Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Design, Place, and Duration of Study
4.2. Sample Size and Sampling
- where P = prevalence of the previous study, 73% = 0.73 [41].
- where n= number of samples to be collected.
- where q = 1 − P (proportion of the population without the characteristic).
- Z = confidence level at 95% (standard value of 1.96).
- d = margin of error at 5% (standard value of 0.05).
- P = prevalence rate.
- q = 1 − P = 1 − 0.73 = 0.27.
- d = allowable error = 5%.
- Z = standard normal distribution at 95% CI = 1.96.
- n = (1.962 × 0.059 × 0.27)/0.052.
- n = 65.
4.3. Bacterial Isolation and Identification
4.4. Antimicrobial Susceptibility Testing (AST)
4.5. Phenotypic Detection of Carbapenemase-Producing Enterococcus Species
4.6. DNA Extraction, Resistance, and Virulence Gene Detection
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bondi, M.; Laukova, A.; de Niederhausern, S.; Messi, P.; Papadopoulou, C.; Economou, V. Controversial aspects displayed by enterococci: Probiotics or pathogens? Biomed. Res. Int. 2020, 2020, 3. [Google Scholar] [CrossRef] [Scilit]
- Dubin, K.; Pamer, E.G. Enterococci and their interactions with the intestinal microbiome. Microbiol. Spectr. 2017, 5, 10–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kommineni, S.; Kristich, C.J.; Salzma, N.H. Harnessing bacteriocin biology as targeted therapy in the GI tract. Gut Microbes 2016, 7, 512–517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makarov, D.A.; Ivanova, O.E.; Pomazkova, A.V.; Egoreva, M.A.; Prasolova, O.V.; Lenev, S.V.; Gergel, M.A.; Bukova, N.K.; Karabanov, S.Y. Antimicrobial resistance of commensal Enterococcus faecalis and Enterococcus faecium from food-producing animals in Russia. Veter World 2022, 15, 611–621. [Google Scholar] [CrossRef] [Scilit]
- Stępień-Pyśniak, D.; Hauschild, T.; Nowaczek, A.; Marek, A.; Dec, M. Wild birds as a potential source of known and novel multilocus sequence types of antibiotic-resistant Enterococcus faecalis. J. Wildl. Dis. 2018, 54, 219–228. [Google Scholar] [CrossRef] [Scilit]
- WHO. Antibiotic Resistance. 2020. Available online: https://www.who.int/news-room/fact-sheets/detail/antibiotic-resistance (accessed on 21 November 2023).
- Zhao, Y.-C.; Sun, Z.-H.; Li, J.-K.; Liu, H.-Y.; Cai, H.-L.; Cao, W.; Yu, F.; Zhang, B.-K.; Yan, M. Exploring the causes of the prevalence of vancomycin-resistant Enterococcus faecalis. Environ. Sci. Eur. 2024, 36, 92. [Google Scholar] [CrossRef] [Scilit]
- Vikesland, P.; Garner, E.; Gupta, S.; Kang, S.; Maile-Moskowitz, A.; Zhu, N. Differential Drivers of Antimicrobial Resistance across the World. Accounts Chem. Res. 2019, 52, 916–924. [Google Scholar] [CrossRef] [Scilit]
- Ayukekbong, J.A.; Ntemgwa, M.; Atabe, A.N. The threat of antimicrobial resistance in developing countries: Causes and control strategies. Antimicrob. Resist. Infect. Control. 2017, 6, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kariuki, S.; Dougan, G. Antibacterial resistance in sub-Saharan Africa: An underestimated emergency. Ann. N. Y. Acad. Sci. 2014, 1323, 43–55. [Google Scholar] [CrossRef] [Scilit]
- Amuasi, G.R.; Dsani, E.; Owusu-Nyantakyi, C.; Owusu, F.A.; Mohktar, Q.; Nilsson, P.; Adu, B.; Hendriksen, R.S.; Egyir, B. Enterococcus species: Insights into antimicrobial resistance and whole-genome features of isolates recovered from livestock and raw meat in Ghana. Front. Microbiol. 2023, 14, 1254896. [Google Scholar] [CrossRef] [Scilit]
- Ngbede, E.O.; Raji, M.A.; Kwanashie, C.N.; Kwaga, J.K.P. Antimicrobial resistance and virulence profile of enterococci isolated from poultry and cattle sources in Nigeria. Trop. Anim. Health Prod. 2016, 49, 451–458. [Google Scholar] [CrossRef] [Scilit]
- Saxena, D.; Maitra, R.; Bormon, R.; Czekanska, M.; Meiers, J.; Titz, A.; Verma, S.; Chopra, S. Tackling the outer membrane: Facilitating compound entry into Gram-negative bacterial pathogens. NPJ Antimicrob. Resist. 2023, 1, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aurilio, C.; Sansone, P.; Barbarisi, M.; Pota, V.; Giaccari, L.G.; Coppolino, F.; Barbarisi, A.; Passavanti, M.B.; Pace, M.C. Mechanisms of Action of Carbapenem Resistance. Antibiotics 2022, 11, 421. [Google Scholar] [CrossRef] [Scilit]
- Meletis, G. Carbapenem resistance: Overview of the problem and future perspectives. Ther. Adv. Infect. Dis. 2016, 3, 15–21. [Google Scholar] [CrossRef] [Scilit]
- Elshamy, A.A.; Aboshanab, K.M. A Review on Bacterial Resistance to Carbapenems: Epidemiology, Detection and Treatment Options. Future Sci. OA 2020, 6, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mó, I.; da Silva, G.J. Tackling Carbapenem Resistance and the Imperative for One Health Strategies—Insights from the Portuguese Perspective. Antibiotics 2024, 13, 557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mancuso, G.; Midiri, A.; Gerace, E.; Biondo, C. Bacterial Antibiotic Resistance: The Most Critical Pathogens. Pathogens 2021, 10, 1310. [Google Scholar] [CrossRef] [Scilit]
- Wada, Y.; Harun, A.; Yean, C.; Nasir, N.M.; Zaidah, A. Vancomycin-resistant enterococcus, obesity, and antibiotics: Is there a possible link? Obes. Med. 2020, 18, 100226. [Google Scholar] [CrossRef] [Scilit]
- Boccella, M.; Santella, B.; Pagliano, P.; De Filippis, A.; Casolaro, V.; Galdiero, M.; Borrelli, A.; Capunzo, M.; Boccia, G.; Franci, G. Prevalence and antimicrobial resistance of Enterococcus species: A retrospective cohort study in Italy. Antibiotics 2021, 10, 1552. [Google Scholar] [CrossRef] [Scilit]
- Gul, Z.; Jan, A.Z.; Liaqat, F.; Qureshi, M.S. Causative organisms and antimicrobial sensitivity pattern of pediatric urinary tract infections. Gomal J. Med. Sci. 2015, 13, 118–122. [Google Scholar]
- Aamodt, H.; Mohn, S.C.; Maselle, S.; Manji, K.P.; Willems, R.; Jureen, R.; Langeland, N.; Blomberg, B. Genetic relatedness and risk factor analysis of ampicillin-resistant and high-level gentamicin-resistant enterococci causing bloodstream infections in Tanzanian children. BMC Infect. Dis. 2015, 15, 107. [Google Scholar] [CrossRef] [Scilit]
- Nor, N.S.M.; Abu, N.A.; Rashid, M.A.; Ismail, M.; Razak, R. Bacterial pathogens and antibiotic resistance patterns in children with urinary tract infection in a Malaysian tertiary hospital. Med. J. Malays 2015, 70, 153–157. [Google Scholar]
- Orababa, O.Q.; Soriwei, J.D.; Akinsuyi, S.O.; Essiet, U.U.; Solesi, O.M. A systematic review and meta-analysis on the prevalence of vancomycin-resistant enterococci (VRE) among Nigerians. Porto Biomed. J. 2021, 6, e125. [Google Scholar] [CrossRef] [Scilit]
- Ferede, Z.T.; Tullu, K.D.; Derese, S.G.; Yeshanew, A.G. Prevalence and antimicrobial susceptibility pattern of Enterococcus species isolated from different clinical samples at Black Lion Specialized Teaching Hospital, Addis Ababa, Ethiopia. BMC Res. Notes 2018, 11, 793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Czajkowski, K.; Broś-Konopielko, M.; Teliga-Czajkowska, J. Urinary tract infection in women. Menopause Rev./Przegląd Menopauzalny 2021, 20, 40–47. [Google Scholar] [CrossRef] [Scilit]
- Schaeffer, A.J.; Nicolle, L.E. Urinary tract infections in older men. N. Engl. J. Med. 2016, 374, 562–571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Komiyama, E.Y.; Lepesqueur, L.S.S.; Yassuda, C.G.; Samaranayake, L.P.; Parahitiyawa, N.B.; Balducci, I.; Koga-Ito, C.Y. Enterococcus species in the oral cavity: Prevalence, virulence factors, and antimicrobial susceptibility. PLoS ONE 2016, 11, e0163001. [Google Scholar] [CrossRef] [Scilit]
- Molale-Tom, L.; Bezuidenhout, C. Prevalence, antibiotic resistance and virulence of Enterococcus spp. from wastewater treatment plant effluent and receiving waters in South Africa. J. Water Health 2020, 18, 753–765. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, W.; Neubauer, H.; Tomaso, H.; El Hofy, F.I.; Monecke, S.; Abd El-Tawab, A.A.; Hotzel, H. Characterization of enterococci-and ESBL-producing Escherichia coli isolated from milk of bovides with mastitis in Egypt. Pathogens 2021, 10, 97. [Google Scholar] [CrossRef] [Scilit]
- Akinyemi, K.O.; Fakorede, C.O. Antimicrobial resistance and resistance genes in salmonella enterica serovars from Nigeria. In Salmonella enterica: Molecular Characterization, Role in Infectious Diseases and Emerging Research; van Doleweerd, F., Ed.; Nova Science Publisher: Hauppauge, NY, USA, 2018; pp. 103–124. ISBN 978-1-53613-084-3. [Google Scholar]
- Iweriebor, B.C.; Obi, L.C.; Okoh, A.I. Macrolide, glycopeptide resistance, and virulence genes in Enterococcus species isolates from dairy cattle. J. Med. Microbiol. 2016, 65, 641–648. [Google Scholar] [CrossRef] [Scilit]
- Sabouni, F.; Movahedi, Z.; Mahmoudi, S.; Pourakbari, B.; Valian, S.K.; Mamishi, S. High frequency of vancomycin-resistant Enterococcus faecalis in children: An alarming concern. J. Prev. Med. Hyg. 2016, 57, E201. [Google Scholar] [PubMed Central]
- Kara, A.; Devrim, İ.; Bayram, N.; Katipoğlu, N.; Kıran, E.; Oruç, Y.; Demiray, N.; Apab, H.; Gülfidan, G. Risk of vancomycin-resistant enterococci bloodstream infection among patients colonized with vancomycin-resistant enterococci. Braz. J. Infect. Dis. 2015, 19, 58–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Georges, M.; Odoyo, E.; Matano, D.; Tiria, F.; Kyany’a, C.; Mbwika, D.; Mutai, W.C.; Musila, L. Determination of Enterococcus faecalis and Enterococcus faecium antimicrobial resistance and virulence factors and their association with clinical and demographic factors in Kenya. J. Pathog. 2022, 2022, 3129439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Njeru, J. Emerging carbapenem resistance in ESKAPE pathogens in sub-Saharan Africa and the way forward. Ger. J. Microbiol. 2021, 1, 3–6. [Google Scholar] [CrossRef] [Scilit]
- Masoud, S.S.; Njakoi, G.N.; Sholla, S.; Renatus, D.; Majigo, M.; Gangji, R.R.; Nyawale, H.; Mawazo, A.; Msafiri, F.; Ntukula, A.; et al. Carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii in Tanzania. Ger. J. Microbiol. 2024, 4, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Guardabassi, L.; Larsen, J.; Skov, R.; Schønheyder, H.C. Gentamicin-resistant Enterococcus faecalis sequence type 6 with reduced penicillin susceptibility: Diagnostic and therapeutic implications. J. Clin. Microbiol. 2010, 48, 3820–3821. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.B.; Seo, H.J.; Seo, K.W.; Jeon, H.Y.; Kim, D.K.; Kim, S.W.; Lim, S.-K.; Lee, Y.J. Characteristics of high-level ciprofloxacin-resistant Enterococcus faecalis and Enterococcus faecium from retail chicken meat in Korea. J. Food Prot. 2018, 81, 1357–1363. [Google Scholar] [CrossRef] [Scilit]
- Raji, M.A.; Jamal, W.; Ojemhen, O.; Rotimi, V.O. Point-surveillance of antibiotic resistance in Enterobacteriaceae isolates from patients in a Lagos Teaching Hospital, Nigeria. J. Infect. Public Health 2013, 6, 431–437. [Google Scholar] [CrossRef] [Scilit]
- Adesida, S.A.; Oluwatosin, Q.O.; Rebecca, F.P.; Bamidele, T.O.; Ajoke, O.A.; Titilayo, O.S. Distribution and Evaluation of Multiple Antibiotic Resistance (MAR) Index of Clinical Isolates of Enterococcus species in Lagos, Nigeria. Acta Microbiol. Bulg. 2022, 38, 301–308. [Google Scholar]
- Deka, J.; Ahmed, G. Antimicrobial resistance in Escherichia coli isolates collected from poultry meat: An epidemiological surveillance study from Guwahati city. Proc. Zool. Soc. 2022, 75, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Zavaryani, S.M.; Mirnejad, R.; Piranfar, V.; Moghaddam, M.M.; Sajjadi, N.; Saeedi, S. Assessment of susceptibility to five common antibiotics and their resistance pattern in clinical Enterococcus isolates. Iran J. Pathol. 2020, 15, 96–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terentjeva, M.; Ķibilds, J.; Avsejenko, J.; Cīrulis, A.; Labecka, L.; Bērziņš, A. Antimicrobial Resistance in Enterococcus spp. Isolates from Red Foxes (Vulpes vulpes) in Latvia. Antibiotics 2024, 13, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, C.M.; Antiporta, M.H.; Murray, B.E.; Dunny, G.M. Role of the Enterococcus faecalis GelE Protease in Determination of Cellular Chain Length, Supernatant Pheromone Levels, and Degradation of Fibrin and Misfolded Surface Proteins. J. Bacteriol. 2003, 185, 3613–3623. [Google Scholar] [CrossRef] [Scilit]
- Hashem, Y.A.; Yassin, A.; Amin, M. Molecular characterization of Enterococcus spp. Clinical isolates from Cairo, Egypt. Ind. J. Med. Microbiol. 2015, 33, S80–S88. [Google Scholar] [CrossRef] [Scilit]
- Munita, J.M.; Arias, C.A. Mechanisms of antibiotic resistance. In Virulence Mechanisms of Bacterial Pathogens; Wiley: Hoboken, NJ, USA, 2016; pp. 481–511. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, S.K.; Hussein, S.; Qurbani, K.; Ibrahim, R.H.; Fareeq, A.; Mahmood, K.; Mohamed, M.G. Antimicrobial resistance: Impacts, challenges, and future prospects. J. Med. Surg. Public Health 2024, 2, 100081. [Google Scholar] [CrossRef] [Scilit]
- Lata, P.; Ram, S.; Agrawal, M.; Shanker, R. Enterococci in river Ganga surface waters: The propensity of species distribution, dissemination of antimicrobial-resistance and virulence-markers among species along the landscape. BMC Microbiol. 2009, 9, 140. [Google Scholar] [CrossRef] [Scilit]
- Facklam, R.; Elliott, J.A. Identification, classification, and clinical relevance of catalase-negative, gram-positive cocci, excluding the streptococci and enterococci. Clin. Microbiol. Rev. 1995, 8, 479–495. [Google Scholar] [CrossRef] [PubMed]
- Vandepitte, J. Basic Laboratory Procedures in Clinical Bacteriology; World Health Organization: Geneva, Switzerland, 2003. [Google Scholar]
- CLSI. CLSI: Performance Standards for Antimicrobial Susceptibility Testing, 32nd ed.; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2022; Volume 256. [Google Scholar]
- Amjad, A.; Mirza, I.A.; Abbasi, S.; Farwa, U.; Malik, N.; Zia, F. Modified Hodge test: A simple and effective test for detection of carbapenemase production. Iran J. Microbiol. 2011, 3, 189–4193. [Google Scholar] [PubMed Central]
- Akinyemi, K.O.; Fakorede, C.O.; Abegunrin, R.O.; Ajoseh, S.O.; Anjorin, A.-A.A.; Amisu, K.O.; Opere, B.O.; Moro, D.D. Detection of invA and blaCTM-genes in Salmonella spp isolated from febrile patients in Lagos hospitals, Nigeria. Ger. J. Microbiol. 2021, 1, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, Y.; Gadzama, G.B.; Zailani, S.B.; Aboderin, A.O. Characterization of extended-spectrum beta-lactamase from Escherichia coli and Klebsiella species from North Eastern Nigeria. J. Clin. Diagn. Res. 2016, 10, DC07-10. [Google Scholar] [CrossRef] [Scilit]
- Woodford, N.; Wareham, D.W.; Guerra, B.; Teale, C. Carbapenemase-producing Enterobacteriaceae and non-Enterobacteriaceae from animals and the environment: An emerging public health risk of our own making? J. Antimicrob. Chemother. 2014, 69, 287–291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogba, R.C.; Nomeh, O.L.; Edemekong, C.I.; Nwuzo, A.C.; Akpu, P.O.; Peter, I.U.; Iroha, I.R. Molecular Characterization of Carbapenemase Encoding Genes in Pseudomonas aeruginosa from Tertiary Healthcare in South Eastern Nigeria. Asian J. Biochem. Genet. Mol. Biol. 2022, 12, 61–168. [Google Scholar] [CrossRef] [Scilit]
- Hatrongjit, R.; Kerdsin, A.; Akeda, Y.; Hamada, S. Detection of plasmid-mediated colistin-resistant and carbapenem-resistant genes by multiplex PCR. MethodsX 2018, 5, 532–536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef] [Scilit]

| Category | Sub-Category | Parameters | No. of Samples | No. of + Samples | Enterococcus spp. Isolated | |
|---|---|---|---|---|---|---|
| E. faecalis | E. faecium | |||||
| Clinical | Hospital | BGH | 175 | 2 | 2 | 0 |
| LASUTH | 175 | 4 | 4 | 0 | ||
| Total | 350 | 6 | 6 | 0 | ||
| Samples collected | Urine | 100 | 4 | 4 | 0 | |
| Blood | 150 | 2 | 2 | 0 | ||
| Sputum | 50 | 0 | 0 | 0 | ||
| Wound | 50 | 0 | 0 | 0 | ||
| Total | 350 | 6 | 6 | 0 | ||
| Sex | Male | 127 | 1 | 1 | 0 | |
| Female | 223 | 5 | 5 | 0 | ||
| Total | 350 | 6 | 6 | 0 | ||
| Age | 0–18 | 100 | 1 | 1 | 0 | |
| 19–37 | 150 | 3 | 3 | 0 | ||
| 38–56 | 50 | 0 | 0 | 0 | ||
| >57 | 50 | 2 | 2 | 0 | ||
| Total | 350 | 6 | 6 | 0 | ||
| Animal | Study area | Oko-Oba abattoir | 50 | 1 | 1 | 0 |
| Oto Awori abattoir | 50 | 4 | 1 | 3 | ||
| Samples collected | Cattle Nasal swab | 50 | 1 | 1 | 0 | |
| Cattle Rectal swab | 50 | 4 | 1 | 3 | ||
| Total | 100 | 5 | 2 | 3 | ||
| Environmental | Effluent | Oko-Oba abattoir | 25 | 5 | 3 | 2 |
| Lagoon water | Maza-Maza | 25 | 7 | 7 | 0 | |
| Total | 50 | 12 | 10 | 2 | ||
| Ground Total | 500 | 23 | 18 | 5 | ||
| Antibiotics Susceptibility | Strain Code | No. of Resistance | No. of Sensitive | 3 RI | Suspected Organism | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Sample Source | Sample Type | Sample Location | 1 GM | 1 AMP | 1 ERY | 1 TGC | 1 CIP | 1 TS | 1 VA | 1 CHL | 1 AUG | 1 MEM | 1 IMI | |||||
| Clinical | Blood | Badagry | S | R | R | R | R | R | R | R | R | R | R | 2 HB003 | 10 | 1 | 0.1 | E. faecalis |
| S | R | R | S | R | R | R | R | R | R | R | 2 HB050 | 10 | 1 | 0.1 | E. faecalis | |||
| Urine | LASUTH | S | R | R | R | R | R | R | R | R | R | R | 2 HU052 | 10 | 1 | 0.1 | E. faecalis | |
| S | R | R | R | R | R | R | R | R | R | R | 2 HU062 | 10 | 1 | 0.1 | E. faecalis | |||
| S | R | R | S | R | R | R | R | R | R | R | 2 HU074 | 9 | 2 | 0.2 | E. faecalis | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 HU075 | 10 | 1 | 0.1 | E. faecalis | |||
| Animal | Nasal Swab | Oko-Oba | S | R | R | R | R | S | R | R | R | R | R | 2 ANS1 | 9 | 2 | 0.2 | E. faecalis |
| Rectal Swab | Oto-Awori | S | R | R | S | R | R | R | R | R | R | R | 2 ARS20 | 9 | 2 | 0.2 | E. faecium | |
| R | R | R | S | R | R | R | R | R | R | R | 2 ARS21 | 10 | 1 | 0.1 | E. faecium | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 ARS22 | 10 | 1 | 0.1 | E. faecalis | |||
| R | R | R | R | R | R | R | R | R | R | R | 2 ARS23 | 11 | 0 | 0 | E. faecium | |||
| Environmental | Lagoon Water | Maza-Maza | S | R | R | S | R | S | R | S | R | R | R | 2 EL1 | 7 | 4 | 0.6 | E. faecalis |
| S | R | R | R | R | R | R | R | R | R | R | 2 EL12 | 10 | 1 | 0.1 | E. faecium | |||
| S | R | R | S | R | S | R | S | R | R | R | 2 EL14 | 10 | 1 | 0.1 | E. faecium | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 EL15 | 10 | 1 | 0.1 | E. faecalis | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 EL17 | 10 | 1 | 0.1 | E. faecalis | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 EL21 | 10 | 1 | 0.1 | E. faecalis | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 EL5 | 10 | 1 | 0.1 | E. faecalis | |||
| Effluent | Oko-Oba | S | R | R | R | R | R | R | R | R | R | R | 2 EE2 | 10 | 1 | 0.1 | E. faecalis | |
| S | R | R | S | R | S | R | S | R | R | R | 2 EE3 | 7 | 4 | 0.6 | E. faecalis | |||
| S | R | R | S | R | S | R | R | S | R | R | 2 EE 5 | 7 | 4 | 0.6 | E. faecalis | |||
| S | R | R | S | R | R | R | R | R | R | R | 2 EE 6 | 9 | 2 | 0.2 | E. faecalis | |||
| S | R | R | R | R | R | R | R | R | R | R | 2 EE 8 | 10 | 1 | 0.1 | E. faecalis | |||
| Resistance Patterns | Pattern Code | No of Isolates | No. of Antibiotics Resisted | E. faecalis | E. faecium | ||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Code | Resistance Gene (Code) | Virulence Gene (Code) | Strain Code | Resistance Gene (Code) | Virulence Gene (Code) | ||||
| AMP-ERY-TGC-CIP-VA-CHL-AUG-MEM-IMI | A | 1 | 9 | ANS1 | - | - | - | - | - |
| AMP-ERY-CIP-VA-AUG-MEM-IMI | B | 3 | 7 | EL14, ELI | - | gelE (EL1) | EE3 | - | - |
| GM-AMP-ERY-CIP-TS-VA-CHL-AUG MEM-IMI | C | 1 | 10 | - | - | - | ARS21 | - | gelE (ARS21) |
| AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-IMI | D | 3 | 10 | HB050, EE6, EE8 | blaOXA-48, blaKPC, (B050) | gelE (HB050) | - | - | - |
| AMP-ERY-TGC-CIP-TS-VA-CHL-AUG-MEM-IMI | E | 11 | 10 | HU052, HU062, HU075, EL12, HB003, EL15, EL17, EL21, EL5 EE2 | blaOXA-48, blaKPC, (HB003) | gelE (HB003, EL5, EL15, EL17, EL21) | EE5 | - | - |
| GM-AMP-CO-TGC-CIP-TS-VA-CHL-AUG--MEM-IMI | F | 1 | 11 | - | - | - | ARS23 | - | gelE (ARS23) |
| S/N | Genes | Primer Sequence 5′-3′ | Size (bp) | Reference |
|---|---|---|---|---|
| 1 | blaSHV, | F-3′CGCCTGTGTATTATCTCCCT’ R-5′CGAGTAGTCCACCAGATCCT’ | 293 | [55] |
| 2 | blaTEM, | F-3′TTTCGTGTCGCCCTTATTCC R-5′ATCGTTGTCAGAAGTAAGTTGG | 403 | [55] |
| 3 | blaKPC | F-3′CGTCTAGTTCTGCTGTCTTG R-5′CTTGTCATCCTTGTTAGGCG | 798 | [56] |
| 4 | blaoxa-48 | F-3′GCGTGGTTAAGGATGAACAC R-5′CATCAAGTTCAACCCAACCG’ | 550 | [57] |
| 5 | blaImp | F-3′GGAATAGAGTGGTTAAYTCTC R-5′GGTTTAAYAAAACAACCACC’ | 232 | [58] |
| 6 | esp | F AATTGATTCTTTAGCATCTGG R AGATTCATCTTTGATTCTTGG | 510 | [59] |
| 7 | gelE | F-TATGACAATGCTTTTTGGGAT R-AGATGCACCCGAAATAATATA | 213 | [59] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Salami, W.O.; Ajoseh, S.O.; Lawal-Sanni, A.O.; El Tawab, A.A.A.; Neubauer, H.; Wareth, G.; Akinyemi, K.O. Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria. Antibiotics 2025, 14, 398. https://doi.org/10.3390/antibiotics14040398
Salami WO, Ajoseh SO, Lawal-Sanni AO, El Tawab AAA, Neubauer H, Wareth G, Akinyemi KO. Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria. Antibiotics. 2025; 14(4):398. https://doi.org/10.3390/antibiotics14040398
Chicago/Turabian StyleSalami, Wasiu Olawale, Samuel Oluwasegun Ajoseh, Aminat Olajumoke Lawal-Sanni, Ashraf A. Abd El Tawab, Heinrich Neubauer, Gamal Wareth, and Kabiru Olusegun Akinyemi. 2025. "Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria" Antibiotics 14, no. 4: 398. https://doi.org/10.3390/antibiotics14040398
APA StyleSalami, W. O., Ajoseh, S. O., Lawal-Sanni, A. O., El Tawab, A. A. A., Neubauer, H., Wareth, G., & Akinyemi, K. O. (2025). Prevalence, Antimicrobial Resistance Patterns, and Emerging Carbapenemase-Producing Enterococcus Species from Different Sources in Lagos, Nigeria. Antibiotics, 14(4), 398. https://doi.org/10.3390/antibiotics14040398

