Next Article in Journal
Analysis of ESAC-Net/EARS-Net Data from 29 EEA Countries for Spatiotemporal Associations Between Antimicrobial Use and Resistance—Implications for Antimicrobial Stewardship?
Next Article in Special Issue
From Farm to Slaughter: Tracing Antimicrobial Resistance in a Poultry Short Food Chain
Previous Article in Journal
Co-Colonization of Non-difficile Clostridial Species in Antibiotic-Associated Diarrhea Caused by Clostridioides difficile
Previous Article in Special Issue
Prevalence of Variant GTRIStaphylococcus aureus Isolated from Dairy Cow Milk Samples in the Alpine Grazing System of the Aosta Valley and Its Association with AMR and Virulence Profiles
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria

by
Wasiu Olawale Salami
1,
Samuel Oluwasegun Ajoseh
1,
Aminat Olajumoke Lawal-Sanni
1,
Ashraf A. Abd El Tawab
2,
Heinrich Neubauer
3,
Gamal Wareth
3,* and
Kabiru Olusegun Akinyemi
1,*
1
Department of Microbiology, Faculty of Science, Lagos State University, Ojo P.O. Box 0001 LASU Post Office, Lagos 102101, Nigeria
2
Department of Bacteriology, Immunology, and Mycology, Faculty of Veterinary Medicine, Benha University, Toukh 13511, Egypt
3
Institute of Bacterial Infections and Zoonoses, Friedrich-Loeffler-Institut, 07743 Jena, Germany
*
Authors to whom correspondence should be addressed.
Antibiotics 2025, 14(4), 398; https://doi.org/10.3390/antibiotics14040398
Submission received: 18 February 2025 / Revised: 8 April 2025 / Accepted: 10 April 2025 / Published: 12 April 2025
(This article belongs to the Special Issue Livestock Antibiotic Use and Resistance)

Abstract

BackgroundEnterococcus species present significant health risks due to their widespread presence in humans, animals, and the environment. This study examined the patterns of antimicrobial resistance (AMR) and the presence of carbapenemase-producing Enterococcus species from various sources. Methods: Between November 2023 and February 2024, 500 samples were collected in Lagos State, including 350 clinical human samples, 50 environmental samples, and 100 animal samples. The samples were processed, and Enterococcus isolates were identified and subjected to antimicrobial susceptibility tests (AST) by standard methods. Furthermore, carbapenemase (blaKPC and oxa-48) and virulence genes (gelE) were detected by real-time polymerase chain reaction (RT-PCR) methods using specific primers. Results: The overall prevalence of Enterococcus isolates was 4.6% (23/500), including 18 E. faecalis and 5 E. faecium. The source prevalence was 24% (12/50) from the environmental samples, 5% (5/100) from animal sources, and 1.7% (6/350) from the clinical samples. All Enterococcus isolates were 100% resistant to ciprofloxacin, erythromycin, imipenem, vancomycin, and ampicillin. However, 91% were susceptible to gentamicin. Six (6) distinct resistance profiles were observed, with the pattern AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-IMI being the most frequent in 12 E. faecalis (4 isolates from humans, 2 from animals, and 6 from the environment). Notably, 39.1% (9/23) of multiple-drug resistant Enterococcus isolates harbored the gelE virulence gene, including seven E. faecalis (five environmental and two human) and two E. faecium from animal sources. The E. faecalis strains HB003 and HB050, from human bacteremia cases carrying gelE, were the first in Nigeria to produce blaKPC and oxa-48 carbapenemase genes. Conclusions: This study revealed the emergence of carbapenemase-producing Enterococcus species in our environment. A one-health approach and further molecular studies are essential to mitigate the spread and understand the transmission dynamics.

1. Introduction

Enterococcus species are non-spore-forming, facultative anaerobes that tolerate various environmental conditions [1]. This adaptability has made the organism part of the commensal flora of almost all terrestrial animals, including mammals, birds, reptiles, insects, farm animals, soil, plants, and aquatic ecosystems [2]. E. faecium and E. faecalis are the two most prevalent Enterococcus commensals in the gastrointestinal and genitourinary tracts, oral cavity, vagina, and skin, posing a significant public health concern to human and animal populations [3]. The intensity of antimicrobial use for different animal species has been reported to be among the crucial factors determining the levels of commensal enterococci resistance [4]. Antimicrobial resistance (AMR) bacteria are known to spread to humans through direct or indirect contact with animals or the consumption of animal products. Resistance genes from commensal Enterococcus strains in food animals may also transfer to human pathogenic bacteria over time, entering the environment and ecosystems through the use of manure as a fertilizer or via wastewater treatment discharges [5]. The diverse reservoir hosts, such as cattle, sheep, and goats, act as significant bio-indicators of environmental pollution with resistant bacteria from various sources [5]. The rise in AMR has been exacerbated by limited antibiotic discovery and inappropriate use (misuse and overuse) of available antibiotics, affecting different classes of drugs [6]. β-lactam drugs constitute roughly 65% of all antibiotics used globally for bacterial infections, encompassing penicillin, cephalosporins, monobactams, and carbapenems [6]. Notably, E. faecalis ranks as the second most commonly detected vancomycin-resistant enterococci (VRE) [7]. In Africa, antibiotics are often used as growth enhancers in livestock, poultry, and aquaculture, and they are commonly added directly to dairy products to prolong their shelf-life [8]. However, significant levels of antimicrobial drug residues in meat intended for human consumption pose a considerable risk for the spread and transmission of AMR bacteria [9]. In Sub-Saharan Africa, antibiotic resistance traits and antibiotic-resistant bacteria are normally transferred to the general public via food, the environment, and farm workers [10]. In Ghana, AMR Enterococcus spp. in livestock and raw meat samples, carrying multiple resistance (tet(M), aph(3′)-III, lsa(A), erm(B), and lnu(B)) and virulence (ebpA, ebpB, cylB, hylB, and srB) genes, including known clones associated with hospital-acquired infections, has been documented [11]. Also, in Nigeria, the transmission of this pathogen through the food chain has contributed to the spread of AMR (tetK, tetL, tetM, tetO, and ermB) and virulence (asa1, gelE, and cylA) genes [12]. Currently, carbapenems are highly effective against numerous bacterial species. They are less susceptible to many β-lactam resistance mechanisms, making them the most dependable last-resort antibiotics for treating bacterial infections. Carbapenems possess a characteristic β-lactam ring structure, which allows them to function by attaching to and deactivating penicillin-binding proteins (PBPs), essential components for constructing the bacterial cell wall [13]. This mechanism of action is a key factor in the potency of carbapenems as antibiotics [14]. Additionally, they have fewer side effects, making them a safer option than other last-line medications [15]. Furthermore, the distinctive molecular structure of carbapenems, which includes a carbapenem linked to a β-lactam ring, provides them with remarkable resistance against many β-lactamase enzymes [16]. Despite Enterococcus species exhibiting intrinsic resistance to many β-lactam antibiotics, carbapenems are an exception within the β-lactam class. Carbapenems are highly effective against Gram-positive and Gram-negative bacteria and offer a broad spectrum of antibacterial activity compared to other β-lactam antibiotics [15]. The emergence and dissemination of carbapenemase-producing bacteria, such as Acinetobacter baumannii, Klebsiella pneumoniae, and Pseudomonas aeruginosa, have raised substantial concerns due to their ability to infect humans and animals (both companion and food-producing) and their presence in environmental reservoirs [17]. The most prevalent carbapenemase genes are blaIMI/NMC-A, blaKPC, blaVIM, blaIMP, and blaOXA-48 [17]. However, carbapenem antibiotics are the most effective antimicrobials for treating infections caused by E. faecium [18]. Therefore, documented reports on carbapenemase-producing Enterococcus species in Africa, including Sub-Saharan countries such as Nigeria, are rare. This study investigated antimicrobial resistance patterns and carbapenemase-producing Enterococcus species in Lagos, Nigeria, from diverse sources.

2. Results

In this study, 23 Enterococcus isolates including 18 E. faecalis and 5 E. faecium were identified, with an overall prevalence of 4.6% (23/500) and source prevalences of 24% (12/50), 5% (5/100), and 1.7% (6/350) from environmental, animal, and clinical samples, respectively. Of the 12 environmental isolates, two strains of E. faecium were isolated from the abattoir effluent and 10 E. faecalis from both the abattoir effluent and the lagoon. Regarding the animal isolates, three strains of E. faecium and two E. faecalis were obtained from ready-to-slaughter cattle, while all six clinical isolates were E. faecalis in this study (Table 1 and Figure 1). However, there was no statistically significant relationship (p > 0.05) between the prevalence of positive Enterococcus spp. and the types of samples analyzed, with a significance level of 0.23. E. faecalis strains were isolated more in females than males, and the age group 19–37 was mainly implicated in this study. A statistically significant difference between age distribution and gender in the positive E. faecalis (p < 0.05) was recorded (Table 1). The antimicrobial susceptibility test (AST) results revealed that all Enterococcus isolates exhibited 100% resistance to ciprofloxacin, erythromycin, imipenem, vancomycin, meropenem, and ampicillin. High resistance levels were also noted for amoxicillin–clavulanic acid 95.7% (22/23), chloramphenicol 87% (20/23), trimethoprim–sulfamethoxazole 78.3% (18/23), and tigecycline 60.9% (14/23), while gentamicin had a lower resistance rate of 8.7% (2/23) (Table 2). E. faecalis and E. faecium isolates from clinical, environmental, and animal sources exhibited 82.6% (19/23) multidrug resistance (MDR). However, 39.1% (9/23) of MDR isolates carried the gelE virulence gene, mostly from environmental and human sources. Carbapenemase genes (blaKPC and blaOXA-48) identified in two E. faecalis strains isolated from human blood (HB003 and HB050) were found in patients with cases of bacteremia. Six resistance profiles (A-F) were observed, with pattern E (AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-FOX-IMI) being the most frequent in E. faecalis from multiple sources. Additionally, unique resistance patterns were noted in a few E. faecalis and E. faecium isolates from animals (Table 3)

3. Discussion

Enterococci, a component of the normal intestinal flora in humans and animals, have become increasingly recognized as pathogens acquired within the community and are a significant cause of nosocomial infections [19]. In this study, the prevalence of E. faecalis from clinical settings is 1.7%, and the source prevalence of this pathogen in urine and blood samples is 1.4% and 0.3%, respectively. No E. faecium was isolated from clinical samples of human origin. This result contrasts with the 82.2% and 17.8% prevalence of E. faecalis and E. faecium reported in clinical samples, respectively, in Italy [20]. Several studies have documented disparate prevalence rates of E. faecalis in clinical specimens across diverse geographical regions. For example, investigations conducted in Pakistan, Tanzania, and Malaysia have reported prevalence rates of 20.8% [21], 15.3% [22], and 11% [23], respectively. The observed discrepancies between our findings and those of previous studies may be attributable to variations in study populations, geographic locations, sample sizes, sample types, isolation techniques, and antibiotic usage patterns [24]. Similar factors have been reported to influence the results of bacterial cultures from clinical samples [25]. Thus, the prevalence of E. faecalis indicates the spread of Enterococci-associated infections in both the community and hospital environment. Interestingly, 1.4% of females exhibited a higher prevalence of E. faecalis than the male subjects in this study. The increasing vulnerability and spread of infections by the female gender has been partly attributed to the proximity of the urethral opening to the bacterially rich vagina and rectum and its shorter distance from the bladder [26]. Additionally, 50% of E. faecalis strains from clinical human samples were isolated from the age group 19–37, making this group at risk of Enterococcal infections. In Winnipeg, Canada, the age group ≥65 years was reported to be at high risk of Enterococcus-associated infections in both women and men [27], and such infections were uncommon in men under 60. However, at age 80, men and women exhibit similar rates [27]. There is no statistically significant difference between age group and gender (p > 0.05) in the positive E. faecalis in clinical samples in this study. This result is at variance with a report from Brazil in which a variation was recorded in the Enterococcal prevalence between adolescents, adults, and gender [28]. Moreover, 12 (24%) Enterococcus isolates were recorded from the environmental samples. The increased prevalence of Enterococcus species in the environment can be attributed to contamination from water bodies and effluent, which are influenced by human activities, sewage discharge, and animal feces. The implication of this is the increasing spread of community-associated Enterococcal infections. These findings are consistent with a previous report that detected 63 Enterococcus species in the final effluent of wastewater treatment plants and downstream environmental waters [29]. This affirms the significance of the Enterococcus species as a reliable indicator for evaluating water quality.
Furthermore, the prevalence of 5% Enterococcus species was recorded in animal samples. This result is low compared to the 42.8% prevalence reported in a study conducted in Nigeria on cattle and poultry animals [12]. A 34% prevalence was recorded in a study conducted in Egypt on the milk of cattle and buffalo [30]. The variation could be attributed to host-related factors, such as diet, which can influence the composition of commensal bacteria in the animal gut [30]. This may account for the observed differences in the distribution of Enterococcus species recorded. The detection of E. faecalis and E. faecium in animal samples holds significance, as these species are the most predominant among Enterococci-causing human infections [3] and could be a major contributor to animal mortality. The consequence of this finding is the possibility of continuous zoonotic transmission of Enterococcus species in our environment.
In Nigeria, antibiotic use both in animal and human medicine, and factors such as uncontrolled use of antibiotics in the form of over-the-counter purchase and street hawking of drugs, all have a role in the emergence, persistence, and spread of antibiotic resistance (Akinyemi and Fakorede, 2018) [31]. Also, the improper use of antibiotics usually leaves antibiotic residues in animal-derived products and the environment, thus heightening the risk of resistant bacterial transmission along the food chain (Ayukekbong et al., 2016) [9]. The result of the antibiotic susceptibility test conducted consistently indicated that 100% of Enterococcus species were resistant to several antibiotics, namely ciprofloxacin, erythromycin, imipenem, vancomycin, meropenem, and ampicillin. Also, all the 23 Enterococcus isolates unveiled resistance to vancomycin. This result is consistent with the findings from South Africa, where over 95% of the Enterococcus species were vancomycin-resistant [32], and in Iran, where vancomycin-resistant Enterococcus species were high in children [33]. In contrast, a study reported a low resistance rate (3.3%) to these antibiotics in Turkey [34].
Furthermore, the study also revealed 100% resistance to ampicillin. This resistance rate is relatively higher than the 46% reported from Jimma, Ethiopia [23]. Interestingly, there was also a high resistance rate to chloramphenicol and tigecycline, which aligns with a study from Tanzania [22] and is in contrast to a study conducted in Kenya, where Enterococcus species were 100% susceptible to tigecycline [35]. It was observed that Enterococcus isolates were 100% resistant to carbapenem antibiotics (imipenem and meropenem). Carbapenems are potent antibiotics used primarily for multidrug-resistant (MDR) infections. Although these antibiotics are often unavailable in hospitals in developed African countries due to high costs, studies reveal the emergence of carbapenem-resistant bacteria (CRB) in Sub-Saharan Africa (SSA) [36,37]. This result corroborated a study conducted in Denmark in 2007, where two of the isolates from the blood of patients with bacteremia were resistant to imipenem [38]. Furthermore, this study revealed a high resistance rate of E. faecalis and E. faecium to ciprofloxacin. Similar reported cases of ciprofloxacin resistance in E. faecalis and E. faecium from poultry occurred in Korea [39]. All Enterococcus isolates were MDR. They developed resistance to different antimicrobials from three to five distinct classes.
The high prevalence of MDR isolates observed in this study reflects the widespread use of broad-spectrum antibiotics. These findings align with other research conducted in Nigeria, which indicates that E. faecalis and E. faecium present significant concerns due to their ability to develop resistance to various antibiotics, including vancomycin and other commonly used therapeutic agents [40,41]. Interestingly, the observed MDR pattern is consistent with a study in India involving Enterococcus species isolated from animals, humans, and food sources [42]. These MDR strains pose a significant public health risk, particularly considering that the same class of antibiotics is commonly used to treat various bacterial infections in humans and animals. Interestingly, there was a high susceptibility to gentamicin; only 8.7% of the isolates developed resistance. This finding is slightly similar to the lower prevalence of 21% E. faecalis and 35% E. faecium isolates that developed resistance to gentamicin in Iran [43]. This situation might be associated with the judicious use of gentamicin antibiotics, which prevent the development and spread of resistant bacteria. This study suggests that gentamicin could be used instead of vancomycin as an alternative antibiotic for patients with Enterococcus-associated diseases. However, Enterococci have restricted permeability to aminoglycosides, and the antibiotics needed to eradicate the bacteria effectively are often too high to administer to humans safely [44]. In this study, all Enterococcus isolates exhibited six resistance patterns with pattern E, with AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-IMI being the most frequently encountered in 47% of the Enterococcus species isolated. In this study, 41.7% of Enterococcal isolates from the environment harbored a virulence gene (gelE). This virulence determinant (gelE) produced by E. faecalis is known to degrade host proteins and weaken immune defenses through complement inactivation, thus aiding bacterial spread and survival [45]. This gene may influence its pathogenicity, biofilm formation, and antibiotic resistance, making it a crucial factor in clinical infections and environmental persistence. Nonetheless, 43.8% (7/16) of E. faecalis strains from clinical and environmental isolates were found to carry the gelE virulence gene.
Additionally, 66.7% (2/3) of E. faecium strains from animal isolates exhibited this gene. This percentage is lower than the 84% reported in Cairo, Egypt, from clinical isolates [23,46]. This variation in prevalence rates may be partly attributed to differences in the distribution of virulent strains in different geographical areas. Notably, the transfer of virulence genes is interconnected among the sources. It can play a role in the emergence and spread of bacterial antibiotic resistance, affecting human populations, animals, and the environment [3,46].
Interestingly, the E. faecalis strains HB003 and HB050 carrying the virulence gene gelE, isolated from cases of bacteremia, were found to produce carbapenemase genes blaKPC and oxa-48. This finding was further corroborated by a report from Munita and Arias [47], which showed that Enterococcus species can acquire carbapenemase genes, such as blaKPC, blaNDM, blaOXA, and blaVIM, through horizontal gene transfer. Notwithstanding, these mechanisms have the unintended consequence of perpetuating the multidrug resistance crisis by facilitating the rapid dissemination of resistance genes, not only within Enterococcus strains but also across interspecies boundaries [48]. This phenomenon has profound implications for clinical practice, as it severely constrains therapeutic options and presents a formidable challenge in the management of infectious diseases in clinical settings [48]. The detection of these gene markers in E. faecalis strains indicates the potential for cross-species transmission and the emergence of carbapenemase-producing E. faecalis [3,48]. These findings highlight the challenges in treating infections caused by Enterococcus strains that harbor resistance genes and emphasize the importance of infection control measures in humans and animals [48]. Moreover, this study revealed the dominance of E. faecalis strains as vectors of carbapenemase genes (blaKPC and blaoxa-48) in Nigerian clinical settings, a previously unreported phenomenon. This finding has significant implications for the management of Enterococcus-associated infections, potentially limiting the therapeutic options. The study’s limitations include a modest sample size and geographically restricted focus on Lagos, Nigeria, which may compromise generalizability. Future research should aim to include larger, more diverse populations and employ advanced methodologies, such as whole-genome sequencing, to elucidate the evolutionary dynamics of these resistance-resistant genes.

4. Materials and Methods

4.1. Study Design, Place, and Duration of Study

A cross-sectional study was conducted from November 2023 to February 2024 involving 500 samples: 350 from patients at Lagos State University Teaching Hospital (LASUTH) and Badagry General Hospital (BGH), 50 environmental samples (effluent) from Maza-Maza lagoon and Oto-Awori, and 100 cow rectal and nasal swab samples from Oko-Oba and Oto-Awori abattoirs.
The study included clinical samples primarily from patients at the two main referral hospitals (LASUTH and BGH), focusing on those with specific conditions such as chronic orthopedic and post-surgical wound infections, urinary tract infections, chronic skin infections, chronic respiratory diseases, ventilator-associated pneumonia, and cardio-pulmonary diseases. The patients cut across all age groups and had been hospitalized for at least two weeks. Environmental samples were collected exclusively from Maza-Maza lagoon and Oto-Awori. Samples of animal origin were collected only from rectal and nasal swabs of cattle.
The study excluded clinical samples from outpatients and those who did not exhibit the symptoms specified in the inclusion criteria. Patients with a hospital stay of less than two weeks were also excluded. Environmental samples were collected from areas outside the designated study area, and food-animal samples not collected from the cloaca/rectal area, particularly those not within the study area, were not included in this study.

4.2. Sample Size and Sampling

The sample size for the clinical samples was obtained using the following formula
n = (Z2 × P × q)/d2
  • where P = prevalence of the previous study, 73% = 0.73 [41].
  • where n= number of samples to be collected.
  • where q = 1 − P (proportion of the population without the characteristic).
  • Z = confidence level at 95% (standard value of 1.96).
  • d = margin of error at 5% (standard value of 0.05).
  • P = prevalence rate.
  • q = 1 − P = 1 − 0.73 = 0.27.
  • d = allowable error = 5%.
  • Z = standard normal distribution at 95% CI = 1.96.
  • n = (1.962 × 0.059 × 0.27)/0.052.
  • n = 65.
However, 350 clinical samples were collected from the hospitals used, comprising 150 blood samples, 100 urine samples, 50 wound swabs, and 50 sputum samples. Specifically, the 100 animal samples consisted of 50 cattle rectal swabs and 50 nasal swabs. Also, 50 environmental samples were made up of 25 abattoir effluent and Lagoon water samples.

4.3. Bacterial Isolation and Identification

Approximately 5 mL blood samples were collected from patients exhibiting clinical symptoms of chronic septicemia and placed in a sterile container with 50 mL of thioglycolate broth, using a blood-to-broth ratio of 1:10. Blood culture bottles were incubated at 37 °C and examined daily after 48 h for five consecutive days. The presence of turbidity, hemolysis, gas formation, or color changes indicated microbial growth. If no growth was observed within 7 days, the result was reported as negative. When visible growth appeared, a small quantity of broth was aseptically taken and subcultured on Bile-esculin azide agar (BEAA) (Tintan media, Rajasthan, India) from Hardy Diagnostics. Urine samples were inoculated on BEAA media using a 10 mL calibrated loop and incubated at 37 °C for 24 h. The presence of 104 colony-forming units per mL of bacteria with black-colored colonies indicated significant Enterococci in the urine. Other clinical samples were directly inoculated on BEAA and incubated at 37 °C for 24 h, checking for the growth of black-colored colonies.
The membrane filtration methods were used to isolate Enterococcus species from environmental water and effluent samples [49]. One-hundred mL of water were filtered through a 0.45 μm-sized membrane filter. The water flow was facilitated using an air vacuum pump attached to a conical flask to collect the unwanted filtered water. The filter paper was placed on the surface of differential media BEAA (Tintan media, Rajasthan, India), plates were incubated at 37 °C for 24 h, and colonies were selected according to their shape, size, and color.
Animal samples were introduced into Todd Hewitt broth and incubated at 37 °C for 24 h under aerobic conditions. Following this, the broth was cultured onto BEAA (Tintan media, Rajasthan, India) and subjected to aerobic incubation at 37 °C for an additional 24 h [50]. Subsequently, the visible colonies were visually inspected for color, size, and shape. Confirmation of Enterococci presence involved additional tests such as Gram stain, catalase reaction, growth on broth containing 6.5% NaCl, and growth in BHI broth at 37 °C and 45 °C for 48 h [51].

4.4. Antimicrobial Susceptibility Testing (AST)

The antimicrobial susceptibility of the isolates was determined using the Kirby–Bauer disk-diffusion method. Antibiotic discs (Mast Diagnostics, Merseyside, UK) were dispensed onto Muller–Hinton agar using an automated disc dispenser. The following antibiotic discs were used: clindamycin (2 μg), imipenem (10 μg), ciprofloxacin (15 μg), vancomycin (30 μg), amoxicillin–clavulanic acid (10 μg), cefoxitin (30 μg), ampicillin (10 μg), ceftriaxone (30 μg), ceftazidime (30 μg), meropenem (10 μg), and gentamycin (30 μg). Strains showing intermediate resistance were considered susceptible dose dependent according to the Clinical and Laboratory Standards Institute (CLSI) guidelines [52]. Where VET01S breakpoints were unavailable, human breakpoints were applied. The diameter zones of inhibition were interpreted as the performance standards outlined in the guideline. The control strain used for testing was E. coli ATCC 25922. Multidrug resistance (MDR) in this study was defined as resistance to 3 or more antimicrobial classes. The resistance index was calculated as the ratio of the number of antibiotics resistant to the total number of antibiotics used.

4.5. Phenotypic Detection of Carbapenemase-Producing Enterococcus Species

Enterococcus species that developed resistance to imipenem and meropenem according to CLSI guidelines [52] were subjected to the Modified Hodge test [53]. In brief, a 0.5 McFarland standard of E. coli ATCC 25,922 suspensions were prepared in 5 mL of saline. A 1:10 dilution (0.5 mL of suspension at 4.5 mL of saline) was streaked as a lawn onto Muller–Hinton Agar (MHA) plate and dried for about 3–10 min. A disc of 10 mcg meropenem was placed at the center of the inoculated MHA plate. The test organism was streaked in a straight line from the edge of the disc to the edge of the plate. It was incubated at 37 °C for 24 h. An enhanced growth formation of a clover leaf-like pattern indicates a positive carbapenemase production [53].

4.6. DNA Extraction, Resistance, and Virulence Gene Detection

DNA was extracted from bacterial colonies grown on bile–esculin agar using bacterial lysis buffer and heat treatment. These were carried out using the Luna Universal qPCR protocol (New England BioLabs), following the manufacturer’s instructions. The process involved mechanical disruption using a bead beater for 25 min, followed by centrifugation of the ZR Bashing Bead Lysis Tube at 10,000× g for 1 min. β-Mercaptoethanol was added to the Genomic Lysis Buffer (final dilution: 0.5%) for enhanced performance. Pure Enterococcus isolate cells were placed into the lysis tube with the Bashing Bead Buffer and centrifuged at high speed for 15 min. The supernatant was filtered through a Zymo-Spin II-F Filter (Zymo Research, Irvine, CA, USA, 8000× g, 1 min) and underwent several washing and centrifugation steps with a Zymo-Spin ICR Column. The DNA was then eluted by adding DNA Elution Buffer to the column and centrifuging at 10,000× g for 3 s, resulting in ultra-pure DNA. The supernatant containing the extracted DNA was collected and stored at −20 °C. The RT-PCR Rotor-Gene Q 2plex (Qiagen, Hilden, Germany) amplification was performed using specific primer sets for resistance (blaSHV, blaTEM, blaKPC, blaoxa-48, and blaImp) and virulence (esp and gelE) genes (Table 4), with PCR mixtures prepared using specific volumes and concentrations. The PCR process entailed 45 cycles, each consisting of a denaturation phase at 95 °C for 30 s, followed by an annealing step at 50 °C for 30 s, and concluding with an extension at 72 °C for 60 s [54].

4.7. Statistical Analysis

In this study, the data collected were input into a computer and analyzed using IBM SPSS version 20. Frequency tables were created, and the relationships between the variables were analyzed using the Chi-square test or t-test, with a significance level set at p < 0.05.

5. Conclusions

This study revealed the prevalence of MDR and the emergence of carbapenemase-producing Enterococcus species in our environment. It also revealed E. faecalis strains carrying carbapenemase genes blaKPC and oxa-48 from bacteremia cases. Enterococcus isolates were found to exhibit heterogeneous resistance profiles. Gentamicin antibiotic was 91% effective on Enterococcus isolates and may be used for the treatment of Enterococcus-associated diseases when indicated. The findings indicated the significance of screening for antibiotic resistance among Enterococcus from diverse sources. Further investigation into their resistance mechanisms and origins from a One Health perspective is essential.

Author Contributions

Conceptualization, K.O.A. and G.W; methodology, W.O.S., S.O.A. and A.O.L.-S.; validation, K.O.A., A.A.A.E.T., G.W. and H.N.; formal analysis, W.O.S.; investigation, W.O.S. and S.O.A.; resources, K.O.A., G.W., H.N., A.A.A.E.T. and W.O.S.; data curation, K.O.A., A.A.A.E.T., G.W., H.N., A.O.L.-S. and W.O.S.; writing—original draft preparation, W.O.S.; writing—review and editing, K.O.A., H.N. and G.W.; visualization, W.O.S.; supervision, K.O.A.; project administration, K.O.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The ethical approval for sample collection was granted by the Lagos State Teaching Ethics Committee, with Ref No: LREC/06/10/2310. Nagoya approval to transfer and use the biological material was obtained from the Ministry of Environment of the Federal Republic of Nigeria.

Informed Consent Statement

The consent of the patients was sought.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

We are grateful to the Alexander von Humboldt Foundation (AvH, Bonn, Germany) for providing a grant for the equipment used in this work. We are equally thankful to all the staff and management of the different hospitals included in this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bondi, M.; Laukova, A.; de Niederhausern, S.; Messi, P.; Papadopoulou, C.; Economou, V. Controversial aspects displayed by enterococci: Probiotics or pathogens? Biomed. Res. Int. 2020, 2020, 3. [Google Scholar] [CrossRef]
  2. Dubin, K.; Pamer, E.G. Enterococci and their interactions with the intestinal microbiome. Microbiol. Spectr. 2017, 5, 10–128. [Google Scholar] [CrossRef] [PubMed]
  3. Kommineni, S.; Kristich, C.J.; Salzma, N.H. Harnessing bacteriocin biology as targeted therapy in the GI tract. Gut Microbes 2016, 7, 512–517. [Google Scholar] [CrossRef] [PubMed]
  4. Makarov, D.A.; Ivanova, O.E.; Pomazkova, A.V.; Egoreva, M.A.; Prasolova, O.V.; Lenev, S.V.; Gergel, M.A.; Bukova, N.K.; Karabanov, S.Y. Antimicrobial resistance of commensal Enterococcus faecalis and Enterococcus faecium from food-producing animals in Russia. Veter World 2022, 15, 611–621. [Google Scholar] [CrossRef]
  5. Stępień-Pyśniak, D.; Hauschild, T.; Nowaczek, A.; Marek, A.; Dec, M. Wild birds as a potential source of known and novel multilocus sequence types of antibiotic-resistant Enterococcus faecalis. J. Wildl. Dis. 2018, 54, 219–228. [Google Scholar] [CrossRef]
  6. WHO. Antibiotic Resistance. 2020. Available online: https://www.who.int/news-room/fact-sheets/detail/antibiotic-resistance (accessed on 21 November 2023).
  7. Zhao, Y.-C.; Sun, Z.-H.; Li, J.-K.; Liu, H.-Y.; Cai, H.-L.; Cao, W.; Yu, F.; Zhang, B.-K.; Yan, M. Exploring the causes of the prevalence of vancomycin-resistant Enterococcus faecalis. Environ. Sci. Eur. 2024, 36, 92. [Google Scholar] [CrossRef]
  8. Vikesland, P.; Garner, E.; Gupta, S.; Kang, S.; Maile-Moskowitz, A.; Zhu, N. Differential Drivers of Antimicrobial Resistance across the World. Accounts Chem. Res. 2019, 52, 916–924. [Google Scholar] [CrossRef]
  9. Ayukekbong, J.A.; Ntemgwa, M.; Atabe, A.N. The threat of antimicrobial resistance in developing countries: Causes and control strategies. Antimicrob. Resist. Infect. Control. 2017, 6, 1–8. [Google Scholar] [CrossRef] [PubMed]
  10. Kariuki, S.; Dougan, G. Antibacterial resistance in sub-Saharan Africa: An underestimated emergency. Ann. N. Y. Acad. Sci. 2014, 1323, 43–55. [Google Scholar] [CrossRef]
  11. Amuasi, G.R.; Dsani, E.; Owusu-Nyantakyi, C.; Owusu, F.A.; Mohktar, Q.; Nilsson, P.; Adu, B.; Hendriksen, R.S.; Egyir, B. Enterococcus species: Insights into antimicrobial resistance and whole-genome features of isolates recovered from livestock and raw meat in Ghana. Front. Microbiol. 2023, 14, 1254896. [Google Scholar] [CrossRef]
  12. Ngbede, E.O.; Raji, M.A.; Kwanashie, C.N.; Kwaga, J.K.P. Antimicrobial resistance and virulence profile of enterococci isolated from poultry and cattle sources in Nigeria. Trop. Anim. Health Prod. 2016, 49, 451–458. [Google Scholar] [CrossRef]
  13. Saxena, D.; Maitra, R.; Bormon, R.; Czekanska, M.; Meiers, J.; Titz, A.; Verma, S.; Chopra, S. Tackling the outer membrane: Facilitating compound entry into Gram-negative bacterial pathogens. NPJ Antimicrob. Resist. 2023, 1, 17. [Google Scholar] [CrossRef] [PubMed]
  14. Aurilio, C.; Sansone, P.; Barbarisi, M.; Pota, V.; Giaccari, L.G.; Coppolino, F.; Barbarisi, A.; Passavanti, M.B.; Pace, M.C. Mechanisms of Action of Carbapenem Resistance. Antibiotics 2022, 11, 421. [Google Scholar] [CrossRef]
  15. Meletis, G. Carbapenem resistance: Overview of the problem and future perspectives. Ther. Adv. Infect. Dis. 2016, 3, 15–21. [Google Scholar] [CrossRef]
  16. Elshamy, A.A.; Aboshanab, K.M. A Review on Bacterial Resistance to Carbapenems: Epidemiology, Detection and Treatment Options. Future Sci. OA 2020, 6, 3. [Google Scholar] [CrossRef] [PubMed]
  17. Mó, I.; da Silva, G.J. Tackling Carbapenem Resistance and the Imperative for One Health Strategies—Insights from the Portuguese Perspective. Antibiotics 2024, 13, 557. [Google Scholar] [CrossRef] [PubMed]
  18. Mancuso, G.; Midiri, A.; Gerace, E.; Biondo, C. Bacterial Antibiotic Resistance: The Most Critical Pathogens. Pathogens 2021, 10, 1310. [Google Scholar] [CrossRef]
  19. Wada, Y.; Harun, A.; Yean, C.; Nasir, N.M.; Zaidah, A. Vancomycin-resistant enterococcus, obesity, and antibiotics: Is there a possible link? Obes. Med. 2020, 18, 100226. [Google Scholar] [CrossRef]
  20. Boccella, M.; Santella, B.; Pagliano, P.; De Filippis, A.; Casolaro, V.; Galdiero, M.; Borrelli, A.; Capunzo, M.; Boccia, G.; Franci, G. Prevalence and antimicrobial resistance of Enterococcus species: A retrospective cohort study in Italy. Antibiotics 2021, 10, 1552. [Google Scholar] [CrossRef]
  21. Gul, Z.; Jan, A.Z.; Liaqat, F.; Qureshi, M.S. Causative organisms and antimicrobial sensitivity pattern of pediatric urinary tract infections. Gomal J. Med. Sci. 2015, 13, 118–122. [Google Scholar]
  22. Aamodt, H.; Mohn, S.C.; Maselle, S.; Manji, K.P.; Willems, R.; Jureen, R.; Langeland, N.; Blomberg, B. Genetic relatedness and risk factor analysis of ampicillin-resistant and high-level gentamicin-resistant enterococci causing bloodstream infections in Tanzanian children. BMC Infect. Dis. 2015, 15, 107. [Google Scholar] [CrossRef]
  23. Nor, N.S.M.; Abu, N.A.; Rashid, M.A.; Ismail, M.; Razak, R. Bacterial pathogens and antibiotic resistance patterns in children with urinary tract infection in a Malaysian tertiary hospital. Med. J. Malays 2015, 70, 153–157. [Google Scholar]
  24. Orababa, O.Q.; Soriwei, J.D.; Akinsuyi, S.O.; Essiet, U.U.; Solesi, O.M. A systematic review and meta-analysis on the prevalence of vancomycin-resistant enterococci (VRE) among Nigerians. Porto Biomed. J. 2021, 6, e125. [Google Scholar] [CrossRef]
  25. Ferede, Z.T.; Tullu, K.D.; Derese, S.G.; Yeshanew, A.G. Prevalence and antimicrobial susceptibility pattern of Enterococcus species isolated from different clinical samples at Black Lion Specialized Teaching Hospital, Addis Ababa, Ethiopia. BMC Res. Notes 2018, 11, 793. [Google Scholar] [CrossRef] [PubMed]
  26. Czajkowski, K.; Broś-Konopielko, M.; Teliga-Czajkowska, J. Urinary tract infection in women. Menopause Rev./Przegląd Menopauzalny 2021, 20, 40–47. [Google Scholar] [CrossRef]
  27. Schaeffer, A.J.; Nicolle, L.E. Urinary tract infections in older men. N. Engl. J. Med. 2016, 374, 562–571. [Google Scholar] [CrossRef] [PubMed]
  28. Komiyama, E.Y.; Lepesqueur, L.S.S.; Yassuda, C.G.; Samaranayake, L.P.; Parahitiyawa, N.B.; Balducci, I.; Koga-Ito, C.Y. Enterococcus species in the oral cavity: Prevalence, virulence factors, and antimicrobial susceptibility. PLoS ONE 2016, 11, e0163001. [Google Scholar] [CrossRef]
  29. Molale-Tom, L.; Bezuidenhout, C. Prevalence, antibiotic resistance and virulence of Enterococcus spp. from wastewater treatment plant effluent and receiving waters in South Africa. J. Water Health 2020, 18, 753–765. [Google Scholar] [CrossRef]
  30. Ahmed, W.; Neubauer, H.; Tomaso, H.; El Hofy, F.I.; Monecke, S.; Abd El-Tawab, A.A.; Hotzel, H. Characterization of enterococci-and ESBL-producing Escherichia coli isolated from milk of bovides with mastitis in Egypt. Pathogens 2021, 10, 97. [Google Scholar] [CrossRef]
  31. Akinyemi, K.O.; Fakorede, C.O. Antimicrobial resistance and resistance genes in salmonella enterica serovars from Nigeria. In Salmonella enterica: Molecular Characterization, Role in Infectious Diseases and Emerging Research; van Doleweerd, F., Ed.; Nova Science Publisher: Hauppauge, NY, USA, 2018; pp. 103–124. ISBN 978-1-53613-084-3. [Google Scholar]
  32. Iweriebor, B.C.; Obi, L.C.; Okoh, A.I. Macrolide, glycopeptide resistance, and virulence genes in Enterococcus species isolates from dairy cattle. J. Med. Microbiol. 2016, 65, 641–648. [Google Scholar] [CrossRef]
  33. Sabouni, F.; Movahedi, Z.; Mahmoudi, S.; Pourakbari, B.; Valian, S.K.; Mamishi, S. High frequency of vancomycin-resistant Enterococcus faecalis in children: An alarming concern. J. Prev. Med. Hyg. 2016, 57, E201. [Google Scholar] [PubMed Central]
  34. Kara, A.; Devrim, İ.; Bayram, N.; Katipoğlu, N.; Kıran, E.; Oruç, Y.; Demiray, N.; Apab, H.; Gülfidan, G. Risk of vancomycin-resistant enterococci bloodstream infection among patients colonized with vancomycin-resistant enterococci. Braz. J. Infect. Dis. 2015, 19, 58–61. [Google Scholar] [CrossRef] [PubMed]
  35. Georges, M.; Odoyo, E.; Matano, D.; Tiria, F.; Kyany’a, C.; Mbwika, D.; Mutai, W.C.; Musila, L. Determination of Enterococcus faecalis and Enterococcus faecium antimicrobial resistance and virulence factors and their association with clinical and demographic factors in Kenya. J. Pathog. 2022, 2022, 3129439. [Google Scholar] [CrossRef] [PubMed]
  36. Njeru, J. Emerging carbapenem resistance in ESKAPE pathogens in sub-Saharan Africa and the way forward. Ger. J. Microbiol. 2021, 1, 3–6. [Google Scholar] [CrossRef]
  37. Masoud, S.S.; Njakoi, G.N.; Sholla, S.; Renatus, D.; Majigo, M.; Gangji, R.R.; Nyawale, H.; Mawazo, A.; Msafiri, F.; Ntukula, A.; et al. Carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii in Tanzania. Ger. J. Microbiol. 2024, 4, 1–9. [Google Scholar] [CrossRef]
  38. Guardabassi, L.; Larsen, J.; Skov, R.; Schønheyder, H.C. Gentamicin-resistant Enterococcus faecalis sequence type 6 with reduced penicillin susceptibility: Diagnostic and therapeutic implications. J. Clin. Microbiol. 2010, 48, 3820–3821. [Google Scholar] [CrossRef]
  39. Kim, Y.B.; Seo, H.J.; Seo, K.W.; Jeon, H.Y.; Kim, D.K.; Kim, S.W.; Lim, S.-K.; Lee, Y.J. Characteristics of high-level ciprofloxacin-resistant Enterococcus faecalis and Enterococcus faecium from retail chicken meat in Korea. J. Food Prot. 2018, 81, 1357–1363. [Google Scholar] [CrossRef]
  40. Raji, M.A.; Jamal, W.; Ojemhen, O.; Rotimi, V.O. Point-surveillance of antibiotic resistance in Enterobacteriaceae isolates from patients in a Lagos Teaching Hospital, Nigeria. J. Infect. Public Health 2013, 6, 431–437. [Google Scholar] [CrossRef]
  41. Adesida, S.A.; Oluwatosin, Q.O.; Rebecca, F.P.; Bamidele, T.O.; Ajoke, O.A.; Titilayo, O.S. Distribution and Evaluation of Multiple Antibiotic Resistance (MAR) Index of Clinical Isolates of Enterococcus species in Lagos, Nigeria. Acta Microbiol. Bulg. 2022, 38, 301–308. [Google Scholar]
  42. Deka, J.; Ahmed, G. Antimicrobial resistance in Escherichia coli isolates collected from poultry meat: An epidemiological surveillance study from Guwahati city. Proc. Zool. Soc. 2022, 75, 31–38. [Google Scholar] [CrossRef]
  43. Zavaryani, S.M.; Mirnejad, R.; Piranfar, V.; Moghaddam, M.M.; Sajjadi, N.; Saeedi, S. Assessment of susceptibility to five common antibiotics and their resistance pattern in clinical Enterococcus isolates. Iran J. Pathol. 2020, 15, 96–105. [Google Scholar] [CrossRef] [PubMed][Green Version]
  44. Terentjeva, M.; Ķibilds, J.; Avsejenko, J.; Cīrulis, A.; Labecka, L.; Bērziņš, A. Antimicrobial Resistance in Enterococcus spp. Isolates from Red Foxes (Vulpes vulpes) in Latvia. Antibiotics 2024, 13, 114. [Google Scholar] [CrossRef] [PubMed]
  45. Waters, C.M.; Antiporta, M.H.; Murray, B.E.; Dunny, G.M. Role of the Enterococcus faecalis GelE Protease in Determination of Cellular Chain Length, Supernatant Pheromone Levels, and Degradation of Fibrin and Misfolded Surface Proteins. J. Bacteriol. 2003, 185, 3613–3623. [Google Scholar] [CrossRef]
  46. Hashem, Y.A.; Yassin, A.; Amin, M. Molecular characterization of Enterococcus spp. Clinical isolates from Cairo, Egypt. Ind. J. Med. Microbiol. 2015, 33, S80–S88. [Google Scholar] [CrossRef]
  47. Munita, J.M.; Arias, C.A. Mechanisms of antibiotic resistance. In Virulence Mechanisms of Bacterial Pathogens; Wiley: Hoboken, NJ, USA, 2016; pp. 481–511. [Google Scholar] [CrossRef]
  48. Ahmed, S.K.; Hussein, S.; Qurbani, K.; Ibrahim, R.H.; Fareeq, A.; Mahmood, K.; Mohamed, M.G. Antimicrobial resistance: Impacts, challenges, and future prospects. J. Med. Surg. Public Health 2024, 2, 100081. [Google Scholar] [CrossRef]
  49. Lata, P.; Ram, S.; Agrawal, M.; Shanker, R. Enterococci in river Ganga surface waters: The propensity of species distribution, dissemination of antimicrobial-resistance and virulence-markers among species along the landscape. BMC Microbiol. 2009, 9, 140. [Google Scholar] [CrossRef]
  50. Facklam, R.; Elliott, J.A. Identification, classification, and clinical relevance of catalase-negative, gram-positive cocci, excluding the streptococci and enterococci. Clin. Microbiol. Rev. 1995, 8, 479–495. [Google Scholar] [CrossRef] [PubMed]
  51. Vandepitte, J. Basic Laboratory Procedures in Clinical Bacteriology; World Health Organization: Geneva, Switzerland, 2003. [Google Scholar]
  52. CLSI. CLSI: Performance Standards for Antimicrobial Susceptibility Testing, 32nd ed.; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2022; Volume 256. [Google Scholar]
  53. Amjad, A.; Mirza, I.A.; Abbasi, S.; Farwa, U.; Malik, N.; Zia, F. Modified Hodge test: A simple and effective test for detection of carbapenemase production. Iran J. Microbiol. 2011, 3, 189–4193. [Google Scholar] [PubMed Central]
  54. Akinyemi, K.O.; Fakorede, C.O.; Abegunrin, R.O.; Ajoseh, S.O.; Anjorin, A.-A.A.; Amisu, K.O.; Opere, B.O.; Moro, D.D. Detection of invA and blaCTM-genes in Salmonella spp isolated from febrile patients in Lagos hospitals, Nigeria. Ger. J. Microbiol. 2021, 1, 1–10. [Google Scholar] [CrossRef]
  55. Mohammed, Y.; Gadzama, G.B.; Zailani, S.B.; Aboderin, A.O. Characterization of extended-spectrum beta-lactamase from Escherichia coli and Klebsiella species from North Eastern Nigeria. J. Clin. Diagn. Res. 2016, 10, DC07-10. [Google Scholar] [CrossRef]
  56. Woodford, N.; Wareham, D.W.; Guerra, B.; Teale, C. Carbapenemase-producing Enterobacteriaceae and non-Enterobacteriaceae from animals and the environment: An emerging public health risk of our own making? J. Antimicrob. Chemother. 2014, 69, 287–291. [Google Scholar] [CrossRef] [PubMed]
  57. Ogba, R.C.; Nomeh, O.L.; Edemekong, C.I.; Nwuzo, A.C.; Akpu, P.O.; Peter, I.U.; Iroha, I.R. Molecular Characterization of Carbapenemase Encoding Genes in Pseudomonas aeruginosa from Tertiary Healthcare in South Eastern Nigeria. Asian J. Biochem. Genet. Mol. Biol. 2022, 12, 61–168. [Google Scholar] [CrossRef]
  58. Hatrongjit, R.; Kerdsin, A.; Akeda, Y.; Hamada, S. Detection of plasmid-mediated colistin-resistant and carbapenem-resistant genes by multiplex PCR. MethodsX 2018, 5, 532–536. [Google Scholar] [CrossRef] [PubMed]
  59. Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef]
Figure 1. Occurrence of Enterococcus species isolated from clinical, animal, and environmental sources.
Figure 1. Occurrence of Enterococcus species isolated from clinical, animal, and environmental sources.
Antibiotics 14 00398 g001
Table 1. Prevalence and distribution of Enterococcus species isolated from different sources.
Table 1. Prevalence and distribution of Enterococcus species isolated from different sources.
CategorySub-CategoryParametersNo. of SamplesNo. of + SamplesEnterococcus spp. Isolated
E. faecalisE. faecium
ClinicalHospitalBGH175220
LASUTH175440
Total350660
Samples collectedUrine100440
Blood150220
Sputum50000
Wound50000
Total350660
SexMale127110
Female223550
Total350660
Age0–18100110
19–37150330
38–5650000
>5750220
Total350660
AnimalStudy areaOko-Oba abattoir50110
Oto Awori abattoir50413
Samples collectedCattle Nasal swab50110
Cattle Rectal swab50413
Total100523
EnvironmentalEffluentOko-Oba abattoir25532
Lagoon waterMaza-Maza25770
Total5012102
Ground Total50023185
+ = positive.
Table 2. Antibiotic susceptibility, resistance, and virulence genes of Enterococcus species from different sources.
Table 2. Antibiotic susceptibility, resistance, and virulence genes of Enterococcus species from different sources.
Antibiotics SusceptibilityStrain CodeNo. of ResistanceNo. of Sensitive3 RISuspected Organism
Sample SourceSample TypeSample Location1 GM1 AMP1 ERY1 TGC1 CIP1 TS1 VA1 CHL1 AUG1 MEM1 IMI
ClinicalBloodBadagrySRRRRRRRRRR2 HB0031010.1E. faecalis
SRRSRRRRRRR2 HB0501010.1E. faecalis
UrineLASUTHSRRRRRRRRRR2 HU0521010.1E. faecalis
SRRRRRRRRRR2 HU0621010.1E. faecalis
SRRSRRRRRRR2 HU074920.2E. faecalis
SRRRRRRRRRR2 HU0751010.1E. faecalis
AnimalNasal SwabOko-ObaSRRRRSRRRRR2 ANS1920.2E. faecalis
Rectal SwabOto-AworiSRRSRRRRRRR2 ARS20920.2E. faecium
RRRSRRRRRRR2 ARS211010.1E. faecium
SRRRRRRRRRR2 ARS221010.1E. faecalis
RRRRRRRRRRR2 ARS231100E. faecium
EnvironmentalLagoon WaterMaza-MazaSRRSRSRSRRR2 EL1740.6E. faecalis
SRRRRRRRRRR2 EL121010.1E. faecium
SRRSRSRSRRR2 EL141010.1E. faecium
SRRRRRRRRRR2 EL151010.1E. faecalis
SRRRRRRRRRR2 EL171010.1E. faecalis
SRRRRRRRRRR2 EL211010.1E. faecalis
SRRRRRRRRRR2 EL51010.1E. faecalis
EffluentOko-ObaSRRRRRRRRRR2 EE21010.1E. faecalis
SRRSRSRSRRR2 EE3740.6E. faecalis
SRRSRSRRSRR2 EE 5740.6E. faecalis
SRRSRRRRRRR2 EE 6920.2E. faecalis
SRRRRRRRRRR2 EE 81010.1E. faecalis
1 Antibiotics: AMP, ampicillin; AUG amoxicillin–clavulanic acid; GM, gentamycin; CIP, ciprofloxacin; ERY, erythromycin; IMI, imipenem; VA, vancomycin; CHL, chloramphenicol; TGC, tigecycline; MEM, meropenem; TS trimethoprim sulfamethoxazole; 2 Samples: HB, human blood; HU, human urine; ANS, animal nasal swab; ARS, animal rectal swab; EL, lagoon water; EE, environmental effluent; 3 Resistance index (RI): number of antibiotics resisted/total number of antibiotics used.
Table 3. Resistance pattern, phenotypic, and genotypic detected resistance and virulence genes found in Enterococcus isolates.
Table 3. Resistance pattern, phenotypic, and genotypic detected resistance and virulence genes found in Enterococcus isolates.
Resistance PatternsPattern CodeNo of IsolatesNo. of Antibiotics ResistedE. faecalisE. faecium
Strain CodeResistance Gene (Code)Virulence
Gene (Code)
Strain CodeResistance Gene (Code)Virulence Gene (Code)
AMP-ERY-TGC-CIP-VA-CHL-AUG-MEM-IMIA19ANS1-----
AMP-ERY-CIP-VA-AUG-MEM-IMIB37EL14, ELI-gelE (EL1)EE3--
GM-AMP-ERY-CIP-TS-VA-CHL-AUG MEM-IMIC110---ARS21-gelE (ARS21)
AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-IMID310HB050, EE6, EE8blaOXA-48, blaKPC, (B050)gelE (HB050)---
AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-IMIE1110HU052, HU062, HU075, EL12,
HB003, EL15,
EL17, EL21, EL5 EE2
blaOXA-48, blaKPC, (HB003)gelE (HB003, EL5, EL15, EL17, EL21)EE5--
GM-AMP-CO-TGC-CIP-TS-VA-CHL-AUG--MEM-IMIF111---ARS23-gelE (ARS23)
Keys: AMP, ampicillin, AUG, amoxicillin–clavulanic acid: GM, gentamycin; CIP, ciprofloxacin; ERY, erythromycin, IMI, imipenem; VA, vancomycin; CHL, chloramphenicol; TGC, tigecycline; MEM, meropenem; TS, trimethoprim–sulfamethoxazole; HB, human blood; HU, human urine; ANS, animal nasal swab; ARS, animal rectal swab; EL, lagoon water; EE, environmental effluent.
Table 4. Primers for molecular identification of resistance and virulence genes.
Table 4. Primers for molecular identification of resistance and virulence genes.
S/NGenesPrimer Sequence 5′-3′Size (bp)Reference
1blaSHV, F-3′CGCCTGTGTATTATCTCCCT’
R-5′CGAGTAGTCCACCAGATCCT’
293 [55]
2blaTEM, F-3′TTTCGTGTCGCCCTTATTCC
R-5′ATCGTTGTCAGAAGTAAGTTGG
403[55]
3blaKPCF-3′CGTCTAGTTCTGCTGTCTTG
R-5′CTTGTCATCCTTGTTAGGCG
798[56]
4blaoxa-48F-3′GCGTGGTTAAGGATGAACAC
R-5′CATCAAGTTCAACCCAACCG’
550[57]
5blaImpF-3′GGAATAGAGTGGTTAAYTCTC
R-5′GGTTTAAYAAAACAACCACC’
232[58]
6espF AATTGATTCTTTAGCATCTGG
R AGATTCATCTTTGATTCTTGG
510[59]
7gelEF-TATGACAATGCTTTTTGGGAT
R-AGATGCACCCGAAATAATATA
213[59]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Salami, W.O.; Ajoseh, S.O.; Lawal-Sanni, A.O.; El Tawab, A.A.A.; Neubauer, H.; Wareth, G.; Akinyemi, K.O. Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria. Antibiotics 2025, 14, 398. https://doi.org/10.3390/antibiotics14040398

AMA Style

Salami WO, Ajoseh SO, Lawal-Sanni AO, El Tawab AAA, Neubauer H, Wareth G, Akinyemi KO. Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria. Antibiotics. 2025; 14(4):398. https://doi.org/10.3390/antibiotics14040398

Chicago/Turabian Style

Salami, Wasiu Olawale, Samuel Oluwasegun Ajoseh, Aminat Olajumoke Lawal-Sanni, Ashraf A. Abd El Tawab, Heinrich Neubauer, Gamal Wareth, and Kabiru Olusegun Akinyemi. 2025. "Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria" Antibiotics 14, no. 4: 398. https://doi.org/10.3390/antibiotics14040398

APA Style

Salami, W. O., Ajoseh, S. O., Lawal-Sanni, A. O., El Tawab, A. A. A., Neubauer, H., Wareth, G., & Akinyemi, K. O. (2025). Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria. Antibiotics, 14(4), 398. https://doi.org/10.3390/antibiotics14040398

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop