V, and electrophoresis was allowed to run for 40 min. The image of the DNA fragments was captured using Bio-Rad’s Gel Doc™ EZ Imaging System. Nine amplicons, five for fleas (2–3 per species) and four for mites, were sequenced at Macrogen Europe (Amsterdam, The Netherlands). The raw sequence data were cleaned, edited, and assembled using Geneious Prime version 2022.1.1 software [62] to obtain consensus sequences. The obtained nucleotide sequences were aligned with other ectoparasite reference sequences available in the GenBank database. A maximum likelihood phylogenetic tree was constructed with the robustness of 1000 bootstraps, using the T92/+G+1 substitution model with an AICc value of 5008.13 implemented in MEGA 11 [63]. Four nucleotide sequences for mites (accession number: OP776142, OP798020, OP798021, and OP798022) and five for fleas (accession number: OP857545, OP857546, OP857547, OP857548, and OP857549) were submitted to the GenBank.

2.5. Data Analysis

Quantitative descriptors of the ectoparasite species on each host species were calculated in accordance with [64]. P—Prevalence (proportion of infested host individuals) was estimated using the formula (P = Re/Rt * 100%), where Re = number of individual rodent species infested with one or more ectoparasite species and Rt = total number of examined hosts. D—Ecological index of dominance was estimated using the formula (D = Es/Et * 100), where Es = number of ectoparasites of a given species collected from the rodents and Et = total number of ectoparasite species collected from the rodents; it refers the degree to which a species is more numerous than other species in an ecological community. MA—Mean Abundance of the ectoparasites was estimated using the formula (MA = Ea/Ht), where Ea = number of ectoparasites of a given species collected from the rodent species, and Ht = total number of hosts examined for that particular parasite species. Statistics are presented as mean ± SE with bias corrections.
We employed multiple regression models to determine the effects of the independent variables (temperature, elevation, host sex, host species, and host density) on the response variables, ectoparasite infestation (prevalence and abundance). Because of the small sample size, which resulted in zero ectoparasite or low rodent host counts at some of the sites, analysis was made of the combined ectoparasites (fleas and mites) and host species. As a result, no species-specific ectoparasite or rodent models were fitted. To avoid bias due to the smaller sample size, we excluded the data of the 1500 m site (N = 6 hosts) from the regression model. Host density was described as the number of captures per trap and per night, as described in Stanko et al. [65]. The distribution of ectoparasite abundance is usually patchy, with many hosts having low parasitic loads and only a few having high parasite loads, resulting in an excess zero in the data [66]. Thus, to account for dispersion and bias due to excess zero, we employed zero-inflated negative binomial (ZINB) regression models with a log link function to assess the effects on mean ectoparasite abundance. Since 41.2% of the host population had no ectoparasites present, we, therefore, used generalized linear models with a binomial distribution (infested or not infested) linked to a logit function. A host infested at least by one ectoparasite was represented by “1,” and the host not infested was represented by “0.” The probability of being infested was referred to as the prevalence. Since elevation negatively correlates with temperature, we employed them in different models to avoid confounding effects. The best-fitting model among candidate models was selected on the basis of Akaike’s information criterion corrected for small sample sizes (AICc) [67]. The model with a lower ∆AICc value was selected as a best-fit model. The summary of parameter estimates for the fitting model is presented as estimates, SE, and 95% confidence intervals; the confidence interval which includes zero is not significant. The “lme4” and “pscl” packages in R ver. 4.2.2 [68] were used for binomial and ZINB models, respectively.

3. Results

3.1. Morphological and Molecular Identification Results of Fleas and Mites

Samples of mounted vouchers of flea and mite species are provided in Figure 2a,b. BLAST search results revealed three ectoparasite species: Ctenophthalmus calceatus cabirus (n = 3), Dinopsyllus ellobius (n = 2), and Varroa rindereri (n = 4). The comparison of C. calceatus cabirus in our study with sequences obtained from Lemniscomys striatus from Rwanda (MH142447.1) revealed 95.19–97.89% identity of similarity in the BLAST. The phylogenetic tree for fleas (Figure 3A) was rooted using Tunga trimamillata as the outgroup species. C. calceatus cabirus (OP857547, OP857548 and OP857549) of this study shared different lineages with the reference (MH142447.1) obtained from GenBank. The percent BLAST similarity between D. ellobius (OP857545 and OP857546) sequences in our study and the closest match in the GenBank (EU335993.1) was 95.75%. The two D. ellobius sequences were clustered together, but were distantly grouped with D. ellobius from the references (EU335993.1). The flea, Xenopsylla cheopis, was not sequenced because there were not enough samples for molecular analysis; it was identified only morphologically. On the other hand, the mite species identification result in this study was ambiguous; it was identified morphologically as a Laelaps species (Mesostigmata). However, the cox1 gene sequence results of all four mite samples (OP776142, OP798020, OP798021, and OP798022) provided the highest-scoring BLAST hit to a sequence from the species V. rindereri (Order Mesostigmata) in the GenBank (AF107261.2), with an 83.24% identity of similarity. Morphologically, Laelaps possess a flask-shaped ventral genital shield that is distinct from the sternal plate, whereas in Varroa the genital shield is large, with deep lateral and angular projections that are fused with the sternal plate. Metapodal shields are greatly enlarged and broadly triangular in Varroa but small and inconspicuous in Laelaps (Figure 2b). The phylogenetic tree for mites (Figure 3B) was rooted using Laelaps as the out-group. The V. rindereri sequences in this study share different lineages with V. rindereri from the reference sequences (AF107261.2).

3.2. Quantitative Descriptors of Ectoparasite Infestation

A total of 398 rodents (335 of Montemys delectorum and 63 of Rhabdomys dilectus) were examined for flea and mite infestation (Table 1). Overall, a total of 266 mites and 59 flea individuals were recovered from the two host rodents. About 58.8% of the hosts (234/398) were infested by at least one ectoparasite. Probabilities of ectoparasite infestation of 63% and 37% were observed in M. delectorum and R. dilectus, respectively. In M. delectorum, 95% males and 41% females were infested, whereas in R. dilectus, 48.3% males and 30% females were parasitized by at least one ectoparasite (Figure 4a). The mites were recorded most frequently, accounting for 81.85% of the total ectoparasite ecological index of dominance, and contributing to 50.68% of the infestation in the total host population. Of the fleas, D. ellobius was the most abundant flea species, accounting for 7.11% of the total ectoparasite dominance index (Table 2). On M. delectorum, there were 8.8 ± 5.01 fleas and 41.6 ± 21.66 mites, whereas on R. dilectus, there were 3 ± 1.5 fleas and 11.6 ± 7.17 mites (Figure 4b,c). R. dilectus was parasitized by all the flea and mite species, whereas M. delectorum was infested by D. ellobius and mites only. In both rodent species, the mite and D. ellobius contributed the most to the overall parasite infestation (Figure 5). The prevalence of ectoparasites declined with increasing elevation for both host species, with the lowest record at 3500 m (Figure 6). However, the low prevalence at 1500 m (Table 1) was due to the smaller sample size of rodent hosts examined for M. delectorum (n = 2) and R. dilectus (n = 4). The flea X. cheopis was recorded only at 1500 m on R. dilectus, whereas the other ectoparasite species were found at multiple elevations (Table 1).

3.3. Assessment of Parameters Influencing Ectoparasite Occurrence

The results of the study show that host species, sex, and temperature best predict ectoparasite prevalence and mean abundance (Table 3, Table S1 and Table S2). M. delectorum had a higher prevalence (1.22 ± 0.30) than R. dilectus, and male individuals had a greater prevalence (2.56 ± 0.28) than female individuals. Similarly, the parasites’ mean abundance was greater in M. delectorum (0.42 ± 0.14) and in males (0.93 ± 0.12).

4. Discussion

This study investigated the distribution of arthropod ectoparasites on Rhabdomys dilectus (mesic four-striped grass rat) and Montemys delectorum (East African soft-furred mouse), which are the two most abundant species, with a wide range of distribution on Mount Meru [39,41]. Mount Meru has experienced habitat disturbances due to a fire outbreak in the ericaceous habitats; deforestation; road construction along the National Park; and ecotourism activities including clearing of land for vehicle parking and camping. Moreover, the degradation of habitats by human activities, including farming and grazing, has intensified in the last decades, particularly at the base of the mountain [51]. The habitat degradation and temperature increases due to climate change have been reported to cause an upward shift in the distribution of rodent and shrew species, including endemic and threatened species on the IUCN Red List [39]. However, parasites can also be a danger to threatened species because many threatened mammal populations are fragmented and small, and have low levels of genetic diversity [70,71]. These conditions can enhance host susceptibility and exposure to parasitic infections [72]; moreover, parasitic infections could be another factor that contributes to an increased probability of stochastic extinction [73,74]. Therefore, the parasite burden observed in this study, especially for the endemic M. delectorum (with 63% parasite prevalence), needs attention and improved conservation management.
Rodents on Mount Meru were infested more with mites than fleas, consistent with previous studies elsewhere [75,76]. In contrast, despite the fact that fleas are the most dominant group of ectoparasites for small mammals [77], we collected far fewer fleas than mites. The most likely explanation is that fleas spend more time in the nests of their host than on their bodies, lowering the likelihood of their collection [77]. Moreover, the fact that mites are more host generalists than fleas [78] may have also contributed to their greater abundance.
The mites in this study were identified as Laelaps species, using morphological cues; they did, however, provide the highest-scoring BLAST hit to a sequence from the species Varroa rindereri using the cox1 gene. Surprisingly, the mite species was discovered in honeybees in 1998 (accession no: AF107261.2) [3]. Varroa was previously known as the “Laelappid-like mite”, and belonged to the family Laelapidea before being separated into the Varroadea family [79]. Thus, the low percent identity value (83.24%) between the DNA sequences suggests that our mites belong to a previously uncharacterized species in the Mesostigmata group. To the best of our knowledge, this is the first study on the molecular identification of rodent mites in Tanzania. Thus, the quite limited sequenced data for Mesostigmata mites and fleas from Tanzania available in GenBank made it difficult to compare our DNA sequence. We only sequenced small samples to confirm the species; thus, further study using different “target genes” is needed to resolve the ambiguity of the mite species identification, and to detail the molecular characteristics of the ectoparasites. Finally, it might also be worth questioning: "Can the same mite species parasitize rodents and honeybees?"
While there remains much to be learned, our study provided an overview of the key factors that determine the distribution of ectoparasites on the two rodent species; host species, sex, and temperature are predictive variables. Host species influenced parasite prevalence and ectoparasite abundance. This is due to the fact that different species have different resistances (i.e., the capacity of the host to reduce parasite establishment) and tolerance (i.e., the competence of the host to resist a given parasite load and sustain fitness while under infestation) [80]. Moreover, the infestation of the animal may be determined by different factors, such as the color and type of the host’s fur. The greater prevalence and abundance of ectoparasites on M. delectorum than on R. dilectus may partly be associated with its soft fur, which potentially allows ectoparasites to penetrate easily. However, the greater ectoparasite species diversity (four species) in R. dilectus could be due to the striped, white-grey color of the rodent, which could be easily detectable by the ectoparasites, as some species are known to use the host’s color to find their host. Though it may depend on the host–parasite taxon, this can support previous findings that found plumage color affected the infestation of lice on Columba livia [81]. Moreover, our study showed that sex was among the predictors of ectoparasite load, with the burden of parasites biased towards male individuals. Similar findings were reported in previous studies on different taxa: rodents [82,83], geckos (Quedenfeldtia trachyblepharus) [84], and grey squirrel species [85]. Different factors may contribute to these sex-based variations. Larger male hosts in mammal species [86] provide a wider range of niches for parasites, and can thus support a greater number of parasites [87,88]. In addition, male hosts often have higher energetic requirements, necessitating longer distances travelled in the quest of food, increasing their chances of encountering ectoparasites [89]. Furthermore, due to the physiological differences between males and females, the immunosuppressive properties of testosterone tend to diminish the body’s immunity, causing a substantial decline in male immune fitness [90].
We expected that parasite infestation would be affected by the density of the host; this is due to the idea that hosts in high densities should contain more parasite species than hosts in low densities because of the increased contact between individuals [42]. However, we did not see the influence of host density in this study, and it was not a predictor variable in the parasite distribution, which was in line with the findings of Singleton [91], which reported no association between host density and parasite infestation rate in Mus musculus. Thus, other abiotic factors such as temperature, humidity, host burrow structures, and soil type may determine the distribution of the parasite [92].
It is commonly reported that elevation determines organisms’ distribution. However, by itself, elevation above sea level means nothing to a species [93]. The correlated environmental variables that change rapidly over short distances generate and maintain the patterns of abundance and distribution [37,38,93]. Generally, the most obvious change predictor with increasing elevation is linear decrease in temperature [94]. Our study showed that temperature significantly influenced the occurrence of ectoparasites, supporting the idea that temperature is considered to be the most important factor changing elevational distribution of species [24,93]. The lower ectoparasite prevalence and mean abundance at 3500 m, in the site where a daily minimum temperature was 2.7–4.6 °C, implies that the cold conditions of the highlands impose thermoregulatory constraints on ectoparasites, and have a direct effect on their physiology and survival rate. This justifies the fact that as temperature is inversely linked to elevation; warmer temperatures at lower elevations provide more favorable conditions for parasite development than at higher elevations. Another reason for the lower infestation at higher elevations would be due to the cold weather; there is less movement of the hosts, hence reduced contact with other individuals and a lower probability of being infested. Though our study is not species-specific, the findings do corroborate prior studies of parasitic mites on lizards [95], feather mites on birds [44], and fleas on rodents [45].
Disease ecologists and conservation biologists argue that parasites are increasing in abundance through time [31]. Parasite outbreaks are predicted to be a result of habitat change, biodiversity loss, and rising temperatures related to climate change [31,32,33]. Previous studies provided evidence that Mount Meru has shown an increase in mean annual temperature, particularly in the last decade where a 0.37 °C rise in mean annual temperature was recorded [39]. This may provide a platform for parasites to increase in abundance through time. However, for the vast majority of wildlife parasite species, the hypothesis that parasites are increasing in abundance over time remains entirely untested [31]. Our study may provide historical data as a baseline against which to compare contemporary parasite burdens over time.
Some of the ectoparasites and rodents reported in this study have been identified as having medical and veterinary importance [49]. The fleas, X. cheopis, C. calceatus, and Dinopsyllus spp., for instance, are confirmed efficient vectors of bubonic plague in Tanzania, and have been recovered from rodents involved in plague outbreaks [49]. Bubonic plague is a rodent-borne infectious disease caused by the bacterium Yersinia pestis. It affects both humans and animals, and is primarily transmitted by flea bites that jump from rodents to humans [9]. In addition, C. calceatus has also been reported as a transmitter of bartonellosis in Rwanda [96]. Bartonellosis is another rodent-borne disease caused by Gram-negative bacteria in the genus Bartonella. It affects both humans and wild and domestic animals, and is spread to humans by fleas or contact with flea-infested animals [97]. Moreover, some mites, such as Laelaps spp., are vectors for zoonoses such as Q fever and rickettsialpox [98], and Chigger mites for scrub typhus [99]. Moreover, the mite, Varroa destructor, is a vector of the deformed wing virus (DWV), a bee-pathogenic RNA virus that causes honeybee (Apis mellifera) colony losses worldwide [6]. Therefore, more research on zoonotic pathogens is needed to ascertain the risk of zoonosis. Mount Meru is the centerpiece of the Arusha National Park, and is a popular ecotourism destination. It is home to diverse endemic and threatened species. Mount Meru attracts a large number of tourists and researchers, due to its rich biodiversity and numerous trails for nature enthusiasts to explore. On the other hand, animals in the park interact with these parties, who in turn are likely to interact with the local community. Moreover, wildlife, including rodents, cross the park boundaries and enter human dwellings, coming into direct or indirect contact with people and livestock along the edge of the park. All of these interactions increase the likelihood of anthroponotic and zoonotic pathogen transmission, altering the threat of disease to both animals and humans [49]. As human–wildlife interactions increase, the importance of surveillance for zoonotic diseases cannot be overstated. Given the 65% increase in zoonotic outbreaks in Africa over the last decade [50], recognizing the patterns of parasite distribution among wildlife hosts is of major importance. Our study contributes to a better understanding of the ecology of host–ectoparasite relationships along elevational gradients; this is important in this region, not only for identifying potential ectoparasite vectors, but also for designing and implementing vector-borne disease management programs for wildlife conservation and human health. Moreover, no information is available regarding the role of arthropod ectoparasites in the transmission of zoonotic infectious agents. This study may lay the groundwork for screening rodent hosts and their ectoparasites for potential zoonotic pathogens on Mount Meru.

5. Conclusions

The elevational distribution of ectoparasites infesting Montemys delectorum and Rhabdomys dilectus was influenced by the host traits (species and sex), in combination with environmental factors such as temperature. The host sex and species influenced the prevalence and abundances of ectoparasites, such that it was higher for males than females and for M. delectorum than R. dilectus. Our findings did not support our hypothesis that host density predicts the prevalence and abundances of ectoparasites in the two rodent species, but rather that temperature was the best predictor. Since temperatures decrease with elevation, parasite prevalence and mean abundance were lower at higher elevations, highlighting the idea that cold conditions at higher elevations limit reproduction and development—this shows higher elevation zones are ideal for conservation. This may have an impact in light of climate change, since organisms shift their distribution towards higher altitudes. This could also affect species that act as parasite reservoirs and vectors, altering wildlife and livestock infestation patterns. Furthermore, the rodents and ectoparasite species described in this study have been reported to be vectors of diseases of medical and veterinary importance, necessitating precautions. Moreover, Mount Meru is a refuge for a number of endemic and threatened species on the IUCN Red List. Thus, parasitic infection can also be an additional risk to these critical species and biodiversity in general. Therefore, our study lays the groundwork for future wildlife disease surveillance and biodiversity conservation management plans. In addition, the flea and mite species identification using cytochrome oxidase genes in this study at least partly helps to fill the scarcity of sequence data for ectoparasites of African rodents in GenBank. We found a previously uncharacterized mite species in the Mesostigmata group that was previously known to be a parasite of honeybees. Further investigations may shed light into the role of this mite species on Mount Meru.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology12030394/s1, Table S1: AICc models for ectoparasite prevalence; Table S2: AICc models for abundance of ectoparasites.

Author Contributions

Conceptualization, G.B.G., R.H.M. and Y.M.; data curation, G.B.G.; formal analysis, G.B.G. and C.M.L.; funding acquisition, R.H.M.; methodology, G.B.G., R.H.M., Y.M., A.A.S.K. and C.M.L., supervision, R.H.M., Y.M. and A.A.S.K.; writing—original draft, G.B.G.; writing—review and editing, G.B.G., R.H.M., Y.M., A.A.S.K., C.M.L. and S.R.B. All authors have read and agreed to the published version of the manuscript.

Funding

Tanzania Center of Excellence Project ACE II (grant number 5799-TZ), funded the field works of this study.

Institutional Review Board Statement

The study ethical clearance was issued by the Tanzania Wildlife Research Institute and COSTECH (2021–008–NA–2020–238). The study was approved by Sokoine University of Agriculture (SUA/ADM/R.1/8/651 and SUA/PFC/D/2019/0021/05) for the use of animals in this study. The Tanzania National Park Authority (AB.161/376/01) granted permission to work in the study area.

Informed Consent Statement

Not applicable.

Data Availability Statement

All of the data for the study are provided in the paper and Supplementary Materials.

Acknowledgments

This research was supported by the African Centre of Excellence for Innovative Rodent Pest Management and Biosensor Technology Development, Sokoine University of Agriculture, Tanzania. We acknowledge the Tanzania Commission for Science and Technology, the Tanzania Wildlife Research Institute, and the Tanzania National Park Authority for permission to conduct this research. We thank the Arusha National Park staff for logistical support. The field assistance of Omary Kibwana, Khalid Kibwana, Salim Fadhili, and Sadick Kahangwa is highly appreciated. We also thank Ginethon Mhamphi of the Institute of Pest Management for his assistance with morphological taxonomic identification of fleas and mites. We also acknowledge Mwiyni Masala of the College of Veterinary Medicine, for his technical assistance with DNA extraction and PCR of the fleas and mites. Josef Bryja and Getachew Mulualem of the Institute of Vertebrate Biology, Czech Republic, are also thanked for their cooperation in rodent species confirmation with molecular techniques. We would also like to thank Sonja Matthee of the Department of Conservation Ecology and Entomology at Stellenbosch University, South Africa, for guidance on the ectoparasites collection and identification and reviewing the manuscript. We acknowledge Grant Singleton of the CSIRO in Australia, for his insightful corrections to the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Krasnov, B.R.; Shenbrot, G.I.; Khokhlova, I.S.; Poulin, R. Geographical Variation in the “Bottom-Up” Control of Diversity: Fleas and Their Small Mammalian Hosts. Glob. Ecol. Biogeogr. 2007, 16, 179–186. [Google Scholar] [CrossRef]
  2. Wall, R.L.; Shearer, D. Veterinary Ectoparasites: Biology, Pathology & Control, 2nd ed.; Blackwell Science: London, UK, 2001; 275p. [Google Scholar]
  3. Anderson, D.L.; Trueman, J.W. Varroa jacobsoni(Acari: Varroidae) is more than one species. Exp. Appl. Acarol. 2000, 24, 165–189. [Google Scholar] [CrossRef] [PubMed]
  4. Giliba, R.A.; Mpinga, I.H.; Ndimuligo, S.A.; Mpanda, M.M. Changing climate patterns risk the spread of Varroa destructor infestation of African honeybees in Tanzania. Ecol. Process. 2020, 9, 1–11. [Google Scholar] [CrossRef]
  5. Flores, J.M.; Gámiz, V.; Jiménez-Marín, Á.; Flores-Cortés, A.; Gil-Lebrero, S.; Garrido, J.J.; Hernando, M.D. Impact of Varroa Destructor and Associated Pathologies on the Colony Collapse Disorder Affecting Honeybees. Res. Vet. Sci. 2021, 135, 85–95. [Google Scholar] [CrossRef] [PubMed]
  6. Gisder, S.; Genersch, E. Direct Evidence for Infection of Varroa Destructor Mites with the Bee-Pathogenic Deformed Wing Virus Variant B—but Not Variant a—Via Fluorescence-in Situ-Hybridization Analysis. J. Virol. 2020, 95, e01786-20. [Google Scholar] [CrossRef] [PubMed]
  7. Reyes-Quintana, M.; Espinosa-Montaño, L.G.; Prieto-Merlos, D.; Koleoglu, G.; Petukhova, T.; Correa-Benítez, A.; Guzman-Novoa, E. Impact of Varroa Destructor and Deformed Wing Virus on Emergence, Cellular Immunity, Wing Integrity and Survivorship of Africanized Honeybees in Mexico. J. Invertebr. Pathol. 2019, 164, 43–48. [Google Scholar] [CrossRef]
  8. Eads, D.A.; Biggins, D.E.; Gage, K.L. Ecology and Management of Plague in Diverse Communities of Rodents and Fleas. Vector Borne Zoonotic Dis. 2020, 20, 888–896. [Google Scholar] [CrossRef]
  9. Eisen, R.J.; Borchert, J.N.; Mpanga, J.T.; Atiku, L.A.; MacMillan, K.; Boegler, K.A.; Montenieri, J.A.; Monaghan, A.; Gage, K.L. Flea Diversity as an Element for Persistence of Plague Bacteria in an East African Plague Focus. PLoS ONE 2012, 7, e35598. [Google Scholar] [CrossRef]
  10. Moore, S.M.; Monaghan, A.; Borchert, J.N.; Atiku, L.A.; Boegler, K.A.; Montenieri, J.; MacMillan, K.; Gage, K.L.; Eisen, R.J. Seasonal Fluctuations of Small Mammal and Flea Communities in a Ugandan Plague Focus: Evidence to Implicate Arvicanthis Niloticus and Crocidura Spp. As Key Hosts in Yersinia Pestis Transmission. Parasites Vectors 2015, 8, 11. [Google Scholar] [CrossRef]
  11. Haikukutu, L.; Lyaku, J.R.; Lyimo, C.; Kasanga, C.J.; Kandusi, S.E.; Rahelinirina, S.; Rasoamalala, F.; Rajerison, M.; Makundi, R. Plague in Tanzania: First Report of Sylvatic Plague in Morogoro Region, Persistence in Mbulu Focus, and Ongoing Quiescence in Lushoto and Iringa Foci. IJID Reg. 2022, 4, 105–110. [Google Scholar] [CrossRef]
  12. Zanet, S.; Miglio, G.; Ferrari, C.; Bassano, B.; Ferroglio, E.; von Hardenberg, A. Higher Risk of Gastrointestinal Parasite Infection at Lower Elevation Suggests Possible Constraints in the Distributional Niche of Alpine Marmots. PLoS ONE 2017, 12, e0182477. [Google Scholar] [CrossRef] [PubMed]
  13. Ebert, D.; Lipsitch, M.; Mangin, K.L. The Effect of Parasites on Host Population Density and Extinction: Experimental Epidemiology with Daphnia and Six Microparasites. Am. Nat. 2000, 156, 459–477. [Google Scholar] [CrossRef]
  14. Newey, S.; Dahl, F.; Willebrand, T.; Thirgood, S. Unstable Dynamics and Population Limitation in Mountain Hares. Biol. Rev. 2007, 82, 527–549. [Google Scholar] [CrossRef] [PubMed]
  15. Freed, L.A.; Medeiros, M.C.; Bodner, G.R. Explosive increase in ectoparasites in Hawaiian forest birds. J. Parasitol. 2008, 94, 1009–1021. [Google Scholar] [CrossRef]
  16. Poulin, R. Are there general laws in parasite ecology? Parasitology 2007, 134, 763–776. [Google Scholar] [CrossRef] [PubMed]
  17. Viljoen, H.; Bennett, N.C.; Ueckermann, E.A.; Lutermann, H. The Role of Host Traits, Season and Group Size on Parasite Burdens in a Cooperative Mammal. PLoS ONE 2011, 6, e27003. [Google Scholar] [CrossRef] [PubMed]
  18. Fichet-Calvet, E.; Wang, J.; Jomâa, I.; Ben Ismail, R.; Ashford, R.W. Patterns of the Tapeworm Raillietina Trapezoides Infection in the Fat Sand Rat Psammomys Obesus in Tunisia: Season, Climatic Conditions, Host Age and Crowding Effects. Parasitology 2003, 126, 481–492. [Google Scholar] [CrossRef]
  19. Soliman, S.; Marzouk, A.S.; Main, A.J.; Montasser, A.A. Effect of Sex, Size, and Age of Commensal Rat Hosts on the Infestation Parameters of Their Ectoparasites in a Rural Area of Egypt. J. Parasitol. Res. 2001, 87, 1308. [Google Scholar] [CrossRef]
  20. Postawa, T.; Szubert-Kruszyńska, A. Is Parasite Load Dependent on Host Aggregation Size?The Case of the Greater Mouse-Eared Bat Myotis Myotis(Mammalia: Chiroptera) and Its Parasitic Mite Spinturnix Myoti(Acari: Gamasida). Parasitol. Res. 2014, 113, 1803–1811. [Google Scholar] [CrossRef]
  21. Krasnov, A.; Skugor, S.; Todorcevic, M.; Glover, K.A.; Nilsen, F. Gene Expression in Atlantic Salmon Skin in Response to Infection with the Parasitic Copepod Lepeophtheirus Salmonis, Cortisol Implant, and Their Combination. BMC Genom. 2012, 13, 130. [Google Scholar] [CrossRef]
  22. Zhang, L.; Parsons, S.; Daszak, P.; Wei, L.; Zhu, G.; Zhang, S. Variation in the Abundance of Ectoparasitic Mites of Flat-Headed Bats. J. Mammal. 2010, 91, 136–143. [Google Scholar] [CrossRef]
  23. Gomez, D.; Sommaro, L.; Steinmann, A.; Chiappero, M.; Priotto, J. Movement Distances of Two Species of Sympatric Rodents in Linear Habitats of Central Argentine Agro-Ecosystems. Mamm. Biol. 2011, 76, 58–63. [Google Scholar] [CrossRef]
  24. Froeschke, G.; Harf, R.; Sommer, S.; Matthee, S. Effects of Precipitation on Parasite Burden along a Natural Climatic Gradient in Southern Africa—Implications for Possible Shifts in Infestation Patterns due to Global Changes. Oikos 2010, 119, 1029–1039. [Google Scholar] [CrossRef]
  25. Schares, G.; Ziller, M.; Herrmann, D.C.; Globokar, M.V.; Pantchev, N.; Conraths, F.J. Seasonality in the Proportions of Domestic Cats Shedding Toxoplasma Gondii or Hammondia Hammondi Oocysts Is Associated with Climatic Factors. Int. J. Parasitol. 2016, 46, 263–273. [Google Scholar] [CrossRef] [PubMed]
  26. Fuentes-Vicente, J.A.; Gutiérrez-Cabrera, A.E.; Flores-Villegas, A.L.; Lowenberger, C.; Benelli, G.; Salazar-Schettino, P.M.; Córdoba-Aguilar, A. What Makes an Effective Chagas Disease Vector? Factors Underlying Trypanosoma Cruzi-Triatomine Interactions. Acta Trop. 2018, 183, 23–31. [Google Scholar] [CrossRef] [PubMed]
  27. Akbar, H.; Pinçon, C.; Aliouat-Denis, C.-M.; Derouiche, S.; Taylor, M.-L.; Pottier, M.; Carreto-Binaghi, L.-H.; González-González, A.E.; Courpon, A.; Barriel, V.; et al. Characterizing Pneumocystis in the Lungs of Bats: Understanding Pneumocystis Evolution and the Spread of Pneumocystis Organisms in Mammal Populations. Appl. Environ. Microbiol. 2012, 78, 8122–8136. [Google Scholar] [CrossRef] [PubMed]
  28. Kramm, M.M., III; Gutierrez, M.R.; Luepke, T.D.; Soria, C.; Lopez, R.R.; Cooper, S.M.; Davis, D.S.; Parker, I.D. Trypanosoma Cruziin free-ranging mammalian populations in south Texas, USA. J. Wildl. Dis. 2017, 53, 788–794. [Google Scholar] [CrossRef]
  29. Merino, S.; Møller, A.P. Host-parasite interactions and climate change. In Effects of Climate Change on Birds; Møller, A.P., Fiedler, W., Berthold, P., Eds.; Oxford University Press: Oxford, UK, 2010; pp. 213–226. [Google Scholar]
  30. Moller, A.P.; Merino, S.; Soler, J.J.; Antonov, A.; Badás, E.P.; Calero-Torralbo, M.A.; de Lope, F.; Eeva, T.; Figuerola, J.; FlenstedJensen, E.; et al. Assessing the effects of climate on host-parasite interactions: A comparative study of European birds and their parasites. PLoS ONE 2013, 8, e82886. [Google Scholar] [CrossRef]
  31. Wood, C.L.; Vanhove, M.P.M. Is the World Wormier than It Used to Be? We’ll Never Know without Natural History Collections. J. Anim. Ecol. 2022, 92, 250–262. [Google Scholar] [CrossRef]
  32. Kirk, D.; O’Connor, M.I.; Mordecai, E.A. Scaling Effects of Temperature on Parasitism from Individuals to Populations. J. Anim. Ecol. 2022, 91, 2087–2102. [Google Scholar] [CrossRef]
  33. Rizzoli, A.; Tagliapietra, V.; Cagnacci, F.; Marini, G.; Arnoldi, D.; Rosso, F.; Rosà, R. Parasites and Wildlife in a Changing World: The Vector-Host- Pathogen Interaction as a Learning Case. Int. J. Parasitol. 2019, 9, 394–401. [Google Scholar] [CrossRef] [PubMed]
  34. Pounds, J.A.; Bustamante, M.R.; Coloma, L.A.; Consuegra, J.A.; Fogden, M.P.L.; Foster, P.N.; La Marca, E.; Masters, K.L.; Merino-Viteri, A.; Puschendorf, R.; et al. Widespread amphibian extinctions from epidemic disease driven by global warming. Nature 2006, 439, 161–167. [Google Scholar] [CrossRef] [PubMed]
  35. Vetaas, O.R. Mountain Biodiversity and Elevational Gradients. Front. Biogeogr. 2021, 13, e54146. [Google Scholar] [CrossRef]
  36. Heaney, L.R. Small Mammal Diversity along Elevational Gradients in the Philippines: An Assessment of Patterns and Hypotheses. Glob. Ecol. Biogeogr. 2001, 10, 15–39. [Google Scholar] [CrossRef]
  37. Brown, J.H. Mammals on Mountainsides: Elevational Patterns of Diversity. Glob. Ecol. Biogeogr. 2001, 10, 101–109. [Google Scholar] [CrossRef]
  38. McCain, C.M. The Mid-Domain Effect Applied to Elevational Gradients: Species Richness of Small Mammals in Costa Rica. J. Biogeogr. 2003, 31, 19–31. [Google Scholar] [CrossRef]
  39. Gebrezgiher, G.B.; Makundi, R.H.; Meheretu, Y.; Mulungu, L.S.; Katakweba, A.A.S. A Decade-Long Change in the Elevational Distribution of Non-Volant Small Mammals on Mount Meru, Tanzania. Diversity 2022, 14, 454. [Google Scholar] [CrossRef]
  40. Thomas, S.M.; Soka, G.E.; Mulungu, L.S. Influence of Vegetation Structure, Seasonality, and Soil Properties on Rodent Diversity and Community Assemblages in West Mount Kilimanjaro, Tanzania. Ecol. Evol. 2022, 12, e9211. [Google Scholar] [CrossRef]
  41. Stanley, W.T.; Kihaule, P.M. Elevational Distribution and Ecology of Small Mammals on Tanzania’s Second Highest Mountain. PLoS ONE 2016, 11, e0162009. [Google Scholar] [CrossRef]
  42. Krasnov, B.R.; Khokhlova, I.; Shenbrot, G. The effect of host density on ectoparasite distribution: An example of a rodent parasitized by fleas. Ecology 2002, 83, 164–175. [Google Scholar] [CrossRef]
  43. Morand, S.; Poulin, R. Density, Body Mass and Parasite Species Richness of Terrestrial Mammals. Evol. Ecol. 1998, 12, 717–727. [Google Scholar] [CrossRef]
  44. Meléndez, L.; Laiolo, P.; Mironov, S.; García, M.; Magaña, O.; Jovani, R. Climate-driven variation in the intensity of a host-symbiont animal interaction along a broad elevation gradient. PLoS ONE 2014, 9, e101942. [Google Scholar] [CrossRef]
  45. Baláž, I.; Ševčík, M.; Tulis, F.; Zigová, M.; Dudich, A. Diversity, Distribution and Changes in Communities of Fleas on Small Mammals along the Elevational Gradient from the Pannonian Plain to the Carpathian Mountains. Parasitology 2020, 148, 63–73. [Google Scholar] [CrossRef] [PubMed]
  46. Castiglia, R.; Solano, E.; Makundi, R.H.; Hulselmans, J.; Verheyen, E.; Colangelo, P. Rapid Chromosomal Evolution in the Mesic Four-Striped Grass RatRhabdomys Dilectus(Rodentia, Muridae) Revealed by MtDNA Phylogeographic Analysis. J. Zool. Syst. Evol. Res. 2011, 50, 165–172. [Google Scholar] [CrossRef]
  47. Nicolas, V.; Mikula, O.; Lavrenchenko, L.A.; Šumbera, R.; Bartáková, V.; Bryjová, A.; Meheretu, Y.; Verheyen, E.; Missoup, A.D.; Lemmon, A.R.; et al. Phylogenomics of African Radiation of Praomyini(Muridae: Murinae) Rodents: First Fully Resolved Phylogeny, Evolutionary History and Delimitation of Extant Genera. Mol. Phylogenet. Evol. 2021, 163, 107263. [Google Scholar] [CrossRef]
  48. Cassola, F. “Praomys delectorum”. IUCN Red List of Threatened Species. 2016. [Google Scholar] [CrossRef]
  49. Makundi, R.H.; Massawe, A.W.; Borremans, B.; Laudisoit, A.; Katakweba, A. We Are Connected: Flea–Host Association Networks in the Plague Outbreak Focus in the Rift Valley, Northern Tanzania. Wildl. Res. 2015, 42, 196. [Google Scholar] [CrossRef]
  50. Animal-To-Human Diseases on the Rise in Africa, Warns UN Health Agency. Available online: https://news.un.org/en/story/2022/07/1122522 (accessed on 11 June 2022).
  51. Maleko, D.D.; Mbassa, G.N.; Maanga, W.F.; Sisya, E.S. Impacts of wildlife-livestock interactions in and around Arusha National Park, Tanzania. Curr. Res. J. Biol. Sci. 2012, 4, 471–476. [Google Scholar]
  52. Bussmann, R.W. Vegetation zonation and nomenclature of African Mountains—An overview. Lyonia 2006, 11, 41–66. [Google Scholar]
  53. Happold, D.C.D.; Kingdon, J. Mammals of Africa. Volume III: Rodents, Hares and Rabbits; David, C.D., Ed.; Happold: Bath, UK; Bloomsbury: London, UK, 2013. [Google Scholar]
  54. Hoffmann, A.; Decher, J.; Rovero, F.; Schaer, J.; Voigt, C.; Wibbelt, G. Field methods and techniques for monitoring mammals. J. Dedic. Capacit. Build. Taxon. Collect. Manag. 2010, 8, 482–529. [Google Scholar]
  55. Walker, A. The Arthropods of Humans and Domestic Animals: A Guide to Preliminary Identification; Chapman & Hall: London UK; New York, NY, USA, 1994; p. 231. [Google Scholar]
  56. Anne, M.Z.; Gary, A.C.; Susan, E.L.; Mason, V.R. Veterinary Clinical Parasitology, 9th ed.; Wiley Blackwell: Hoboken, NJ, USA, 2021. [Google Scholar]
  57. Mathison, B.A.; Pritt, B.S. Laboratory Identification of Arthropod Ectoparasites. Clin. Microbiol. 2014, 27, 48–67. [Google Scholar] [CrossRef] [PubMed]
  58. Yakub, A.; Amrito, B.; Abdullah, S.M. Morphological Identification and Prevalence of the Dog Flea Ctenocephalides Canis (Curtis, 1826) and the Cat Flea(Ctenocephalides Felis (Bouché, 1835) in Dhaka City, Bangladesh. Parasitology 2020, 54, 163–172. [Google Scholar] [CrossRef]
  59. Campbell, J.D.; Bennett, S.; Krueger, L.; Morgan, T.; Nguyen, K.; Penicks, A.; Sun, S.; Cummings, R.; Martinez, D.; Quinn, N. Flea ‘in around: A look at the identification, preservation, clearing, and mounting of Siphonaptera. Proc. Vertebr. Pest Conf. 2018, 28, 163–172. [Google Scholar]
  60. Zhu, Q.; Hastriter, M.W.; Whiting, M.F.; Dittmar, K. Fleas(Siphonaptera) Are Cretaceous, and Evolved with Theria. Mol. Phylogenet. Evol. 2015, 90, 129–139. [Google Scholar] [CrossRef]
  61. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  62. Geneious Software, version 2022.1.1.; Biomatters Inc.: Auckland, New Zealand.
  63. Kumar, S.; Stecher, G.; Tamura, K. MEGA11: Molecular Evolutionary Genetics Analysis Version 11.0 for Bigger Datasets. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  64. Reiczigel, J.; Marozzi, M.; Fábián, I.; Rózsa, L. Biostatistics for parasitologists–a primer to quantitative parasitology. Trends Parasitol. 2019, 35, 277–281. [Google Scholar] [CrossRef]
  65. Stanko, M.; Miklisová, D.; Goüy de Bellocq, J.; Morand, S. Mammal Density and Patterns of Ectoparasite Species Richness and Abundance. Oecologia 2002, 131, 289–295. [Google Scholar] [CrossRef]
  66. Zuur, A.F.; Ieno, E.N.; Elphick, C.S. A Protocol for Data Exploration to Avoid Common Statistical Problems. Methods Ecol. Evol. 2009, 1, 3–14. [Google Scholar] [CrossRef]
  67. Anderson, D.R.; Burnham, K.P. Avoiding Pitfalls When Using Information-Theoretic Methods. J. Wildl. Manag. 2002, 66, 912–918. [Google Scholar] [CrossRef]
  68. R Core Team. A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. Methods in Ecology and Evolution. 2008. Available online: http://softlibre.unizar.es/manuales/aplicaciones/r/fullrefman.pdf (accessed on 23 June 2022).
  69. Varroa (Jacobsoni) Mite (326). Available online: https://apps.lucidcentral.org/ppp/text/web_full/entities/varroa_jacobsoni_mite_326.htm (accessed on 10 November 2022).
  70. Woodroffe, R. Managing Disease Threats to Wild Mammals. Anim. Conserv. 1999, 2, 185–193. [Google Scholar] [CrossRef]
  71. Altizer, S.; Harvell, D.; Friedle, E. Rapid Evolutionary Dynamics and Disease Threats to Biodiversity. Trends Ecol. Evol. 2003, 18, 589–596. [Google Scholar] [CrossRef]
  72. Lyles, A.M.; Dobson, A.P. Infectious disease and intensive management: Population dynamics, threatened hosts and their parasites. Zoo Wildl. Med. 1993, 24, 315–326. [Google Scholar]
  73. McCallum, H.; Dobson, A. Detecting Disease and Parasite Threats to Endangered Species and Ecosystems. Trends Ecol. Evol. 1995, 10, 190–194. [Google Scholar] [CrossRef] [PubMed]
  74. Pedersen, A.B.; Jones, K.E.; Nunn, C.L.; Altizer, S. Infectious Diseases and Extinction Risk in Wild Mammals. Conserv. Biol. 2007, 21, 1269–1279. [Google Scholar] [CrossRef]
  75. Lareschi, M.; Krasnov, B.R. Determinants of Ectoparasite Assemblage Structure on Rodent Hosts from South American Marshlands: The Effect of Host Species, Locality and Season. Med. Vet. Entomol. 2010, 24, 284–292. [Google Scholar] [CrossRef] [PubMed]
  76. Yonas, M.; Welegerima, K.; Laudisoit, A.; Bauer, H.; Gebrehiwot, K.; Deckers, S.; Katakweba, A.; Makundi, R.; Leirs, H. Preliminary Investigation on Rodent-Ectoparasite Associations in the Highlands of Tigray, Northern Ethiopia: Implications for Potential Zoonoses. Integr. Zool. 2011, 6, 366–374. [Google Scholar] [CrossRef]
  77. Krasnov, B.R.; Shenbrot, G.I.; Khokhlova, I.S.; Vinarski, M.; Korallo-Vinarskaya, N.; Poulin, R. Geographical Patterns of Abundance: Testing Expectations of the “Abundance Optimum” Model in Two Taxa of Ectoparasitic Arthropods. J. Biogeogr. 2008, 35, 2187–2194. [Google Scholar] [CrossRef]
  78. Cruz, L.D.; Fernandes, F.R.; Linhares, A.X. Similarities among Ectoparasite Fauna of Sigmodontine Rodents: Phylogenetic and Geographical Influences. Parasitology 2012, 139, 1749–1756. [Google Scholar] [CrossRef]
  79. Delfinado, M.D.; Baker, E.W. Varroidae, a new family of mites on honeybees (Mesostigmata: Acarina). J. Wash. Acad. Sci. 1974, 1, 4–10. [Google Scholar]
  80. Medzhitov, R.; Schneider, D.S.; Soares, M.P. Disease Tolerance as a Defense Strategy. Science 2012, 335, 936–941. [Google Scholar] [CrossRef]
  81. da Amaral, C.H.L.; Bergmann, F.B.; dos Santos, P.R.S.; Silveira, T.; Krüger, R.F. How Do Seasonality and Host Traits Influence the Distribution Patterns of Parasites on Juveniles and Adults of Columba Livia? Acta Trop. 2017, 176, 305–310. [Google Scholar] [CrossRef]
  82. Shilereyo, M.; Magige, F.; Ranke, P.S.; Ogutu, J.O.; Røskaft, E. Ectoparasite Load of Small Mammals in the Serengeti Ecosystem: Effects of Land Use, Season, Host Species, Age, Sex and Breeding Status. Parasitol. Res. 2022, 121, 823–838. [Google Scholar] [CrossRef]
  83. Matthee, S.; McGEOCH, M.A.; Krasnov, B.R. Parasite-specifc variation and the extent of male-biased parasitism; an example with a South African rodent and ectoparasitic arthropods. Parasitology 2010, 137, 651–660. [Google Scholar] [CrossRef]
  84. Comas, M. Body Condition, Sex and Elevation in Relation to Mite Parasitism in a High Mountain Gecko. J. Zool. 2020, 310, 298–305. [Google Scholar] [CrossRef]
  85. Scantlebury, M.; Maher McWilliams, M.; Marks, N.J.; Dick, J.T.A.; Edgar, H.; Lutermann, H. Effects of Life-History Traits on Parasite Load in Grey Squirrels. J. Zool. 2010, 282, 246–255. [Google Scholar] [CrossRef]
  86. Slob, A.K.; van der Werff Ten Bosch, J.J. Sex Differences in Body Growth in the Rat. Physiol. Behav. 1975, 14, 353–361. [Google Scholar] [CrossRef]
  87. Kowalski, K.; Bogdziewicz, M.; Eichert, U.; Rychlik, L. Sex Differences in Flea Infections among Rodent Hosts: Is There a Male Bias? Parasitol. Res. 2014, 114, 337–341. [Google Scholar] [CrossRef]
  88. Young, H.S.; Dirzo, R.; McCauley, D.J.; Agwanda, B.; Cattaneo, L.; Dittmar, K.; Eckerlin, R.P.; Fleischer, R.C.; Helgen, L.E.; Hintz, A.; et al. Drivers of Intensity and Prevalence of Flea Parasitism on Small Mammals in East African Savanna Ecosystems. J. Parasitol. 2015, 101, 327. [Google Scholar] [CrossRef]
  89. Postawa, T.; Nagy, Z. Variation of Parasitism Patterns in Bats during Hibernation: The Effect of Host Species, Resources, Health Status, and Hibernation Period. Parasitol. Res. 2016, 115, 3767–3778. [Google Scholar] [CrossRef]
  90. Krasnov, B.R.; Vinarski, M.V.; Korallo-Vinarskaya, N.P.; Shenbrot, G.I.; Khokhlova, I.S. Species Associations in Arthropod Ectoparasite Infracommunities Are Spatially and Temporally Variable and Affected by Environmental Factors. Ecol. Entomol. 2021, 46, 1254–1265. [Google Scholar] [CrossRef]
  91. Singleton, G. Population Dynamics of Mus Musculus and Its Parasites in Mallee Wheatlands in Victoria during and after a Drought. Wildl. Res. 1985, 12, 437. [Google Scholar] [CrossRef]
  92. Krasnov, B.R.; Shenbrot, G.I.; Medvedev, S.G.; Vatschenok, V.S.; Khokhlova, I.S. Host–Habitat Relations as an Important Determinant of Spatial Distribution of Flea Assemblages(Siphonaptera) on Rodents in the Negev Desert. Parasitology 1997, 114, 159–173. [Google Scholar] [CrossRef] [PubMed]
  93. Lomolino, M.V. Elevation Gradients of Species-Density: Historical and Prospective Views. Glob. Ecol. Biogeogr. 2001, 10, 3–13. [Google Scholar] [CrossRef]
  94. Zamora-Vilchis, I.; Williams, S.E.; Johnson, C.N. Environmental Temperature Affects Prevalence of Blood Parasites of Birds on an Elevation Gradient: Implications for Disease in a Warming Climate. PLoS ONE 2012, 7, e39208. [Google Scholar] [CrossRef]
  95. Alvarez-Ruiz, L.; Megía-Palma, R.; Reguera, S.; Ruiz, S.; Zamora-Camacho, F.J.; Figuerola, J.; Moreno-Rueda, G. Opposed Elevational Variation in Prevalence and Intensity of Endoparasites and Their Vectors in a Lizard. Curr. Zool. 2018, 64, 197–204. [Google Scholar] [CrossRef]
  96. Nziza, J.; Tumushime, J.C.; Cranfield, M.; Ntwari, A.E.; Modrý, D.; Mudakikwa, A.; Gilardi, K.; Šlapeta, J. Fleas from Domestic Dogs and Rodents in Rwanda Carry Rickettsia Asembonensis and Bartonella Tribocorum. Med. Vet. Entomol. 2018, 33, 177–184. [Google Scholar] [CrossRef]
  97. Mullins, K.; Canal, E.; Ouch, P.; Prasetyo, D.; Tagoe, J.; Attram, N.; Yeboah, C.; Kumordjie, S.; Fox, A.; Letizia, A.G.; et al. Bartonella Species in Cambodia, Ghana, Laos, and Peru: Results from Vector and Serosurveys. Vector Borne Zoonotic Dis. 2023, 23, 9–17. [Google Scholar] [CrossRef]
  98. Diaz, J.H. Mite-Transmitted Dermatoses and Infectious Diseases in Returning Travelers. J. Travel Med. 2010, 17, 21–31. [Google Scholar] [CrossRef]
  99. Chen, Y.-L.; Guo, X.-G.; Ding, F.; Lv, Y.; Yin, P.-W.; Song, W.-Y.; Zhao, C.-F.; Zhang, Z.-W.; Fan, R.; Peng, P.-Y.; et al. Infestation of Oriental House Rat (Rattus Tanezumi) with Chigger Mites Varies along Environmental Gradients across Five Provincial Regions of Southwest China. Int. J. Environ. Res. Public Health 2023, 20, 2203. [Google Scholar] [CrossRef]
Figure 1. Geographic locations of trapping sites on Mount Meru.
Figure 1. Geographic locations of trapping sites on Mount Meru.
Biology 12 00394 g001
Figure 2. (a) Mounted vouchers of flea species: F1—Dinopsyllus ellobius (female, a—spermatheica); F2—Ctenophthalmus calceatus cabirus (front part; e—genal ctenidia with three spines, f—Pronotal ctenidia); F3—Xenopsylla cheopis (male; h—clasper); F4—Dinopsyllus ellobius (male, b—clasper); F5—Dinopsyllus ellobius (front part; c—Pronotal ctenidia, d—genal ctenidia); F6— Xenopsylla cheopis (male; h—clasper). (b) Ventral view of Laelaps mite (L) and Varroa mite (V) [69]. Varroa (V): Sternal plate (sp) fused with genital shield (gs); genital shield is large with lateral deep and angular projections; metapodal shields (mps) greatly enlarged and broadly triangular. Laelaps (L): Genital shield is flask-shaped and distinctive from the sternal plate. Both mites possess one post anal setae in the anal plate (ap).
Figure 2. (a) Mounted vouchers of flea species: F1—Dinopsyllus ellobius (female, a—spermatheica); F2—Ctenophthalmus calceatus cabirus (front part; e—genal ctenidia with three spines, f—Pronotal ctenidia); F3—Xenopsylla cheopis (male; h—clasper); F4—Dinopsyllus ellobius (male, b—clasper); F5—Dinopsyllus ellobius (front part; c—Pronotal ctenidia, d—genal ctenidia); F6— Xenopsylla cheopis (male; h—clasper). (b) Ventral view of Laelaps mite (L) and Varroa mite (V) [69]. Varroa (V): Sternal plate (sp) fused with genital shield (gs); genital shield is large with lateral deep and angular projections; metapodal shields (mps) greatly enlarged and broadly triangular. Laelaps (L): Genital shield is flask-shaped and distinctive from the sternal plate. Both mites possess one post anal setae in the anal plate (ap).
Biology 12 00394 g002
Figure 3. Phylogenetic tree for fleas (A) and mites (B) using cox2 and cox1 genes, respectively. The evolutionary history was inferred using the maximum likelihood method with bootstrap tests (1000 replicates). The percentage of trees in which the associated taxa clustered together is shown next to the branches. The phylogenetic tree was constructed using the sequences from this study, as well as other reference sequences from GenBank. Tunga and Laelaps were used as outgroup species for fleas and mites, respectively.
Figure 3. Phylogenetic tree for fleas (A) and mites (B) using cox2 and cox1 genes, respectively. The evolutionary history was inferred using the maximum likelihood method with bootstrap tests (1000 replicates). The percentage of trees in which the associated taxa clustered together is shown next to the branches. The phylogenetic tree was constructed using the sequences from this study, as well as other reference sequences from GenBank. Tunga and Laelaps were used as outgroup species for fleas and mites, respectively.
Biology 12 00394 g003aBiology 12 00394 g003b
Figure 4. Ectoparasite infestation on M. delectorum and R. dilectus: (a) prevalence (%) between host sexes; (b) flea mean abundance with SE bar; (c) mite mean abundance with SE bar.
Figure 4. Ectoparasite infestation on M. delectorum and R. dilectus: (a) prevalence (%) between host sexes; (b) flea mean abundance with SE bar; (c) mite mean abundance with SE bar.
Biology 12 00394 g004aBiology 12 00394 g004b
Figure 5. Relative contributions of flea and mite species infesting M. delectorum and R. dilectus on Mount Meru, Tanzania.
Figure 5. Relative contributions of flea and mite species infesting M. delectorum and R. dilectus on Mount Meru, Tanzania.
Biology 12 00394 g005
Figure 6. Ectoparasite prevalence of M. delectorum and R. dilectus in relation to elevation on Mount Meru.
Figure 6. Ectoparasite prevalence of M. delectorum and R. dilectus in relation to elevation on Mount Meru.
Biology 12 00394 g006
Table 1. Flea and mite species infecting M. delectorum and R. dilectus at different elevation zones on Mount Meru. N and n are the numbers of hosts examined and infested, respectively. Count and mean abundance of the fleas and mites are provided in brackets.
Table 1. Flea and mite species infecting M. delectorum and R. dilectus at different elevation zones on Mount Meru. N and n are the numbers of hosts examined and infested, respectively. Count and mean abundance of the fleas and mites are provided in brackets.
Host
(Infested
/Examined)
Ectoparasite Taxa1500 m
N = 6
n = 3
2000 m
N = 83
n = 57
2500 m
N = 201
n = 130
2950 m
N = 70
n = 29
3500 m
N = 38
n = 15
Total
N = 398
n = 234
Montemys delectorum (211/335)Xenopsylla cheopis000000
Dinopsyllus ellobius022(0.28)20(0.21)2(0.05)044
Ctenophthalmus calceatus cabirus000000
Mite052(0.67)121(0.62)24(0.56)11(0.60)208
Total074(0.95)141(0.72)26(0.64)11(0.60)252
Rhabdomys dilectus (23/63)Xenopsylla cheopis2(0.05)00002
Dinopsyllus ellobius002(0.40)5(0.19)07
Ctenophthalmus calceatus cabirus001(0.20)4(0.15)1(0.05)6
Mite3(0.75)0037(1.37)18 (0.82)58
Total5(1.25)03(0.6)46(1.70)19(0.86)73
Overall ectoparasites (MA ± SE)0.16 ± 0.100.29 ± 0.170.19 ± 0.120.16 ± 0.080.12 ± 0.09
MA = mean abundance.
Table 2. Flea and mite infestation probability (%P) and ecological dominance index (%D) on M. delectorum and R. dilectus rodents.
Table 2. Flea and mite infestation probability (%P) and ecological dominance index (%D) on M. delectorum and R. dilectus rodents.
Ectoparasite Taxa%P%D
Xenopsylla cheopis0.250.62
Dinopsyllus ellobius7.1115.69
Ctenophthalmus calceatus cabirus0.761.85
Over all fleas8.1218.15
Mites50.6881.85
Table 3. Summary of best model describing the ectoparasite abundance (zero-inflated negative binomial) and prevalence (binomial and logitlink function) of the rodents M. delectorum and R. dilectus on Mount Meru, Tanzania. For categorical variables, the reference level is reported in parentheses.
Table 3. Summary of best model describing the ectoparasite abundance (zero-inflated negative binomial) and prevalence (binomial and logitlink function) of the rodents M. delectorum and R. dilectus on Mount Meru, Tanzania. For categorical variables, the reference level is reported in parentheses.
VariablesEstimateSE95% LCL95% UCL
Prevalence
Host species (Md)1.220.300.325.21
Host sex (Male)2.560.280.394.69
Temperature (°C)0.500.120.283.44
Abundance
Host species (Md)0.420.140.048.06
Host sex (Male)0.930.120.139.17
Temperature (°C)2.100.991.164.48
Md = M. delectorum; SE = standard error; LCL = lower confidence interval, UCL = upper confidence interval.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gebrezgiher, G.B.; Makundi, R.H.; Katakweba, A.A.S.; Belmain, S.R.; Lyimo, C.M.; Meheretu, Y. Arthropod Ectoparasites of Two Rodent Species Occurring in Varied Elevations on Tanzania’s Second Highest Mountain. Biology 2023, 12, 394. https://doi.org/10.3390/biology12030394

AMA Style

Gebrezgiher GB, Makundi RH, Katakweba AAS, Belmain SR, Lyimo CM, Meheretu Y. Arthropod Ectoparasites of Two Rodent Species Occurring in Varied Elevations on Tanzania’s Second Highest Mountain. Biology. 2023; 12(3):394. https://doi.org/10.3390/biology12030394

Chicago/Turabian Style

Gebrezgiher, Genet B., Rhodes H. Makundi, Abdul A. S. Katakweba, Steven R. Belmain, Charles M. Lyimo, and Yonas Meheretu. 2023. "Arthropod Ectoparasites of Two Rodent Species Occurring in Varied Elevations on Tanzania’s Second Highest Mountain" Biology 12, no. 3: 394. https://doi.org/10.3390/biology12030394

APA Style

Gebrezgiher, G. B., Makundi, R. H., Katakweba, A. A. S., Belmain, S. R., Lyimo, C. M., & Meheretu, Y. (2023). Arthropod Ectoparasites of Two Rodent Species Occurring in Varied Elevations on Tanzania’s Second Highest Mountain. Biology, 12(3), 394. https://doi.org/10.3390/biology12030394

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop