Next Article in Journal
Distribution Drivers of the Alien Butterfly Geranium Bronze (Cacyreus marshalli) in an Alpine Protected Area and Indications for an Effective Management
Next Article in Special Issue
Transcriptional Dynamics Induced by Diapause Hormone in the Silkworm, Bombyx mori
Previous Article in Journal
Effects of “Bacuri” Seed Butter (Platonia insignis Mart.), a Brazilian Amazon Fruit, on Oxidative Stress and Diabetes Mellitus-Related Parameters in STZ-Diabetic Rats
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 11
Issue 4
10.3390/biology11040561
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPR/Cas9 Mediated Disruption of Seminal Fluid Protein Sfp62 Induces Male Sterility in Bombyx mori

by
Xia Xu
,
Jine Chen
,
Xin Du
,
Lusong Yao
and
Yongqiang Wang
*
Institute of Sericulture and Tea, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
*
Author to whom correspondence should be addressed.
Biology 2022, 11(4), 561; https://doi.org/10.3390/biology11040561
Submission received: 10 March 2022 / Revised: 4 April 2022 / Accepted: 6 April 2022 / Published: 7 April 2022
(This article belongs to the Special Issue Molecular Mechanisms of Insects Metamorphosis and Sex Determination)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

In gamogenetic animals, seminal fluid proteins are essential for male fertility. In this study, we investigated the function of the seminal fluid protein Sfp62 by using the CRISPR/Cas9 system in lepidopteran model insect Bombyx mori. Sfp62 mutation led to male sterility and can be inherited stably. The mutation did not affect growth and developmental nor female fertility. These data indicate that Sfp62 is an ideal target for sterile insect technology (SIT), in which genetically modified insects are released on a large scale to mate with wild-type insects in order to reduce or even eradicate the target pests. The determining factors for the effective implementation of SIT include the strong competitiveness of the modified individuals and multi-generational effects resulting from the mutation. Sfp62 meets these criteria and is therefore a promising target for biological pest control.

Abstract

Seminal fluid proteins provide factors necessary for development, storage, and activation of sperm. Altered expression of seminal fluid proteins can lead to defect in male infertility. We investigated the function of seminal fluid protein Sfp62 in the model lepidopteran insect Bombyx mori using CRISPR/Cas9 mediated mutagenesis. The knockout of BmSfp62 gene led to male sterility but has no effect on female fertility. The mutation did not affect growth and development of the silkworm of both sexes. Motility of sperm in male mutants was decreased and the mRNA expression levels of other genes encoding seminal fluid proteins were altered in BmSfp62 mutants compared to the wild-type controls. The male sterility caused by mutation of BmSfp62 was stably inherited. As the proteins encoded by Sfp62 genes are conserved among lepidopteran species, Sfp62 is a potential target for the biological management of lepidopteran pests.

Graphical Abstract

1. Introduction

The males of gamogenetic animals produce seminal fluid proteins (SFPs) of various types that are critical for male fertility [1]. SFPs identified using transcriptome and proteome analyses include proteases, protease inhibitors, peptides, prohormones, lipases, trypsins, antioxidants, c-type lectins, and cysteine-rich secreted proteins [2,3,4,5]. SFPs provide a fluid environment for sperm and are necessary for development, storage, and activation of sperm [6,7]. Upon ejaculation, SFPs enter the genital tract of the female where these factors influence ovulation and fertilization [8,9].
In mammals, SFPs are biomarkers for male fertility [10]. About 50% of human infertility results from SFP dysfunction [11]. SFPs provide the main energy source for sperm and regulate sperm capacitation and acrosome reaction [12,13,14]. In Mus musculus, certain SFPs are essential for sperm–egg fusion including the membrane protein FIMP, SOF1; transmembrane protein TMEM95; the acrosome-associated protein SPACA6, DCST1, and DCST2 [15,16,17,18]. In fishes, SFPs sperm motility and fertilization are used as markers to evaluate the fish reproductive ability and to monitor sperm cryopreservation methods [19,20]. The ganglioside GM3 in SFPs is involved in the fertilization process in Oncorhynchus mykiss [21]. A high molecular weight glycosylated SFP is a sperm motility inhibitor in Oreochromis niloticus [22]. The lack of SPACA6 prevents sperm–egg fusion in Danio rerio [23].
In insects, SFPs not only regulate reproduction but also affect the lifespan of mating individuals and the numbers and survival rates of offspring [24,25,26,27,28,29]. In Drosophila melanogaster, Seminase is an essential factor for female oviposition induction, and its downregulation blocks sperm release, which in turn results in a significant reduction in post-copulation oviposition [30,31]. Acp70A (also known as sex peptide) and Acp26Aa (also known as Ovulin) regulate sperm storage and stimulate oviposition in Drosophila and also affect the survival of offspring [32,33,34]. In Culex pipiens, trypsin is essential for maintaining sperm motility and is necessary for maintenance of sperm viability in vitro [35]. In Anopheles, SFPs bind to symbiotic bacteria in males and transfer these bacteria to females, where they affect the female immune response [36]. In Ceratitis capitata, the SFPs enter the female and cause conformational changes in reproductive tract [37]. In Teleogryllus oceanicus, seven SFPs regulate sperm motility and enhance sperm competitiveness [38]. In Bombyx mori and Plutella xylostella, the serine protease Ser2 is an SFP necessary for male reproduction; its absence results in male sterility, but female mutants are fertile [39].
Sterile insect technology (SIT) is a new biological method for pest control [40]. The principle is that genetically modified to be sterile, are released into the field on a large scale to mate with wild-type insects to reduce or even eradicate target pests [41]. As SFPs are mainly secreted from insect gonads during the adult stage, loss of these factors does not usually impact growth and development [42]. Therefore, SFPs are potential targets for SIT [43].
In this study, we investigated the function of Sfp62 gene in B. mori, a model lepidopteran insect, by CRISPR/Cas9-induced mutation of the gene. This technique has been shown to result in stable inheritance of mutations [44]. Lepidoptera is the second largest order of insects and includes more than 70% of the agriculture pests [45]. We found that the deletion of BmSfp62 led to male sterility. Growth and development of the mutant insects was normal, and female fertility was not impacted by loss of BmSfp62. In females mated with male mutants, sperm motility in the bursa copulatrix was decreased. In addition, the mRNA levels of genes encoding other SFPs associated with sperm motility were altered in the BmSfp62 mutants. Changes in SFP composition and content caused abnormalities in the fluid environment of the sperm, which presumably results in male sterility. As Sfp62 is evolutionarily conserved among lepidopterans, the Sfp62 is a potential target gene for lepidopteran pest control.

2. Materials and Methods

2.1. Silkworm Strains and Rearing

A multivoltine and nondiapausing silkworm strain, Nistari, was used for the experiments and raised under standard conditions [46].

2.2. Evolutionary Analysis

The phylogenetic relationships of Sfp62 proteins in representative lepidopteran species was inferred using neighbor-joining method [47]. The evolutionary distances were computed using Poisson correction method [48]. Phylogenetic analyses were conducted in MEGA X [49]. The alignment of Sfp62 protein sequences was created with the ClustalX2 software and GENEDOC program.

2.3. Quantitative Detection of Genes

TRIzol® reagent (Invitrogen, Waltham, MA, USA) were applied to isolate the total RNAs. For each tissue sample, total RNAs was used with the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) for complementary DNA (cDNA) synthesis. Quantitative real-time PCR (qRT-PCR) analyses were performed using a SYBR Green Realtime PCR Master Mix (Thermo Fisher Scientific, USA). The PCR conditions: 95 °C for 5 min, 35 cycles at 95 °C for 15 s, and 60 °C for 1 min. The ribosomal protein 49 (Bmrp49) was used as an internal control. A relative quantitative method (△△Ct) was used to evaluate quantitative variation. The primers are listed in Table 1.

2.4. Plasmid Construction

Following the GGN19GG rule, small guide RNA (sgRNA) target sites were selected in the screened open reading frame of BmSfp62 [50,51,52]. Two target sites of BmSfp62 were identified. The activator was the plasmid pBac[IE1-EGFP-Nos-Cas9], which encodes Cas9 under the control of the Nos promoter and the enhanced green fluorescent protein (EGFP) marker under control of the IE1 promoter [53]. The effector plasmid was pBac[IE1-DsRed2-U6-sgRNAs], which encodes the sgRNAs and the discosoma red fluorescent protein (DsRed) driven by U6 and IE1 promoters, respectively. The primers are listed in Table 1.

2.5. Mutant Construction

The constructed plasmids were microinjected into embryos for germline transformation. The injected eggs were incubated and raised under standard conditions. When the mutant lines reached to adults, they were arranged to mate with wild-type (WT) moths. G1 progeny were screened under a fluorescence microscope (Nikon AZ100, Tokyo, Japan). The mutant germline (ΔBmSfp62 individuals) with DsRed (red) and EGFP (green) fluorescence were obtained by hybridization of the Nos-Cas9 line with the U6-sgRNA line. Mutants with double-fluorescence were used in subsequent experiments.

2.6. Mutagenesis Analysis

The mutant genomic DNA was extracted by genomic DNA extraction kit (Thermo Fisher Scientific, USA). Genomic PCR was performed as follows: 94 °C for 2 min, 35 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 1 min, followed by a final extension period at 72 °C for 10 min. The PCR products were sub-cloned into pJET1.2 vectors (Thermo Fisher Scientific, USA) and sequenced. The primers are listed in Table 1.

2.7. Sperm Motility and Germline Transmission Assay

The bursa copulatrixes were dissected from control and ΔBmSfp62 females at the mated adult stage. Tissues were placed in physiological saline (Sangon, Shanghai, China) on glass slides. Photos were taken with a microscope (Olympus BX51, Tokyo, Japan).
The emerging moth was set in the center of a plastic container (30 × 18 × 4.5 cm3). WT or ΔBmSfp62 moth of the opposite sex was placed 10 cm from the center of the container. Mutants that mated were recorded as responsive. The response index was calculated as responsive moth number divided by total test number multiplied by 100.

2.8. Statistical Analysis

RT-qPCR, response index, number of eggs and progeny data were analyzed in GraphPad Prism 7. The statistically significant differences were measured by Student’s t-test with two-tailed distribution and error bars show ± SEM (*, p < 0.05; **, p < 0.01; ***, p < 0.001; n. s., p > 0.05).

3. Results

3.1. Phylogenetic Identification of Sfp62

Sfp62 protein sequences from 20 different lepidopteran species were analyzed to evaluate phylogenetic conservation. The sequences evaluated were from B. mori, Danaus chrysippus, Danaus plexippus, Melitaea cinxia, Hyposmocoma kahamanoa, Pieris macdunnoughi, Brenthis ino, Ostrinia furnacalis, Zerene cesonia, Pieris rapae, Arctia plantaginis, Papilio xuthus, Vanessa tameamea, Chilo suppressalis, Helicoverpa armigera, Papilio machaon, Spodoptera litura, Spodoptera frugiperda, Manduca sexta, and Trichoplusia ni. Phylogenetic analysis of Sfp62 protein sequences indicated that the protein is highly conserved (Figure 1A). In addition, we aligned the Sfp62 sequences of six pest species and silkworm (Figure 1B). Sfp2 protein sequence from B. mori had 87.11% identity with O. furnacalis, 83.92% with C. suppressalis, 85.01% with H. armigera, 63.99% with S. litura, 85.76% with S. frugiperda, 85.51% with M. sexta, and 84.39% with T. ni (Figure 1B). These data indicate that findings in B. mori regarding the function of Sfp2 are likely applicable to other lepidopterans.

3.2. Expression Pattern of BmSfp62

The testis of silkworm in adult stage were nearly spherical rather than renal in the larval stage. Male gradually matured from the fifth larval instar to the adult stage. Therefore, we tested the mRNA expression of BmSfp62 in each representative stages. The expressions were first analyzed at day 3 of the fifth instar larvae (L5D3) and the wandering stage (W). In individuals from both developmental stages, BmSfp62 mRNA was much more highly expressed in the testis than head, epidermis, fat body, midgut, Malpighian tubules, anterior silk gland, middle silk gland, posterior silk gland, and ovary (Figure 2A). We then quantified the expression in adult tissues. BmSfp62 mRNA was more highly expressed in the seminal vesicle and ejaculatory vesicle than male accessory gland, glandula prostatica, testis, female accessory gland, and bursa copulatrix in both virgin and mated adults (Figure 2B). In the silkworm gonads, the mRNA expression of BmSfp62 increased significantly with development. These results suggest that the Sfp62 is important in male fertility.

3.3. CRISPR/Cas9-Mediated BmSfp62 Mutation Leads to Male Sterility

Two target sites were selected in exons of the BmSfp62 gene; the fragment containing the two sites was 994 bp (Figure 3A). The activator line vector pBac[IE1-EGFP-Nos-Cas9] is designed to express the fluorescent marker EGFP and the effector line pBac[IE1-DsRed-U6-sgRNAs] is designed to express the fluorescent marker DsRed (Figure 3B). Genomic DNA was extracted from the mutants with EGFP and DsRed fluorescent markers to characterize deletions between the two target sites. Different numbers of bases were deleted in different mutant individuals (Figure 3C).
We then mated WT males with both ΔBmSfp62 and WT females and ΔBmSfp62 males with both WT and ΔBmSfp62 females and examined numbers of eggs produced (Figure 4A). All crosses resulted in similar numbers of eggs laid; however, eggs produced by females mated with ΔBmSfp62 males did not hatch. The control WT cross produced 363 ± 10 eggs; WT males mated with ΔBmSfp62 females produced 339 ± 10 eggs; ΔBmSfp62 males mated with WT females produced 329 ± 10 eggs; ΔBmSfp62 males mated with ΔBmSfp62 females produced 308 ± 10 eggs (n = 30/group). Almost all control eggs hatched (~95%, 346/363) as did eggs of WT males mated with ΔBmSfp62 females (~93%, 316/339), but no eggs of ΔBmSfp62 males mated with WT or ΔBmSfp62 females hatched (~0%, 0/329; ~0%, 0/308, respectively) (Figure 4B). Subsequently, we tested the mRNA expression of BmSfp62 in adult tissues. BmSfp62 mRNA expression was significantly downregulated in ΔBmSfp62 individuals compared with WT individuals (Figure 4C).

3.4. ΔBmSfp62 Sperm Motility Is Decreased and SPF Expression Is Altered

We next evaluated sperm motility in the bursa copulatrix of WT females after mating with WT or ΔBmSfp62 males. Normally, eupyrene sperm do not move on their own but are carried by the movement of apyrene sperm. Apyrene sperm motility was significantly decreased in the mutant compared to WT controls (Videos S1 and S2).
The mRNA levels of genes encoding sperm motility-related SFPs BmAtta, BmTry, BmPtp, and BmRca were significantly up-regulated in virgin adult gonads ΔBmSfp62 individuals compared to WT, whereas BmAmy and BmMlc were significantly downregulated in the mutant (Figure 5). Thus, deletion of BmSfp62 leads to the altered expression of other genes encoding SFPs that are essential for fertility.

3.5. Mutation of BmSfp62 Does Not Affect Adult Competitiveness and Is Stably Inherited

We used the percentage of successful mating as a response index to evaluate the adult competitiveness of the mutant females and males. There was no significant difference in competitiveness of WT and ΔBmSfp62 females (51.52% and 48.48%, respectively; n = 30/group) nor was there any significant difference in competitiveness of WT and ΔBmSfp62 males (51.09% and 48.91%, respectively; n = 30/group) (Figure 6A, B). Heritability stability was analyzed by hybridization of the Nos-Cas9 and U6-sgRNAs lines. In successive generations, ΔBmSfp62 male sterility was observed (Figure 6C). Thus, the BmSfp62 mutation did not affect competitiveness, and the resulting male sterility was stably inherited.

4. Discussion

Seminal fluid proteins are essential for male reproduction. There are many SFPs, and their characteristics and functions vary [54]. Here, we conducted a functional analysis of Sfp62 using the silkworm as a model. At the protein level, Sfp62 is highly conserved across lepidopteran species. BmSfp62 is highly expressed in male gonads; it was detected in other tissues but at low levels. We evaluated the physiological function of BmSfp62 gene in male reproduction by CRISPR/Cas9 technology. The technology enables accurate and efficient targeting of candidate genes [55,56]. The BmSfp62 mutation caused male sterility but did not decrease female fertility. Growth and reproductive behaviors of mutants were normal, but the sperm motility of the male BmSfp62 mutant was dramatically decreased compared to wild-type sperm, resulting in fertilization failure. Females mated with BmSfp62 mutant males laid normal numbers of eggs but did not hatch.
Mutation of BmSfp62 led to loss of BmSfp62 and alters expression of other genes that encode seminal fluid proteins including BmAtta, BmAmy, BmMlc, BmTry, BmPtp, and BmRca. In D. melanogaster, Atta, an immune defense gene, is highly expressed in virgin adults and regulates sperm competitiveness [57]. In D. melanogaster, Amy is expressed in the spermatid and mature sperm; the protein it encodes binds cAMP-dependent kinase to regulate spermatogenesis and sperm capacitation in human and mouse [58]. The Mlc gene encodes a motor protein that is required for sperm storage and release in D. melanogaster [59,60]. The hydrolase encoded by Try regulates the hydrolyzation of sex peptides that influence sperm motility and reproduction [61]. Ptp is expressed in lepidopteran testis, and its homolog in D. melanogaster is critical for efficient ATP synthesis necessary for sperm motility [62]. The SFP encoded by Rca regulates sperm quality and male fertility by influencing Ca+ levels in seminal fluid in Rattus norvegicus [63]. The abnormal expression of SPFs resulting from BmSfp62 deficiency may contribute to the observed male sterility. Sperm motility and the levels of SFPs in the female’s bursa copulatrix after mating influence the efficiency of sperm–egg fusion [64,65]. Loss of BmSfp62 gene function led to a decrease in sperm motility, which likely also impaired fertility.
In summary, our study demonstrated that the mutation of Sfp62 led to stably inherited male sterility by CRISPR/Cas9 system in B. mori. The BmSfp62 gene deletion caused male sterility, but females were fertile, and the mutation did not affect other growth and reproduction indicators. BmSfp62 mutant females released into the environment will mate with WT males and pass on effectively. The next generation of mutant males will be sterile but able to mate. Mating with mutants should eventually suppress the pest population. Further, BmSfp62 is evolutionarily conserved among lepidopterans, making it an ideal target for SIT-mediated control of lepidopteran pests.

5. Conclusions

We investigated the function of BmSfp62 in the lepidopteran model insect, B. mori. The BmSfp62 mutant males were sterile, but females were fertile. The mutation was stably inherited and did not affect other growth and reproductive indicators. BmSfp62 deletion decreased sperm motility and altered mRNA expression levels of other genes encoding seminal fluid proteins. Due to it evolutionary conservation in lepidopterans, BmSfp62 is a possible target for biological control of lepidopteran pests.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology11040561/s1, Video S1. Sperm motility in bursa copulatrix of WT female mated with WT male; Video S2. Sperm motility in bursa copulatrix of WT female mated with ΔBmSfp62 male.

Author Contributions

Conceptualization, X.X. and Y.W.; Data curation, J.C. and L.Y.; Formal analysis, J.C.; Funding acquisition, X.X. and Y.W.; Investigation, X.X.; Methodology, X.D.; Project administration, X.X. and Y.W.; Resources, Y.W.; Software, X.D.; Supervision, Y.W.; Validation, J.C.; Visualization, L.Y.; Writing—original draft, X.X.; Writing—review and editing, Y.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32100377), the Key Scientific and Technological Grant of Zhejiang for Breeding New Agricultural Varieties (2021C02072), the China Agriculture Research System of MOF and MARA (CARS-18), and the National Natural Science Foundation of China (31902212).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Davidovics, R.; Saw, Y.L.; Brown, C.O.; Prinz, M.; McKiernan, H.E.; Danielson, P.B.; Legg, K.M. High-throughput seminal fluid identification by automated immunoaffinity mass spectrometry. J. Forensic. Sci. 2022, 1–7. [Google Scholar] [CrossRef] [PubMed]
  2. Laflamme, B.A.; Wolfner, M.F. Identification and function of proteolysis regulators in seminal fluid. Mol. Reprod. Dev. 2013, 80, 80–101. [Google Scholar] [CrossRef] [Green Version]
  3. Findlay, G.D.; Sitnik, J.L.; Wang, W.; Aquadro, C.F.; Clark, N.L.; Wolfner, M.F. Evolutionary rate covariation identifies new members of a protein network required for Drosophila melanogaster female post-mating responses. PLoS Genet. 2014, 10, e1004108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Ram, K.R.; Wolfner, M.F. Sustained post-mating response in Drosophila melanogaster requires multiple seminal fluid proteins. PLoS Genet. 2007, 3, e238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Sitaram, N.; Nagaraj, R. Seminal plasmin. Bioessays 1995, 17, 415–422. [Google Scholar] [CrossRef] [PubMed]
  6. Amaro, I.A.; Ahmed-Braimah, Y.H.; League, G.P.; Pitcher, S.A.; Avila, F.W.; Cruz, P.C.; Harrington, L.C.; Wolfner, M.F. Seminal fluid proteins induce transcriptome changes in the Aedes aegypti female lower reproductive tract. BMC Genom. 2021, 22, 896. [Google Scholar] [CrossRef] [PubMed]
  7. Ramm, S.A. Seminal fluid and accessory male investment in sperm competition. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2020, 375, 20200068. [Google Scholar] [CrossRef]
  8. Sirot, L.K. On the evolutionary origins of insect seminal fluid proteins. Gen. Comp. Endocrinol. 2019, 278, 104–111. [Google Scholar] [CrossRef] [PubMed]
  9. Robertson, S.A. Seminal fluid signaling in the female reproductive tract: Lessons from rodents and pigs. J. Anim. Sci. 2007, 85, E36–E44. [Google Scholar] [CrossRef]
  10. Druart, X.; de Graaf, S. Seminal plasma proteomes and sperm fertility. Anim. Reprod. Sci. 2018, 194, 33–40. [Google Scholar] [CrossRef] [PubMed]
  11. Minhas, S.; Bettocchi, C.; Boeri, L.; Capogrosso, P.; Carvalho, J.; Cilesiz, N.C.; Cocci, A.; Corona, G.; Dimitropoulos, K.; Gul, M.; et al. European Association of Urology Guidelines on Male Sexual and Reproductive Health: 2021 Update on Male Infertility. Eur. Urol. 2021, 80, 603–620. [Google Scholar] [CrossRef] [PubMed]
  12. Brown, C.O.; Robbins, B.L.; McKiernan, H.E.; Danielson, P.B.; Legg, K.M. Direct seminal fluid identification by protease-free high-resolution mass spectrometry. J. Forensic. Sci. 2021, 66, 1017–1023. [Google Scholar] [CrossRef] [PubMed]
  13. Rodriguez-Martinez, H.; Kvist, U.; Ernerudh, J.; Sanz, L.; Calvete, J.J. Seminal plasma proteins: What role do they play? Am. J. Reprod. Immunol. 2011, 66 (Suppl. 1), 11–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Costello, S.; Michelangeli, F.; Nash, K.; Lefievre, L.; Morris, J.; Machado-Oliveira, G.; Barratt, C.; Kirkman-Brown, J.; Publicover, S. Ca2+-stores in sperm: Their identities and functions. Reproduction 2009, 138, 425–437. [Google Scholar] [CrossRef] [Green Version]
  15. Altschul, S.F.; Madden, T.L.; Schaffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic. Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Green Version]
  16. Lamas-Toranzo, I.; Hamze, J.G.; Bianchi, E.; Fernandez-Fuertes, B.; Perez-Cerezales, S.; Laguna-Barraza, R.; Fernandez-Gonzalez, R.; Lonergan, P.; Gutierrez-Adan, A.; Wright, G.J.; et al. TMEM95 is a sperm membrane protein essential for mammalian fertilization. Elife 2020, 9, e53913. [Google Scholar] [CrossRef]
  17. Noda, T.; Lu, Y.; Fujihara, Y.; Oura, S.; Koyano, T.; Kobayashi, S.; Matzuk, M.M.; Ikawa, M. Sperm proteins SOF1, TMEM95, and SPACA6 are required for sperm-oocyte fusion in mice. Proc. Natl. Acad. Sci. USA 2020, 117, 11493–11502. [Google Scholar] [CrossRef]
  18. Deneke, V.E.; Pauli, A. The Fertilization Enigma: How Sperm and Egg Fuse. Annu. Rev. Cell Dev. Biol. 2021, 37, 391–414. [Google Scholar] [CrossRef]
  19. Loir, M.; Labbe, C.; Maisse, G.; Pinson, A.; Boulard, G.; Mourot, B.; Chambeyron, F. Proteins of seminal fluid and spermatozoa in the trout (Oncorhynchus mykiss): Partial characterization and variations. Fish Physiol. Biochem. 1990, 8, 485–495. [Google Scholar] [CrossRef]
  20. Rasmussen, T.H.; Korsgaard, B. Estrogenic octylphenol affects seminal fluid production and its biochemical composition of eelpout (Zoarces viviparus). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2004, 139, 1–10. [Google Scholar] [CrossRef]
  21. Yu, S.; Kojima, N.; Hakomori, S.I.; Kudo, S.; Inoue, S.; Inoue, Y. Binding of rainbow trout sperm to egg is mediated by strong carbohydrate-to-carbohydrate interaction between (KDN)GM3 (deaminated neuraminyl ganglioside) and Gg3-like epitope. Proc. Natl. Acad. Sci. USA 2002, 99, 2854–2859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Mochida, K.; Kondo, T.; Matsubara, T.; Adachi, S.; Yamauchi, K. A high molecular weight glycoprotein in seminal plasma is a sperm immobilizing factor in the teleost Nile tilapia, Oreochromis niloticus. Dev. Growth Differ. 1999, 41, 619–627. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Binner, M.I.; Kogan, A.; Panser, K.; Schleiffer, A.; Deneke, V.E.; Pauli, A. The Sperm Protein Spaca6 is Essential for Fertilization in Zebrafish. Front. Cell Dev. Biol. 2021, 9, 806982. [Google Scholar] [CrossRef]
  24. Koppik, M.; Fricke, C. Gene expression changes in male accessory glands during ageing are accompanied by reproductive decline in Drosophila melanogaster. Mol. Ecol. 2017, 26, 6704–6716. [Google Scholar] [CrossRef] [PubMed]
  25. Carmel, I.; Tram, U.; Heifetz, Y. Mating induces developmental changes in the insect female reproductive tract. Curr. Opin. Insect Sci. 2016, 13, 106–113. [Google Scholar] [CrossRef] [PubMed]
  26. Simmons, L.W.; Beveridge, M.; Li, L.; Tan, Y.F.; Millar, A.H. Ontogenetic changes in seminal fluid gene expression and the protein composition of cricket seminal fluid. Evol. Dev. 2014, 16, 101–109. [Google Scholar] [CrossRef] [Green Version]
  27. Gasparini, C.; Marino, I.A.; Boschetto, C.; Pilastro, A. Effect of male age on sperm traits and sperm competition success in the guppy (Poecilia reticulata). J. Evol. Biol. 2010, 23, 124–135. [Google Scholar] [CrossRef]
  28. Sirot, L.K.; Buehner, N.A.; Fiumera, A.C.; Wolfner, M.F. Seminal fluid protein depletion and replenishment in the fruit fly, Drosophila melanogaster: An ELISA-based method for tracking individual ejaculates. Behav. Ecol. Sociobiol. 2009, 63, 1505–1513. [Google Scholar] [CrossRef] [Green Version]
  29. Avila, F.W.; Sirot, L.K.; LaFlamme, B.A.; Rubinstein, C.D.; Wolfner, M.F. Insect seminal fluid proteins: Identification and function. Annu. Rev. Entomol. 2011, 56, 21–40. [Google Scholar] [CrossRef] [Green Version]
  30. Ignotz, G.G.; Cho, M.Y.; Suarez, S.S. Annexins are candidate oviductal receptors for bovine sperm surface proteins and thus may serve to hold bovine sperm in the oviductal reservoir. Biol. Reprod. 2007, 77, 906–913. [Google Scholar] [CrossRef] [Green Version]
  31. LaFlamme, B.A.; Ram, K.R.; Wolfner, M.F. The Drosophila melanogaster seminal fluid protease “seminase” regulates proteolytic and post-mating reproductive processes. PLoS Genet. 2012, 8, e1002435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Ben Chehida, Y.; Denis, B.; Claisse, G.; Joly, D. What the study of seminal fluid proteins in Drosophila tells us about the evolution of reproduction. Med. Sci. 2014, 30, 651–657. [Google Scholar] [CrossRef] [Green Version]
  33. McGeary, M.K.; Findlay, G.D. Molecular evolution of the sex peptide network in Drosophila. J. Evol. Biol. 2020, 33, 629–641. [Google Scholar] [CrossRef] [PubMed]
  34. Kubli, E. Sex-peptides: Seminal peptides of the Drosophila male. Cell Mol. Life Sci. 2003, 60, 1689–1704. [Google Scholar] [CrossRef] [PubMed]
  35. Stephens, K.; Cardullo, R.A.; Thaler, C.D. Culex pipiens sperm motility is initiated by a trypsin-like protease from male accessory glands. Mol. Reprod. Dev. 2018, 85, 440–448. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, S.; Dos-Santos, A.L.A.; Huang, W.; Liu, K.C.; Oshaghi, M.A.; Wei, G.; Agre, P.; Jacobs-Lorena, M. Driving mosquito refractoriness to Plasmodium falciparum with engineered symbiotic bacteria. Science 2017, 357, 1399–1402. [Google Scholar] [CrossRef] [Green Version]
  37. Scolari, F.; Gomulski, L.M.; Ribeiro, J.M.; Siciliano, P.; Meraldi, A.; Falchetto, M.; Bonomi, A.; Manni, M.; Gabrieli, P.; Malovini, A.; et al. Transcriptional profiles of mating-responsive genes from testes and male accessory glands of the Mediterranean fruit fly, Ceratitis capitata. PLoS ONE 2012, 7, e46812. [Google Scholar] [CrossRef] [Green Version]
  38. Simmons, L.W.; Lovegrove, M. Socially cued seminal fluid gene expression mediates responses in ejaculate quality to sperm competition risk. Proc. Biol. Sci. 2017, 284, 20171486. [Google Scholar] [CrossRef]
  39. Xu, X.; Wang, Y.; Bi, H.; Xu, J.; Liu, Z.; Niu, C.; He, L.; James, A.A.; Li, K.; Huang, Y. Mutation of the seminal protease gene, serine protease 2, results in male sterility in diverse lepidopterans. Insect Biochem. Mol. Biol. 2020, 116, 103243. [Google Scholar] [CrossRef]
  40. De Castro Poncio, L.; Dos Anjos, F.A.; de Oliveira, D.A.; Rebechi, D.; de Oliveira, R.N.; Chitolina, R.F.; Fermino, M.L.; Bernardes, L.G.; Guimaraes, D.; Lemos, P.A.; et al. Novel Sterile Insect Technology Program Results in Suppression of a Field Mosquito Population and Subsequently to Reduced Incidence of Dengue. J. Infect. Dis. 2021, 224, 1005–1014. [Google Scholar] [CrossRef]
  41. Marec, F.; Vreysen, M.J.B. Advances and Challenges of Using the Sterile Insect Technique for the Management of Pest Lepidoptera. Insects 2019, 10, 371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Bieniek, J.M.; Drabovich, A.P.; Lo, K.C. Seminal biomarkers for the evaluation of male infertility. Asian J. Androl. 2016, 18, 426–433. [Google Scholar] [CrossRef] [PubMed]
  43. Benedict, M.Q. Sterile Insect Technique: Lessons From the Past. J. Med. Entomol. 2021, 58, 1974–1979. [Google Scholar] [CrossRef] [PubMed]
  44. Komor, A.C.; Badran, A.H.; Liu, D.R. CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell 2017, 168, 20–36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Roscoe, L.E.; Silk, P.; Eveleigh, E.S. Evidence of Male Hair Pencil Pheromone in Choristoneura fumiferana (Lepidoptera: Tortricidae). J. Insect Sci. 2016, 16, 27. [Google Scholar] [CrossRef] [Green Version]
  46. Tan, A.; Tanaka, H.; Tamura, T.; Shiotsuki, T. Precocious metamorphosis in transgenic silkworms overexpressing juvenile hormone esterase. Proc. Natl. Acad. Sci. USA 2005, 102, 11751–11756. [Google Scholar] [CrossRef] [Green Version]
  47. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
  48. Zuckerkandl, E. Evolutionary divergence and convergence in proteins. In Evolving Genes & Proteins; Academic Press: New York, NY, USA, 1965. [Google Scholar]
  49. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  50. Hwang, W.Y.; Fu, Y.; Reyon, D.; Maeder, M.L.; Tsai, S.Q.; Sander, J.D.; Peterson, R.T.; Yeh, J.R.; Joung, J.K. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 2013, 31, 227–229. [Google Scholar] [CrossRef] [PubMed]
  51. Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef]
  52. Hsu, P.D.; Lander, E.S.; Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157, 1262–1278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Xu, J.; Chen, R.M.; Chen, S.Q.; Chen, K.; Tang, L.M.; Yang, D.H.; Yang, X.; Zhang, Y.; Song, H.S.; Huang, Y.P. Identification of a germline-expression promoter for genome editing in Bombyx mori. Insect Sci. 2018, 26, 991–999. [Google Scholar] [CrossRef]
  54. Rodriguez-Martinez, H.; Martinez, E.A.; Calvete, J.J.; Pena Vega, F.J.; Roca, J. Seminal Plasma: Relevant for Fertility? Int. J. Mol. Sci. 2021, 22, 4368. [Google Scholar] [CrossRef] [PubMed]
  55. Ma, Y.W.; Zhang, L.F.; Huang, X.X. Genome modification by CRISPR/Cas9. FEBS J. 2014, 281, 5186–5193. [Google Scholar] [CrossRef] [PubMed]
  56. Manghwar, H.; Lindsey, K.; Zhang, X.; Jin, S. CRISPR/Cas System: Recent Advances and Future Prospects for Genome Editing. Trends. Plant. Sci. 2019, 24, 1102–1125. [Google Scholar] [CrossRef] [Green Version]
  57. McGraw, L.A.; Gibson, G.; Clark, A.G.; Wolfner, M.F. Genes regulated by mating, sperm, or seminal proteins in mated female Drosophila melanogaster. Curr. Biol. 2004, 14, 1509–1514. [Google Scholar] [CrossRef] [Green Version]
  58. Furusawa, M.; Ohnishi, T.; Taira, T.; Iguchi-Ariga, S.M.; Ariga, H. AMY-1, a c-Myc-binding protein, is localized in the mitochondria of sperm by association with S-AKAP84, an anchor protein of cAMP-dependent protein kinase. J. Biol. Chem. 2001, 276, 36647–36651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. McGraw, L.A.; Clark, A.G.; Wolfner, M.F. Post-mating gene expression profiles of female Drosophila melanogaster in response to time and to four male accessory gland proteins. Genetics 2008, 179, 1395–1408. [Google Scholar] [CrossRef] [Green Version]
  60. Chakravorty, S.; Vu, H.; Foelber, V.; Vigoreaux, J.O. Mutations of the Drosophila myosin regulatory light chain affect courtship song and reduce reproductive success. PLoS ONE 2014, 9, e90077. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Sitnik, J.L.; Gligorov, D.; Maeda, R.K.; Karch, F.; Wolfner, M.F. The Female Post-Mating Response Requires Genes Expressed in the Secondary Cells of the Male Accessory Gland in Drosophila melanogaster. Genetics 2016, 202, 1029–1041. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Sugahara, R.; Jouraku, A.; Nakakura, T.; Minaba, M.; Yamamoto, T.; Shinohara, Y.; Miyoshi, H.; Shiotsuki, T. Tissue-specific expression and silencing phenotypes of mitochondrial phosphate carrier paralogues in several insect species. Insect Mol. Biol. 2017, 26, 332–342. [Google Scholar] [CrossRef]
  63. Silva, A.M.S.; Socorro, S.; Hurtado de Llera, A.; Vaz, C.V.; Correia, S.; Maia, C.J. Overexpression of regucalcin mitigates the ageing-related changes in oxidative stress and sperm quality. Theriogenology 2020, 157, 472–482. [Google Scholar] [CrossRef] [PubMed]
  64. Primakoff, P.; Myles, D.G. Penetration, adhesion, and fusion in mammalian sperm-egg interaction. Science 2002, 296, 2183–2185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Scolari, F.; Khamis, F.M.; Perez-Staples, D. Beyond Sperm and Male Accessory Gland Proteins: Exploring Insect Reproductive Metabolomes. Front. Physiol. 2021, 12, 729440. [Google Scholar] [CrossRef] [PubMed]
Biology 11 00561 g001 550
Figure 1. Sfp62 is highly conserved in lepidopterans. (A) The phylogenetic tree of Sfp62 in B. mori and other 19 representative lepidopteran species. GenBank accession numbers are as follows: Bombyx mori (XP_021204150.2), Danaus chrysippus (CAG9569287.1), Danaus plexippus (XP_032523373.1), Melitaea cinxia (XP_045455307.1), Hyposmocoma kahamanoa (XP_026322869.1), Pieris macdunnoughi (CAF4912374.1), Brenthis ino (CAH0721132.1), Ostrinia furnacalis (XP_028171747.1), Zerene cesonia (XP_038219751.1), Pieris rapae (XP_022123155.1), Arctia plantaginis (CAB3258352.1), Papilio xuthus (XP_013165404.1), Vanessa tameamea (XP_026498813.1), Chilo suppressalis (RVE48234.1), Helicoverpa armigera (PZC77022.1), Papilio machaon (KPJ19182.1), Spodoptera litura (XP_022827516.1), Spodoptera frugiperda (XP_035441889.1), Manduca sexta (XP_037295811.1), and Trichoplusia ni (XP_026729495.1). (B) Conservation of Sfp62 in B. mori, O. furnacalis, C. suppressalis, H. armigera, S. litura, S. frugiperda, M. sexta, and T. ni.
Figure 1. Sfp62 is highly conserved in lepidopterans. (A) The phylogenetic tree of Sfp62 in B. mori and other 19 representative lepidopteran species. GenBank accession numbers are as follows: Bombyx mori (XP_021204150.2), Danaus chrysippus (CAG9569287.1), Danaus plexippus (XP_032523373.1), Melitaea cinxia (XP_045455307.1), Hyposmocoma kahamanoa (XP_026322869.1), Pieris macdunnoughi (CAF4912374.1), Brenthis ino (CAH0721132.1), Ostrinia furnacalis (XP_028171747.1), Zerene cesonia (XP_038219751.1), Pieris rapae (XP_022123155.1), Arctia plantaginis (CAB3258352.1), Papilio xuthus (XP_013165404.1), Vanessa tameamea (XP_026498813.1), Chilo suppressalis (RVE48234.1), Helicoverpa armigera (PZC77022.1), Papilio machaon (KPJ19182.1), Spodoptera litura (XP_022827516.1), Spodoptera frugiperda (XP_035441889.1), Manduca sexta (XP_037295811.1), and Trichoplusia ni (XP_026729495.1). (B) Conservation of Sfp62 in B. mori, O. furnacalis, C. suppressalis, H. armigera, S. litura, S. frugiperda, M. sexta, and T. ni.
Biology 11 00561 g001
Biology 11 00561 g002 550
Figure 2. BmSfp62 is highly expressed in testis. (A) BmSfp62 expression in 10 tissues: head (HE), epidermis (EPI), fat body (FB), midgut (MG), Malpighian tubules (MT), anterior silk gland (ASG), middle silk gland (MSG), posterior silk gland (PSG), testis (TE) and ovary (OV) at L5D3 and W stages. (B) BmSfp62 expression in male accessory gland (MAG), seminal vesicle and ejaculatory vesicle (SV&EV), glandula prostatica (GP), testis (TE), female accessory gland (FAG), and bursa copulatrix (BC) in virgin and mated adults. BmSfp62 mRNA expression level was normalized to expression of Bmrp49. The data shown are means ± S.E.M. (n = 3). Asterisks indicate significant differences with a two-tailed t-test: *** p < 0.001.
Figure 2. BmSfp62 is highly expressed in testis. (A) BmSfp62 expression in 10 tissues: head (HE), epidermis (EPI), fat body (FB), midgut (MG), Malpighian tubules (MT), anterior silk gland (ASG), middle silk gland (MSG), posterior silk gland (PSG), testis (TE) and ovary (OV) at L5D3 and W stages. (B) BmSfp62 expression in male accessory gland (MAG), seminal vesicle and ejaculatory vesicle (SV&EV), glandula prostatica (GP), testis (TE), female accessory gland (FAG), and bursa copulatrix (BC) in virgin and mated adults. BmSfp62 mRNA expression level was normalized to expression of Bmrp49. The data shown are means ± S.E.M. (n = 3). Asterisks indicate significant differences with a two-tailed t-test: *** p < 0.001.
Biology 11 00561 g002
Biology 11 00561 g003 550
Figure 3. BmSfp62 knockout using CRISPR/Cas9. (A) Genomic structure of BmSfp62. (B) Schematic representations the Nos-Cas9 and U6-sgRNA. (C) Base deletion. Black is target sequences; red is PAM sequences. The deletion size is indicated to the right of the sequence.
Figure 3. BmSfp62 knockout using CRISPR/Cas9. (A) Genomic structure of BmSfp62. (B) Schematic representations the Nos-Cas9 and U6-sgRNA. (C) Base deletion. Black is target sequences; red is PAM sequences. The deletion size is indicated to the right of the sequence.
Biology 11 00561 g003
Biology 11 00561 g004 550
Figure 4. Deletion of BmSfp62 results in male sterility. (A) Eggs produced by crosses. (B) Eggs hatched and unhatched. (C) Relative mRNA expression of BmSfp62 in reproductive adult tissues. Virgin WT is in blue, virgin ΔBmSfp62 is in orange, mated WT is in green, and mated ΔBmSfp62 is in pink. BmSfp62 mRNA expression level was normalized to Bmrp49. The data shown are means ± S.E.M. (n = 3). Asterisks indicate significant differences with a two-tailed t-test: *** p < 0.001; n. s. p > 0.05.
Figure 4. Deletion of BmSfp62 results in male sterility. (A) Eggs produced by crosses. (B) Eggs hatched and unhatched. (C) Relative mRNA expression of BmSfp62 in reproductive adult tissues. Virgin WT is in blue, virgin ΔBmSfp62 is in orange, mated WT is in green, and mated ΔBmSfp62 is in pink. BmSfp62 mRNA expression level was normalized to Bmrp49. The data shown are means ± S.E.M. (n = 3). Asterisks indicate significant differences with a two-tailed t-test: *** p < 0.001; n. s. p > 0.05.
Biology 11 00561 g004
Biology 11 00561 g005 550
Figure 5. Expression of genes associated with sperm development and motility is altered in ΔBmSfp62 individuals. mRNA levels of BmAtta (GU244351.1), BmAmy (NM_001173153.1), BmMlc (XM_012694217.1), BmTry (XM_012688545.2), BmPtp (NM_001047017.1), and BmRca (XM_004930660.3). WT is in blue, ΔBmSfp62 is in orange. mRNA expression level was normalized to Bmrp49. The data shown are means ± S.E.M. (n = 3). Asterisks indicate significant differences with a two-tailed t-test: *** p < 0.001.
Figure 5. Expression of genes associated with sperm development and motility is altered in ΔBmSfp62 individuals. mRNA levels of BmAtta (GU244351.1), BmAmy (NM_001173153.1), BmMlc (XM_012694217.1), BmTry (XM_012688545.2), BmPtp (NM_001047017.1), and BmRca (XM_004930660.3). WT is in blue, ΔBmSfp62 is in orange. mRNA expression level was normalized to Bmrp49. The data shown are means ± S.E.M. (n = 3). Asterisks indicate significant differences with a two-tailed t-test: *** p < 0.001.
Biology 11 00561 g005
Biology 11 00561 g006 550
Figure 6. The BmSfp62 mutation does not impair competitiveness and is inherited. (A) Response indices of WT and ΔBmSfp62 females. (B) Response indices of WT and ΔBmSfp62 males. (C) Number of progenies with indicated mutations in F1 (circles), F2 (squares), and F3 (triangles) generations. The data shown are means ± S.E.M. (n = 30/group). N.S. indicates no significance by a two-tailed t-test. Horizontal bars indicate means (n = 3).
Figure 6. The BmSfp62 mutation does not impair competitiveness and is inherited. (A) Response indices of WT and ΔBmSfp62 females. (B) Response indices of WT and ΔBmSfp62 males. (C) Number of progenies with indicated mutations in F1 (circles), F2 (squares), and F3 (triangles) generations. The data shown are means ± S.E.M. (n = 30/group). N.S. indicates no significance by a two-tailed t-test. Horizontal bars indicate means (n = 3).
Biology 11 00561 g006
Table
Table 1. Primers used in detection.
Table 1. Primers used in detection.
Primer NamePrimer Sequence (5′-3′)
qRT-PCR analysis
BmSfp62-FGGCCCTTCCTATACACGTCA
BmSfp62-RCGTCACTATCGTTTGCAGCA
BmAtta-FGCGGACTGGACTACATGTTC
BmAtta-RTCAAACTTCTTGAAGCCGGC
BmAmy-FCATGGGTGTTGCTGGTTTCA
BmAmy-RTGCGACTGATAGCTTCACCA
BmMlc-FTCCCATCTACAGCCAAGCAA
BmMlc-RTAGGGGATCATGCCGTCATC
BmTry-FCGTACCGACTTTCAGGAGGA
BmTry-RCAGATGATGTGGTGCCTTCG
BmPtp-FCGCCGAGAAGTACAAGAACG
BmPtp-RTACGGTAAGTGTAGGCGGTC
BmRca-FATGACCATAGACACGGACGG
BmRca-RTTCATAGAGGCGGAGGTCAC
BmRP49-FTCAATCGGATCGCTATGACA
BmRP49-RATGACGGGTCTTCTTGTTGG
Plasmid construction
U6-FCTCACTATAGGGCGAATTGGAGGTTATGTAGTACACATTGTTGTA
U6-RTTTTCTTGTTATAGATATCAAAAAAAGCACCGACTCGGTG
Overlap-FGCTAGCCATTGACTCCGCGGAGGTTATGTAGTACACATTGTTGTA
Overlap-RCCGCGGAGTCAATGGCTAGCAAAAAAGCACCGACTCGGTG
Sg1-FGGTAAGTCCCACAGTTGTCAGTTTTAGAGCTAGAAATAGCAAGTT
Sg1-RTGACAACTGTGGGACTTACCACTTGTAGAGCACGATATTTTGTAT
Sg2-FGGGGTATCACTCACGAAGAGGTTTTAGAGCTAGAAATAGCAAGTT
Sg2-RCTCTTCGTGAGTGATACCCCACTTGTAGAGCACGATATTTTGTAT
Identification of mutations
TS-FATGCAGAATGACCACGGTGGG
TS-RCGTCGAGCCCTTCGTCTCAA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Xu, X.; Chen, J.; Du, X.; Yao, L.; Wang, Y. CRISPR/Cas9 Mediated Disruption of Seminal Fluid Protein Sfp62 Induces Male Sterility in Bombyx mori. Biology 2022, 11, 561. https://doi.org/10.3390/biology11040561

AMA Style

Xu X, Chen J, Du X, Yao L, Wang Y. CRISPR/Cas9 Mediated Disruption of Seminal Fluid Protein Sfp62 Induces Male Sterility in Bombyx mori. Biology. 2022; 11(4):561. https://doi.org/10.3390/biology11040561

Chicago/Turabian Style

Xu, Xia, Jine Chen, Xin Du, Lusong Yao, and Yongqiang Wang. 2022. "CRISPR/Cas9 Mediated Disruption of Seminal Fluid Protein Sfp62 Induces Male Sterility in Bombyx mori" Biology 11, no. 4: 561. https://doi.org/10.3390/biology11040561

APA Style

Xu, X., Chen, J., Du, X., Yao, L., & Wang, Y. (2022). CRISPR/Cas9 Mediated Disruption of Seminal Fluid Protein Sfp62 Induces Male Sterility in Bombyx mori. Biology, 11(4), 561. https://doi.org/10.3390/biology11040561

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop