Blockade of Cellular Energy Metabolism through 6-Aminonicotinamide Reduces Proliferation of Non-Small Lung Cancer Cells by Inducing Endoplasmic Reticulum Stress
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Reagents
2.2. 6-AN Treatment
2.3. Cell Metabolic Activity and Clonogenicity Survival Assays
2.4. Metabolic Energy Marker Analysis
2.5. Flow Cytometry Analysis
2.6. Live/Dead Cell Staining
2.7. qRT-PCR
2.8. Intracellular ROS Determination (H2DCFDA)
2.9. Evaluation of the NADP/NADPH Ratio
2.10. Ki67 Immunofluorescence
2.11. Apoptosis Assays
2.12. TCGA Data Analysis
2.13. Statistical Analysis
3. Results
3.1. PPP Inhibitor 6-AN Induces Apoptosis in Non-Small Lung Cancer Cells
3.2. Exposure of 6-AN Reduces Clonogenicity of Lung Cancer Cells
3.3. Exposure of 6-AN Alters the Metabolic Parameters of Lung Cancer Cells
3.4. 6-AN Increases Intracellular ROS and ER Stress, and Affects Mitochondrial Membrane Potential
3.5. 6-AN Modulates the Expression of Key Enzymes Involved in PPP
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Patra, K.C.; Hay, N. The pentose phosphate pathway and cancer. Trends Biochem. Sci. 2014, 39, 347–354. [Google Scholar] [CrossRef] [Scilit]
- Liberti, M.V.; Locasale, J.W. The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riganti, C.; Gazzano, E.; Polimeni, M.; Aldieri, E.; Ghigo, D. The pentose phosphate pathway: An antioxidant defense and a crossroad in tumor cell fate. Free Radic. Biol. Med. 2012, 53, 421–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hay, N. Reprogramming glucose metabolism in cancer: Can it be exploited for cancer therapy? Nat. Rev. Cancer 2016, 16, 635–649. [Google Scholar] [CrossRef] [Scilit]
- Stincone, A.; Prigione, A.; Cramer, T.; Wamelink, M.M.C.; Campbell, K.; Cheung, E.; Olin-Sandoval, V.; Grüning, N.-M.; Krüger, A.; Alam, M.T.; et al. The return of metabolism: Biochemistry and physiology of the pentose phosphate pathway. Biol. Rev. 2015, 90, 927–963. [Google Scholar] [CrossRef] [Scilit]
- Langbein, S.; Zerilli, M.; Hausen, A.Z.; Staiger, W.; Rensch-Boschert, K.; Lukan, N.; Popa, J.; Ternullo, M.P.; Steidler, A.; Weiss, C.; et al. Expression of transketolase TKTL1 predicts colon and urothelial cancer patient survival: Warburg effect reinterpreted. Br. J. Cancer 2006, 94, 578–585. [Google Scholar] [CrossRef] [Scilit]
- Lucarelli, G.; Galleggiante, V.; Rutigliano, M.; Sanguedolce, F.; Cagiano, S.; Bufo, P.; Lastilla, G.; Maiorano, E.; Ribatti, D.; Giglio, A.; et al. Metabolomic profile of glycolysis and the pentose phosphate pathway identifies the central role of glucose-6-phosphate dehydrogenase in clear cell-renal cell carcinoma. Oncotarget 2015, 6, 13371–13386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trachootham, D.; Alexandre, J.; Huang, P. Targeting cancer cells by ROS-mediated mechanisms: A radical therapeutic approach? Nat. Rev. Drug Discov. 2009, 8, 579–591. [Google Scholar] [CrossRef] [Scilit]
- Ivanova, D.; Bakalova, R.; Lazarova, D.; Gadjeva, V.; Zhelev, Z. The impact of reactive oxygen species on anticancer therapeutic strategies. Adv. Clin. Exp. Med. 2013, 22, 899–908. [Google Scholar] [PubMed]
- Bakalova, R.; Zhelev, Z.; Aoki, I.; Saga, T. Tissue Redox Activity as a Hallmark of Carcinogenesis: From Early to Terminal Stages of Cancer. Clin. Cancer Res. 2013, 19, 2503–2517. [Google Scholar] [CrossRef] [Scilit]
- Zhelev, Z.; Aoki, I.; Gadjeva, V.; Nikolova, B.; Bakalova, R.; Saga, T. Tissue redox activity as a sensing platform for imaging of cancer based on nitroxide redox cycle. Eur. J. Cancer 2013, 49, 1467–1478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cruys, B.; Wong, B.; Kuchnio, A.; Verdegem, D.; Cantelmo, A.R.; Conradi, L.-C.; Vandekeere, S.; Bouché, A.; Cornelissen, I.; Vinckier, S.; et al. Glycolytic regulation of cell rearrangement in angiogenesis. Nat. Commun. 2016, 7, 12240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herbel, C.; Patsoukis, N.; Bardhan, K.; Seth, P.; Weaver, J.D.; Boussiotis, V.A. Clinical significance of T cell metabolic reprogramming in cancer. Clin. Transl. Med. 2016, 5, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walker, D.L.; Reid, J.M.; Svingen, P.A.; Rios, R.; Covey, J.M.; Alley, M.C.; Hollingshead, M.G.; Budihardjo, I.; Eckdahl, S.; Boerner, S.A.; et al. Murine pharmacokinetics of 6-aminonicotinamide (NSC 21206), a novel biochemical modulating agent. Biochem. Pharmacol. 1999, 58, 1057–1066. [Google Scholar] [CrossRef] [Scilit]
- Keniry, M.A.; Hollander, C.; Benz, C.C. The effect of gossypol and 6-aminonicotinamide on tumor cell metabolism: A 31P-magnetic resonance spectroscopic study. Biochem. Biophys. Res. Commun. 1989, 164, 947–953. [Google Scholar] [CrossRef] [Scilit]
- Mahmood, U.; Street, J.C.; Matei, C.; Ballon, D.; Martin, D.S.; Koutcher, J.A. In Vivo Detection by31P NMR of Pentose Phosphate Pathway Block Secondary to Biochemical Modulation. NMR Biomed. 1996, 9, 114–120. [Google Scholar] [CrossRef]
- Sharma, P.K.; Bhardwaj, R.; Dwarakanath, B.S.; Varshney, R. Metabolic oxidative stress induced by a combination of 2-DG and 6-AN enhances radiation damage selectively in malignant cells via non-coordinated expression of antioxidant enzymes. Cancer Lett. 2010, 295, 154–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaushik, N.; Lee, S.J.; Choi, T.G.; Baik, K.Y.; Uhm, H.S.; Kim, C.H.; Kaushik, N.K.; Choi, E.H. Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells. Sci. Rep. 2015, 5, 8726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaushik, N.K.; Kaushik, N.; Bhartiya, P.; Nguyen, L.N.; Choi, E.H. Glycolytic inhibitor induces metabolic crisis in solid cancer cells to enhance cold plasma-induced cell death. Plasma Process. Polym. 2021, 18, 2000187. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, L.N.; Kaushik, N.; Bhartiya, P.; Gurmessa, S.K.; Kim, H.-J.; Nguyen, L.Q.; Kaushik, N.K.; Choi, E.H. Plasma-synthesized mussel-inspired gold nanoparticles promote autophagy-dependent damage-associated molecular pattern release to potentiate immunogenic cancer cell death. J. Ind. Eng. Chem. 2021, 100, 99–111. [Google Scholar] [CrossRef] [Scilit]
- Attri, P.; Kaushik, N.K.; Kaushik, N.; Hammerschmid, D.; Privat-Maldonado, A.; De Backer, J.; Shiratani, M.; Choi, E.H.; Bogaerts, A. Plasma treatment causes structural modifications in lysozyme, and increases cytotoxicity towards cancer cells. Int. J. Biol. Macromol. 2021, 182, 1724–1736. [Google Scholar] [CrossRef] [Scilit]
- Bhartiya, P.; Mumtaz, S.; Lim, J.S.; Kaushik, N.; Lamichhane, P.; Nguyen, L.N.; Jang, J.H.; Yoon, S.H.; Choi, J.J.; Kaushik, N.K.; et al. Pulsed 3.5 GHz high power microwaves irradiation on physiological solution and their biological evaluation on human cell lines. Sci. Rep. 2021, 11, 8475. [Google Scholar] [CrossRef] [Scilit]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gerdes, J.; Lemke, H.; Baisch, H.; Wacker, H.H.; Schwab, U.; Stein, H. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J. Immunol. 1984, 133, 1710–1715. [Google Scholar] [PubMed]
- Fernandez-Marcos, P.J.; Nóbrega-Pereira, S. NADPH: New oxygen for the ROS theory of aging. Oncotarget 2016, 7, 50814–50815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Travers, K.J.; Patil, C.K.; Wodicka, L.; Lockhart, D.J.; Weissman, J.S.; Walter, P. Functional and Genomic Analyses Reveal an Essential Coordination between the Unfolded Protein Response and ER-Associated Degradation. Cell 2000, 101, 249–258. [Google Scholar] [CrossRef] [Scilit]
- Tsai, Y.C.; Weissman, A.M. The Unfolded Protein Response, Degradation from the Endoplasmic Reticulum, and Cancer. Genes Cancer 2010, 1, 764–778. [Google Scholar] [CrossRef] [Scilit]
- Özcan, U.; Cao, Q.; Yilmaz, E.; Lee, A.H.; Iwakoshi, N.N.; Özdelen, E.; Tuncman, G.; Görgün, C.; Glimcher, L.H.; Hotamisligil, G.S. Endoplasmic Reticulum Stress Links Obesity, Insulin Action, and Type 2 Diabetes. Science 2004, 306, 457–461. [Google Scholar] [CrossRef] [Scilit]
- Hirosumi, J.; Tuncman, G.; Chang, L.; Görgün, C.Z.; Uysal, K.T.; Maeda, K.; Karin, M.; Hotamisligil, G.S. A central role for JNK in obesity and insulin resistance. Nature 2002, 420, 333–336. [Google Scholar] [CrossRef] [Scilit]
- Ge, T.; Yang, J.; Zhou, S.; Wang, Y.; Li, Y.; Tong, X. The Role of the Pentose Phosphate Pathway in Diabetes and Cancer. Front. Endocrinol. 2020, 11, 365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Santo, C.; Booth, S.; Vardon, A.; Cousins, A.; Tubb, V.; Perry, T.; Noyvert, B.; Beggs, A.; Ng, M.; Halsey, C.; et al. The arginine metabolome in acute lymphoblastic leukemia can be targeted by the pegylated-recombinant arginase I BCT-100. Int. J. Cancer 2018, 142, 1490–1502. [Google Scholar] [CrossRef] [Scilit]
- Mele, L.; Paino, F.; Papaccio, F.; Regad, T.; Boocock, D.; Stiuso, P.; Lombardi, A.; Liccardo, D.; Aquino, G.; Barbieri, A.; et al. A new inhibitor of glucose-6-phosphate dehydrogenase blocks pentose phosphate pathway and suppresses malignant proliferation and metastasis in vivo. Cell Death Dis. 2018, 9, 572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, R.C.; Board, P.G.; Blackburn, A.C. Targeting metabolism with arsenic trioxide and dichloroacetate in breast cancer cells. Mol. Cancer 2011, 10, 142. [Google Scholar] [CrossRef] [Scilit]
- Cheong, J.-H.; Park, E.S.; Liang, J.; Dennison, J.B.; Tsavachidou, D.; Nguyen-Charles, C.; Cheng, K.W.; Hall, H.; Zhang, D.; Lu, Y.; et al. Dual Inhibition of Tumor Energy Pathway by 2-Deoxyglucose and Metformin Is Effective against a Broad Spectrum of Preclinical Cancer Models. Mol. Cancer Ther. 2011, 10, 2350–2362. [Google Scholar] [CrossRef] [Scilit]
- Luengo, A.; Gui, D.Y.; Heiden, M.G.V. Targeting Metabolism for Cancer Therapy. Cell Chem. Biol. 2017, 24, 1161–1180. [Google Scholar] [CrossRef] [Scilit]
- Boros, L.G.; Puigjaner, J.; Cascante, M.; Lee, W.N.; Brandes, J.L.; Bassilian, S.; Yusuf, F.I.; Williams, R.D.; Muscarella, P.; Melvin, W.S.; et al. Oxythiamine and dehydroepiandrosterone inhibit the nonoxidative synthesis of ribose and tumor cell proliferation. Cancer Res. 1997, 57, 4242–4248. [Google Scholar]
- Kowalik, M.A.; Columbano, A.; Perra, A. Emerging Role of the Pentose Phosphate Pathway in Hepatocellular Carcinoma. Front. Oncol. 2017, 7, 87. [Google Scholar] [CrossRef] [Scilit]
- Herter, F.P.; Weissman, S.G.; Thompson, H.G., Jr.; Hyman, G.; Martin, D.S. Clinical experience with 6-aminonicotinamide. Cancer Res. 1961, 21, 31–37. [Google Scholar]
- Keibler, M.A.; Wasylenko, T.M.; Kelleher, J.K.; Iliopoulos, O.; Vander Heiden, M.G.; Stephanopoulos, G. Metabolic requirements for cancer cell proliferation. Cancer Metab. 2016, 4, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schröder, M.; Kaufman, R.J. ER stress and the unfolded protein response. Mutat. Res. Mol. Mech. Mutagen. 2005, 569, 29–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verfaillie, T.; Salazar, M.; Velasco, G.; Agostinis, P. Linking ER Stress to Autophagy: Potential Implications for Cancer Therapy. Int. J. Cell Biol. 2010, 2010, 930509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Indran, I.R.; Tufo, G.; Pervaiz, S.; Brenner, C. Recent advances in apoptosis, mitochondria and drug resistance in cancer cells. Biochim. Biophys. Acta (BBA)-Bioenerg. 2011, 1807, 735–745. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene Name | Sequence (5′-3′) |
|---|---|
| ACTIN-forward | GGC ATC CTC ACC CTG AAG TA |
| ACTIN-reverse | AGG TGT GGT GCC AGA TTT TC |
| G6PD-forward | GAAACGGTCGTACACTTCGG |
| G6PD-reverse | CCGATGCACCCATGATGATG |
| TKT-forward | GTGCCTCTAAGACACCCTGT |
| TKT-reverse | GTGAAAGGGGAGCTGAGAGT |
| HPGD-forward | TAGCGCTGGTGGATTGGAAT |
| HPGD-reverse | GACCAAAATGTCCAGTCTTCCA |
| TALDO1-forward | TAAAGAAGATTCCGGGCCGA |
| TALDO1-reverse | TCCCAGGTTGATGACAGCTT |
| XBP1-forward | GGAGTTAAGACAGCGCTTGG |
| XBP1-reverse | CACTGGCCTCACTTCATTCC |
| DDIT3-forward | CAGAGCTGGAACCTGAGGAG |
| DDIT3-reverse | TGTTTATGGCTGCTTTGGTG |
| pERK-forward | CCAGCCTTAGCAAACCAGAG |
| pERK-reverse | TCTTGGTCCCACTGGAAGAG |
| ATF3-forward | TTTGCCATCCAGAACAAGC |
| ATF3-reverse | CATCTTCTTCAGGGGCTACCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaushik, N.; Kaushik, N.K.; Choi, E.H.; Kim, J.H. Blockade of Cellular Energy Metabolism through 6-Aminonicotinamide Reduces Proliferation of Non-Small Lung Cancer Cells by Inducing Endoplasmic Reticulum Stress. Biology 2021, 10, 1088. https://doi.org/10.3390/biology10111088
Kaushik N, Kaushik NK, Choi EH, Kim JH. Blockade of Cellular Energy Metabolism through 6-Aminonicotinamide Reduces Proliferation of Non-Small Lung Cancer Cells by Inducing Endoplasmic Reticulum Stress. Biology. 2021; 10(11):1088. https://doi.org/10.3390/biology10111088
Chicago/Turabian StyleKaushik, Neha, Nagendra Kumar Kaushik, Eun Ha Choi, and June Hyun Kim. 2021. "Blockade of Cellular Energy Metabolism through 6-Aminonicotinamide Reduces Proliferation of Non-Small Lung Cancer Cells by Inducing Endoplasmic Reticulum Stress" Biology 10, no. 11: 1088. https://doi.org/10.3390/biology10111088
APA StyleKaushik, N., Kaushik, N. K., Choi, E. H., & Kim, J. H. (2021). Blockade of Cellular Energy Metabolism through 6-Aminonicotinamide Reduces Proliferation of Non-Small Lung Cancer Cells by Inducing Endoplasmic Reticulum Stress. Biology, 10(11), 1088. https://doi.org/10.3390/biology10111088

