Biofilm Formation in Chicken-Derived Extraintestinal Pathogenic Escherichia coli Alters the Expression of Biofilm- and Virulence-Associated Genes

Abstract

Background: Extraintestinal pathogenic Escherichia coli (ExPEC) poses significant health risks to poultry and humans, with biofilm formation often complicating treatment by enhancing bacterial persistence and resistance. Understanding the genetic mechanisms underlying this lifestyle transition is crucial for controlling infections. This study aimed to investigate the effect of biofilm formation on the transcriptional expression of specific biofilm- and virulence-associated genes in chicken-derived ExPEC strains. Methods: Biofilm formation conditions for three strong biofilm-producing chicken-derived ExPEC strains were optimized using an orthogonal experimental design (L₉(3³)), evaluating culture medium, incubation time, and initial inoculum concentration. Biofilm biomass was quantified via crystal violet staining. Subsequently, the transcription levels of 10 biofilm-associated genes and 17 virulence-associated genes were compared between planktonic and biofilm states using Reverse Transcription-quantitative PCR (RT-qPCR). Results: Optimal culture conditions varied among strains, though nutrient-rich media consistently promoted rapid biofilm formation. Transcriptional analysis revealed significant reprogramming in the biofilm state. Among biofilm-associated genes, flhC, tolA, qseC, mhpB, and bdcR were consistently and significantly upregulated across all strains (p < 0.05). Regarding virulence determinants, the expression of eaeA, LT, fimH, ompF, and iss was significantly upregulated (p < 0.05), whereas Sta levels were significantly reduced (p < 0.05). Conclusions: Biofilm formation induces a distinct transcriptional shift in chicken-derived ExPEC, simultaneously enhancing the expression of key genes involved in biofilm maintenance and pathogenicity. The conserved upregulation of flhC, tolA, qseC, mhpB, and bdcR suggests these genes are critical drivers of biofilm development. Consequently, they represent potential targets for novel therapeutic strategies aimed at preventing E. coli infections and eradicating biofilms in clinical and agricultural settings.

1. Introduction

Escherichia coli, a widely distributed bacterium, serves as the major facultative anaerobe in the gastrointestinal tract of humans and warm-blooded animals [1]. Pathogenic strains, however, cause significant morbidity and mortality and are classified into two main categories: intestinal (InPEC) and extraintestinal (ExPEC) pathogenic E. coli. ExPEC is a common cause of bacteremia and sepsis in humans and farm animals, and its ability to form biofilm presents difficulties for the eradication of infections caused by E. coli [2].

Biofilms are organized microbial aggregates embedded within a self-produced matrix of extracellular polymeric substances (EPSs) attached to biotic or abiotic surfaces. This formation enhances bacterial environmental adaptation and is a primary contributor to antimicrobial resistance and the challenge of treating infectious diseases. Biofilms provide a protective environment that allows bacteria to survive under adverse conditions, making them difficult to eradicate [3]. It is estimated that 65–80% of human infections are associated with microbial biofilms. Previous studies have highlighted transcriptional shifts following biofilm formation. For instance, Min et al. [4] observed significant changes in the transcription of quorum-sensing and virulence genes in Pseudomonas aeruginosa. Similarly, Schilcher et al. [5] reported that compared to planktonic bacteria, Staphylococcus aureus biofilms exhibited 5-, 4-, 8-, 2-, and 5-fold increases in the expression of agrA, agrC, sarR, sarT, and icaC, respectively, while isaB, icaC, fnbA, ebpS, and fnbB decreased by 10- to 20-fold. In uropathogenic E. coli, Fattahi et al. [6] found a greater abundance of virulence genes (e.g., fimH, TonB, ireA) in strong biofilm producers compared to weak ones. Furthermore, Dawadi et al. [7] observed greater pathogenicity in biofilm-positive isolates compared with biofilm-negative E. coli strains. To date, however, the expression of virulence genes following biofilm formation in chicken-derived ExPEC remains unexplored. Therefore, this study optimized ExPEC biofilm formation and investigated the transcript levels of genes associated with both biofilm formation and virulence. The aim was to identify key genes driving pathogenicity enhancement post-biofilm formation and provide a theoretical basis for clinical intervention.

2. Results

2.1. Optimal Culture Conditions for Biofilm-Forming Strains of Chicken-Derived ExPEC

Biofilm formation conditions for three strong biofilm-producing chicken-derived ExPEC strains were optimized using an orthogonal design and crystal violet staining. As shown in

Table 1. Results of orthogonal tests for three strains of Escherichia coli.

Group	Factor A			Factor B			Factor C			OD600 (nm)
	E-39	E-40	E-41	E-39	E-40	E-41	E-39	E-40	E-41	E-39	E-40	E-41
G1	1	1	1	1	1	1	1	1	1	0.67	2.19	1.95
G2	1	1	1	2	2	2	2	2	2	1.41	2.52	3.13
G3	1	1	1	3	3	3	3	3	3	1.70	2.47	3.45
G4	2	2	2	1	1	1	2	2	2	1.43	1.92	2.33
G5	2	2	2	2	2	2	3	3	3	2.32	2.63	2.32
G6	2	2	2	3	3	3	1	1	1	2.06	2.20	2.69
G7	3	3	3	1	1	1	3	3	3	0.66	0.82	1.03
G8	3	3	3	2	2	2	1	1	1	0.48	0.46	0.67
G9	3	3	3	3	3	3	2	2	2	0.56	0.56	0.52
K1	1.26	2.39	2.84	0.92	1.64	1.77	1.07	1.61	1.77
K2	1.93	2.25	2.45	1.40	1.87	2.04	1.13	1.66	1.99
K3	0.57	0.61	0.74	1.44	1.74	2.22	1.56	1.97	2.27
R	1.36	1.78	2.10	0.52	0.23	0.45	0.49	0.36	0.50

Note: K₁, K₂, and K₃ denote the averages of the test index for the levels of “1”, “2”, and “3” in each column. R means extreme difference (the maximum value in K₁, K₂, and K₃ minus the minimum value).

, analysis of the range (R) values revealed that the optimal conditions varied among the three strains. Specifically, the optimal combination for strain E-39 was A2B3C3, corresponding to an initial inoculum of OD₆₀₀ = 0.4 in TSB medium cultured at 37 °C for 48 h. Strain E-40 required condition A1B2C3 (BHI medium, initial OD₆₀₀ = 0.4, 36 h), whereas strain E-41 achieved maximal biofilm formation under condition A1B3C3 (BHI medium, initial OD₆₀₀ = 0.4, 48 h). These results demonstrate that despite sharing a strong biofilm-positive phenotype, the specific environmental requirements for optimal biofilm formation are strain-dependent.

2.2. Morphological Characteristics of Biofilms (SEM Observation)

Under optimal culture conditions, all three ExPEC strains formed biofilm structures with bacterial aggregates encapsulated in extracellular polymeric substances (EPSs) (shown in Figure 1). These observations confirmed that all tested strains successfully formed biofilms under the optimized conditions, providing phenotypic support for subsequent gene expression analysis. Furthermore, morphological characterization via SEM serves as an important complementary tool to validate and compare strains, allowing for a more comprehensive evaluation of biofilm formation capabilities.

2.3. Transcription Levels of Biofilm-Associated Genes in Chicken-Derived ExPEC

The transcriptional profiles of biofilm-associated genes in the three ExPEC strains were analyzed via qPCR (Figure 2). In strain E-39, the expression of flhD, flhC, qseC, tolA, mhpB, fimA, and bdcR was significantly upregulated upon biofilm formation (p < 0.01). Conversely, mhpA and qseB were significantly downregulated (p < 0.05 and p < 0.01, respectively), while LuxS levels remained unchanged (p > 0.05). Strain E-40 exhibited significant upregulation of flhD, flhC, qseC, qseB, tolA, mhpB, mhpA, LuxS, and bdcR (p < 0.01), whereas fimA expression decreased (p < 0.01). For strain E-41, significant increases were observed in flhC, qseB, qseC, tolA, mhpB, mhpA, fimA, and bdcR (p < 0.05); however, LuxS was significantly reduced (p < 0.01), and flhD expression was unaffected (p > 0.05). Despite strain-specific variations, flhC, tolA, qseC, mhpB, and bdcR were consistently upregulated across all three strains (p < 0.05). These findings indicate that while regulatory mechanisms may vary among strains—reflecting genetic heterogeneity—the conserved upregulation of flhC, tolA, qseC, mhpB, and bdcR suggests these genes play a fundamental role in ExPEC biofilm formation.

2.4. Transcript Levels of Virulence-Related Genes in Chicken-Derived ExPEC

The virulence gene expression profiles of ExPEC strains following biofilm formation were quantified via qPCR (Figure 3). In strain E-39 (Figure 3A), Irp2 and Stb were undetectable. Significant downregulation was observed for OmpC, BcsA, fyuA, Sta, cvaC, and HlyE (p < 0.01), while BcsB and OmpA levels remained unaltered (p > 0.05). Conversely, the expression of eaeA, YqeH, LT, fimC, fimH, OmpF, and iss was significantly upregulated (p < 0.01). For strain E-40 (Figure 3B), significant downregulation occurred in yqeH, BcsB, Irp2, Stb, Sta, fimC, and HlyE (p < 0.01). In contrast, OmpA, OmpC, OmpF, BcsA, fyuA, LT, eaeA, fimH, iss, and cvaC were significantly upregulated (p < 0.01). Strain E-41 (Figure 3C) exhibited significant repression of OmpC, OmpA, Sta, Stb, and fyuA (p < 0.01), whereas OmpF, yqeH, BcsB, BcsA, LT, eaeA, fimC, fimH, iss, cvaC, and HlyE were upregulated (p < 0.01). Collectively, biofilm formation induced significant transcriptional shifts across all three strains. Notably, Sta was consistently downregulated, while eaeA, LT, fimH, OmpF, and iss were consistently upregulated in all strains (p < 0.05). Regarding strain-specific variations, Stb expression was absent in E-39 and significantly reduced in both E-40 and E-41. Similarly, Irp2 was undetectable in E-39 and E-41, and significantly downregulated in E-40. These findings highlight distinct, strain-dependent alterations in virulence gene expression. However, the conserved modulation of eaeA, LT, fimH, OmpF, iss, and Sta suggests these genes may function as core virulence determinants associated with the biofilm lifestyle.

3. Discussion

In the present study, we successfully determined the optimal biofilm formation conditions for three chicken-derived ExPEC strains and demonstrated that the biofilm lifestyle significantly alters the transcriptional profile of virulence and regulatory genes. Our primary finding indicates that biofilm formation serves as a critical survival and virulence strategy, characterized by the significant upregulation of genes associated with adhesion (fimH, csgA), serum resistance (iss), and metabolic regulation. These transcriptomic shifts provide a molecular basis for the enhanced pathogenicity and environmental persistence observed in these strains, highlighting the complex regulatory networks linking biofilm formation to bacterial virulence.

The results presented in Table 1 demonstrate distinct optimal biofilm-forming conditions for the three ExPEC strains, with variations observed in culture medium preference and incubation time. This observation is consistent with findings by Daniel W. Nielsen et al., who reported that optimal biofilm-forming conditions for ExPEC isolated from porcine lungs differed according to strain [8]. These phenotypic differences likely stem from the intrinsic genetic heterogeneity and metabolic plasticity characteristic of ExPEC isolates. Different strains may possess distinct regulatory networks that sense and respond to specific environmental cues—such as nutrient availability (e.g., carbohydrates in TSB versus proteins in BHI) and growth phases—in unique ways. In terms of environmental adaptation, this diversity suggests that ExPEC populations maintain a broad ecological valence, allowing specific sub-lineages to efficiently colonize and persist in varied niches, ranging from nutrient-rich host tissues to nutrient-limited abiotic surfaces in poultry farms. Clinically, such variability implies that a ‘one-size-fits-all’ approach to infection control may be ineffective, as standardized disinfection or treatment protocols might not eradicate all biofilm phenotypes. Consequently, the capacity of different strains to thrive under divergent conditions contributes to the persistence of infections and complicates clinical management.

ExPEC strains are capable of causing urinary tract, bloodstream, respiratory, and other extraintestinal infections. In the present study, all three chicken-derived ExPEC strains were strongly positive for biofilm formation and exhibited high survival in serum. The biofilm acts as a physical barrier, protecting bacteria from elimination by the host immune system. This finding aligns with the observed up-regulation of virulence genes (such as iss and ompA) and biofilm regulators (such as fimH and csgA). Biofilm formation is therefore considered an important virulence factor in ExPEC and involves complex regulation at both transcriptional and post-transcriptional levels [9]. However, due to the increased number of bacterial cells in biofilms compared with the planktonic state, the availability of nutrients, oxygen, and other essential factors is often restricted. Previous transcriptomic analyses indicated that, compared with planktonic E. coli in both logarithmic and stationary phases, the expression of 4290 genes was altered in biofilm-forming bacteria, with significant variations observed among strains. These genes primarily encode proteins involved in carbohydrate and energy metabolism, enzymatic activity, and transport systems, as well as proteins of unknown function [10]. Similarly, Bai et al. [11] reported dynamic transcriptional shifts in Listeria monocytogenes biofilms, identifying 893 upregulated and 911 downregulated genes at 12 h, 857 upregulated and 914 downregulated genes at 24 h, and 823 upregulated and 874 downregulated genes at 48 h relative to planktonic controls.

In Gram-negative bacteria, the QseBC two-component regulatory system is composed of the histidine kinase QseC and the response regulator QseB, which sense environmental molecular signals. The inner-membrane QseC sensor detects the signal molecule autoinducer-3 (AI-3), triggering the activation of cytoplasmic QseB, which subsequently regulates bacterial motility and biofilm formation [12]. QseB possesses versatile regulatory functions; notably, it can also bind directly to the promoter region of the flagellar master regulator flhDC. Depending on its phosphorylation state and specific binding sites, QseB can either promote or inhibit target gene transcription [13]. Similarly, QseB can regulate E. coli motility by binding directly to the flhD promoter [14]. Flagella are the primary locomotor organelles in E. coli, mediating adhesion, movement, chemotaxis, and biofilm formation. Flagellar synthesis involves over 50 genes across at least 14 operons, forming a hierarchical regulatory cascade initiated by the flhDC operon [15,16]. Li et al. [17] reported that qseBC deletion in E. coli resulted in a two-fold reduction in biofilm formation, accompanied by the downregulation of biofilm-associated genes (e.g., bcsA, csgA, fliC, motA, wcaF, fimA). They further observed that flhDC knockout compromised both motility and the ability to form biofilms on biomaterial surfaces. In the present study, the transcription levels of the biofilm-related genes flhC, tolA, and qseC were significantly increased in the three chicken-derived ExPEC strains (p < 0.05), indicating that these genes likely play critical roles in the biofilm formation process. The FlhD/FlhC transcriptional activator complex regulates numerous cellular processes in E. coli, and FlhC is known to affect the transcription of other biofilm-related genes. Furthermore, STRING network analysis revealed that bdcR, mhpA, mhpB, tolA, and ytfR were organized into two functional modules: microbial metabolism and transmembrane transporter activity. Specifically, bdcR, mhpA, mhpB, and tolA were identified as part of the microbial metabolism arm, interacting with genes involved in pyruvate metabolism (mhpF, plfB, tdcE, and adhE), the 3-(3-hydroxy) phenylpropionate catabolic process (mhpA, mhpB), acetaldehyde dehydrogenase activity (mhpF, adhE), and biofilm modulation (such as the c-di-GMP-binding biofilm dispersal mediator bdcR). Previous studies have shown that biofilm formation decreased after the knockout of bdcR, a known negative regulator of bdcA. However, mhpA, mhpB, and bdcR knockout mutants still exhibited some degree of cell aggregation. In E. coli, both bdcA and bdcR are upregulated more than 20-fold during the biofilm phase [18]. These results suggest that, consistent with previous findings, the biofilm-associated genes mhpB and bdcR were significantly upregulated in our chicken-derived ExPEC strains (p < 0.05). Collectively, the QseBC system, the FlhDC regulator, and the microbial metabolic module appear to be essential components of E. coli biofilm development. Consequently, the QseBC system and FlhDC regulator may serve as potential targets for disrupting the maintenance of biofilms, while flhC, tolA, qseC, mhpB, and bdcR represent key genes driving biofilm formation.

The transcriptional profile of bacterial virulence genes within the biofilm state is distinct from that observed in planktonic bacteria. Gene expression patterns are dynamic, varying not only among different bacterial strains but also across the specific developmental stages of biofilm formation and maintenance. Furthermore, virulence determinants themselves are integral to the architecture and development of biofilms. It is well-established that ExPEC employs a diverse arsenal of virulence factors and pathogenic mechanisms to induce colibacillosis in poultry. These factors include, but are not limited to, adhesins, invasins, protectins, iron acquisition systems, toxins, two-component regulatory systems, quorum-sensing (QS) mechanisms, transcriptional regulators, secretion systems, and genes associated with metabolism [19]. In the present study, significant transcriptional shifts were observed in the three chicken-derived ExPEC strains following biofilm formation. Specifically, the transcription levels of Sta were significantly reduced (p < 0.05), whereas the levels of eaeA, LT, fimH, OmpF, and iss were significantly upregulated (p < 0.05). The genes Stb, Sta, and LT are directly associated with the production of heat-labile (LT) and heat-stable (ST) enterotoxins, which are the primary causative agents of diarrhea induced by enterotoxigenic E. coli [20]. Notably, strains expressing LT also demonstrate enhanced colonization advantages [21]. The fimH gene encodes the adhesive subunit of type I pili. Type I pili facilitate bacterial attachment and biofilm development, a process that is crucial for both the initial and irreversible adhesion of E. coli to abiotic surfaces [22]. The capacity of E. coli biofilms to adhere to abiotic substrates is a critical trait linked to bacterial virulence. Pathogenic bacteria utilize surface virulence factors, particularly adhesins, to promote this attachment and subsequent biofilm maturation. Indeed, strains exhibiting moderate to strong biofilm-forming capabilities often express high levels of type I pili. Numerous studies on uropathogenic E. coli have confirmed that type I pili promote biofilm formation and play a pivotal role in adhering to the urogenital tract during infection [23]. Additionally, eaeA is located within the Locus of Enterocyte Effacement (LEE) pathogenicity island. The LEE is a 35 kb gene cluster involved in the formation of attaching and effacing (A/E) lesions, thereby initiating adhesion to intestinal epithelial cells and modulating host signal transduction pathways [24]. Mathouthi et al. demonstrated that E. coli mutants with inactivated LEE showed reduced attachment efficiency to abiotic surfaces, suggesting that the LEE operon plays a crucial role in biofilm formation [1]. The serum resistance gene iss, located on the ColV plasmid, is involved in pathogenesis and encodes an outer membrane protein. This protein complexes with OmpF to form a major pore structure related to permeability [25]. These non-specific transport pores facilitate the diffusion of hydrophilic molecules [26], with OmpF and OmpC serving as the two primary porins in E. coli [27]. Consequently, the enhanced pathogenicity of chicken-derived ExPEC following biofilm formation may be attributed to transcriptional alterations in virulence genes such as Sta, eaeA, LT, fimH, OmpF, and iss. Further investigations into the specific roles of biofilm-associated enterotoxins, pili, outer membrane proteins, and the LEE virulence island are warranted.

The four metabolic arm genes—bdcR, mhpA, mhpB, and tolA—interact with other metabolic genes linked to pyruvate metabolism, the 3-(3-hydroxy) propionate catabolic process, and acetaldehyde dehydrogenase activity. These genes are regulated either directly or indirectly via their interaction with the outer membrane porin OmpF [19]. This regulatory interplay suggests a sophisticated mechanism of cross-talk between metabolic flux and membrane permeability, which is essential for bacterial adaptation to environmental stressors. Therefore, the transcription levels of biofilm formation-related and virulence genes of chicken-derived ExPEC interact to regulate biofilm formation and bacterial pathogenicity. The synchronized expression of these factors indicates that biofilm development is not an isolated physiological event but rather a complex, multifactorial process tightly coupled with virulence expression. Based on the transcriptional profiles and functional connectivity observed in this study, we propose that flhC, tolA, qseC, mhpB, bdcR, Sta, eaeA, LT, fimH, OmpF, and iss represent a core set of key determinants. These genes likely function synergistically to drive biofilm maturation and amplify the pathogenic potential of ExPEC, serving as critical biomarkers for identifying hyper-virulent strains.

4. Materials and Methods

4.1. Bacterial Strains

In February 2025, ten chicken-derived ExPEC strains were isolated from the livers of diarrheic adult chickens and dead embryos at a layer chicken farm in Handan, Hebei Province, China. Biofilm-forming capabilities were evaluated using crystal violet staining [8], categorizing the isolates into strong (n = 3; OD > 3 × ODc), moderate (n = 3; 2 × ODc < OD ≤ 3 × ODc), weak (n = 3; ODc < OD ≤ 2 × ODc), and non-biofilm producers (n = 1; OD ≤ ODc). Three strains exhibiting strong biofilm formation (E-39, E-40, and E-41) were selected for further investigation.

4.2. Optimization of the Culture Conditions for Biofilm-Positive Strains of Chicken-Derived ExPEC by Orthogonal Design

To explore the effects of culture medium, culture time, and initial concentration of bacteria on biofilm formation of chicken-derived ExPEC, three factors were selected: culture medium type (BHI, TSB, and MHB; Beijing Solebao Technology Co., Ltd., Beijing, China), culture duration (24, 36, and 48 h), and the initial bacterial inoculum concentration as standardized by optical density (OD₆₀₀ values of 0.2, 0.3, and 0.4) using a microplate reader (BioTek, Winooski, VT, USA). Each factor was represented on three levels, and the orthogonal test was carried out according to L₉ (3³); biofilm formation was detected by crystal violet staining (Beijing Solebao Technology Co., Ltd.). Specifically, the isolated strains were cultured in the specified media until they reached the required OD₆₀₀ thresholds. Subsequently, 200 µL of the standardized bacterial suspension was dispensed into each well of a 96-well cell culture plate (Corning Life Sciences Co., Ltd, Shanghai, China.) and incubated according to the time intervals specified by the L₉ (3³) matrix. Three replicates of all conditions were used, with medium only used as a blank control. Following incubation, the biofilms were fixed with methanol, stained with 0.5% crystal violet, and resolubilized with 33% glacial acetic acid before quantifying the OD₆₀₀ absorbance. The statistical parameters for the orthogonal analysis were calculated as follows: K₁, the average value of level 1; K₂, the average value of level 2; K₃, the average value of level 3; R, the maximum difference among K₁, K₂, and K₃, i.e., the maximum values of K₁, K₂, and K₃ minus the minimum values. The optimal conditions for biofilm formation by the three strains were then determined based on the K and R values.

4.3. Culture of Planktonic Versus Biofilm Chicken-Derived ExPEC Isolates

4.3.1. Culture of Planktonic Chicken-Derived ExPEC Isolates

The three isolates were inoculated into LB medium and grown at 37 °C with shaking at 180 rpm until reaching the logarithmic growth phase (OD₆₀₀ values between 0.4 and 0.6).

4.3.2. Culture of Biofilm Chicken-Derived ExPEC Isolates

The three isolates were inoculated into LB broth and grown at 37 °C with shaking at 180 rpm overnight. Subsequently, the cultures were transferred to the optimized medium and adjusted to the optimal concentrations. Two-milliliter aliquots of the bacterial suspension were dispensed into 6-well cell culture plates containing sterile glass coverslips and incubated for the optimal duration at 37 °C. Planktonic bacteria were removed by washing with PBS, and the biofilms formed on the coverslips were collected using a cell scraper [8].

4.4. Scanning Electron Microscopy (SEM) Observation of Biofilms

Biofilm samples were prepared under the optimal culture conditions of each strain (Section 2.2). Briefly, 2 mL of bacterial suspension (OD₆₀₀ = 0.4) was inoculated into 6-well plates with sterile glass coverslips and cultured as optimized. After incubation, coverslips were rinsed three times with PBS to remove planktonic bacteria and then fixed with 2.5% glutaraldehyde at 4 °C for 2 h. The samples were dehydrated through a graded ethanol series ranging from 30% to 100%. (15 min each), dried by critical point drying with CO₂, and sputter-coated with gold (10–15 nm). Observations were performed using a SEM at 5.0 kV, with images captured at 5000× (WD = 7.9 mm) and 10,000× (WD = 8.0 mm) magnifications. Three random fields were selected per sample for imaging.

4.5. qPCR Analysis of Biofilm-Associated Gene Expression in Planktonic and Biofilm Chicken-Derived ExPEC

Ten pairs of specific primers were designed based on E. coli sequences from GenBank, targeting the flagellar master regulator genes flhD and flhC, the type 1 fimbrial subunit fimA, the S-ribosylhomocysteine lyase LuxS, the histidine kinase qseC, the response regulator qseB, the metabolic genes bdcR and mhpA (flavin monooxygenase), mhpB (extradiol dioxygenase), and the inner membrane protein tolA (

Table 2. List of primer sequences used in qPCR.

Gene Class	Gene	Gene Number	Primer Sequence (5′ → 3′)	Size
The qseBC two-component regulatory system	qseB	945369	F: TTGATAGAAGTCGCCGCCAG R: ACGGCATTACTGGTGACCTC	257
	qseC	947174	F: GTTGATGACGATGCGCTGAC R: ATCATCGTCAGAGAGCTGCG	564
flhDC operon	flhD	945442	F: TTAACATCATTCAGCAAGCG R: GTTGCTGAAACACATTTATGAC	300
	flhC	947280	F: TTGTGGGATAATATCGGCAG R: AAAAGCATTGTTCAGGAAGC	537
fibronectin	fimA	948838	F: AAACTCTGGCAATCGTTGTT R: CATCCGCATTAGCAGCA	513
Quorum sensing	LuxS	947168	F: AGTTCCTGCAACTTCTCTTT R: ATGCCGTTGTTAGATAGCTT	506
Microbial metabolic arm	mhpA	945197	F: CCAATGACCGATGAATTTGG R: GTTTCCATGCGAGGTTAAAG	664
	mhpB	945047	F: GGCTGGATAAGGTGCCAGTT R: CGCTTAACGAGCCAAATCCG	549
	bdcR	948775	F: GCAAAAGTGCTTTTTCACCA R: TAGTTTTTATCGCTTCCCCC	508
	tolA	946625	F: CGAGTTAAAGCAGAAGCAAG R: GATGCGCCATTGTTTTTAGT	651
internal reference	mdh	947854	F: ATCCAGCATACCTTCCAGCG R: GTTGAAGGCGACGGTCAGTA	132

). All primers were synthesized by GENEWIZ (Suzhou, China).

Biofilm-forming ExPEC cells served as the experimental group, while planktonic bacteria were used as the control. Bacterial cells were harvested by centrifugation at 4000 rpm for 10 min at 4 °C. Total RNA was extracted using the Triquick Total RNA Extraction Reagent (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) and reverse-transcribed into cDNA using a reverse transcription kit (Nanjing Novzan, Nanjing, China). The transcription levels of biofilm-associated genes were quantified via SYBR Green qPCR (Nanjing Novzan, Nanjing, China) using the primers listed in Table 1, with mdh serving as the internal reference gene. Relative gene expression was calculated using the 2^−ΔΔCt method, normalizing the biofilm group to the planktonic control.

4.6. qPCR Analysis of the Expression of Virulence-Associated Genes in Planktonic and Biofilm Cultures

The transcription levels of the virulence-associated genes listed in

Table 3. List of primer sequences used in qPCR.

Gene Class	Gene	Gene Number	Primer Sequence (5′ → 3′)	Size
colistin	cvaC	3853541	F: AACGGGAGCTGTTTGTAGCG R: TCAAGAGTGAAGGGTAGGAGGC	118
LEE virulence Island	eaeA	7063868	F: AAAGACCCGACCACGCAGTA R: TTTTCTCGCCGCAATCC	106
The ETT2 virulence island transcriptional regulon	yqeH	945263	F: CGCGTACAAGCAACGAATC R: CAATGTTGGACCGAATGTGA	81
hemolysin	HlyE	945745	F: CCGCAGATGGAGCATTAGAT R: GGCTGCCTGTGAATACTCCTGT	119
outer membrane protein	ompA	945571	F: CGTATGTTGGCTTTGAAATGGG R: CAGGTCGTCAGTGATTGGGTAA	134
	ompF	945554	F: TGGCAGCGAACTACGGTGAA R: TGGTGTAAGCGATGGACGGA	132
	ompC	946716	F: TCGGCGGTTCTATCACTTATG R: CAGTGTAGGTTTCAGCACGGT	129
type I pili	fimC	948843	F: CCCGACACCCTATTACCTGA R: AACCGTGCTTTCGCCCATT	94
	fimH	948847	F: ACCCTGTTTGCTGTACTGCTG R: TTTTGCCCCACATTCACG	146
cellulose synthase genes	BcsA	948053	F: GTAAAACGCCGAACGAAGG R: TACGACGAATCACCGCACAG	105
	BcsB	948045	F: TGCTCAACCTCGAATACACCC R: CACGCCCATCAGTTCATCAT	89
enterotoxin	Stb	12657461	F: GCACTTTTGAAGATTCCCGTCC R: AAGTCTTCGCTTCCGAGTCCTG	95
	Sta	1245309740	F: GCCTCGACATATAACATGATGCAACT R: TCATGTTACCTCCCGTCATGTTGT	108
	LT	39533774	F: CAGATTATCCGTGCTGGCTTAG R: CATCAGGTTTTCGTTGAGGTTC	123
HPI virulence Island	Irp2	12883863	F: AAAATGGCTACCGCCTTACC R: TTCTTCTTCCGCGTTCTCC	104
	fyuA	7156855	F: GCCGTCTTACAGGGACTCACAA R: AACCACCAGCGTGCTTTCGT	126
Serum resistance genes	iss	7324519	F: ACACCAAAGGAAACCATCACTC R: TCTGCACCGCCACAAATT	92
internal reference	mdh	947854	F: ATCCAGCATACCTTCCAGCG R: GTTGAAGGCGACGGTCAGTA	132

were quantified as described above. Seventeen pairs of specific primers were designed based on E. coli sequences available in GenBank (Table 2). The target genes included those encoding outer membrane proteins (ompA, ompC, and ompF), type I fimbriae (fimC, fimH), cellulose synthases (bcsA, bcsB), colicin V (cvaC), the LEE pathogenicity island (eaeA), the ETT2 type III secretion system regulator (yqeH), hemolysin E (HlyE), enterotoxins (LT, Stb, and Sta), the HPI pathogenicity island (fyuA, irp2), and the serum resistance factor (iss). All primers were synthesized by GENEWIZ (Suzhou, China).

4.7. Data Processing

Statistical analyses were performed using IBM SPSS Statistics 20.0. Differences in gene transcription levels were evaluated using one-way analysis of variance (ANOVA). A p value < 0.05 was considered statistically significant.

5. Conclusions

In conclusion, this study demonstrates significant transcriptional reprogramming in chicken-derived ExPEC following biofilm formation. These alterations involve genes critical for both biofilm architecture and bacterial virulence. Specifically, the QseBC two-component system, the flagellar master regulator flhDC, and the identified metabolic modules appear to be essential drivers of E. coli biofilm development. Furthermore, the differential expression of virulence determinants—including eaeA, LT, fimH, ompF, iss, and Sta—suggests a coordinated mechanism that enhances the pathogenic potential of ExPEC within the biofilm state. Thus, elucidating the interplay between biofilm formation and virulence is crucial for understanding pathogenesis and developing effective methods to prevent or eliminate biofilm in the human environment. While this study provides a preliminary analysis of the genetic basis linking biofilm formation to virulence, it establishes a theoretical foundation for future investigations into ExPEC pathogenicity. However, the precise regulatory networks coordinating these genes remain to be fully characterized, warranting further in-depth research to unravel the complexities of E. coli adaptation and persistence.