Next Article in Journal
Efflux-Mediated Macrolide Resistance in Clinical Streptococcus Isolates: A Comparative Molecular Study
Next Article in Special Issue
A Performance Evaluation of the Vitek®2 AST-N440 Card for Colistin Susceptibility Testing of Carbapenem-Resistant Acinetobacter baumannii Complex Isolates Using Broth Microdilution as the Reference Method
Previous Article in Journal
The Potential Roles of Prophages in the Pathogenicity of Klebsiella pneumoniae Strains from Kenya
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genomic and Phenotypic Characterization of Two High-Risk Klebsiella pneumoniae Clones (ST258-blaKPC-2 and ST11-blaNDM-1) from a Greek Tertiary Hospital

by
Ilias S. Frydas
1,2,
Emmanouil Kouklakis
3,
Georgios Meletis
4,
Andigoni Malousi
4,
Maria Anna Kyriazidi
5,
Fani Chatzopoulou
1,
Irini Amargianitaki
3,
Kallirhoe Kalinderi
1,
Maria Mavridou
1,
Stella Mitka
1,
Evangelia Panagiotaki
3 and
Maria Chatzidimitriou
1,*
1
Department of Biomedical Sciences, International Hellenic University, 57400 Thessaloniki, Greece
2
HERACLES Research Center on the Exposome and Health, Centre for Interdisciplinary Research and Innovation, Aristotle University of Thessaloniki, 57001 Thessaloniki, Greece
3
Microbiology Department, General Hospital “Venizeleio-Pananio”, 71409 Irakleio, Greece
4
Laboratory of Microbiology, School of Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
5
1st Propaedeutic Department of Internal Medicine, Medical School, Faculty of Health Sciences, Aristotle University of Thessaloniki, 54642 Thessaloniki, Greece
*
Author to whom correspondence should be addressed.
Antibiotics 2025, 14(11), 1146; https://doi.org/10.3390/antibiotics14111146
Submission received: 19 September 2025 / Revised: 1 November 2025 / Accepted: 4 November 2025 / Published: 12 November 2025

Abstract

Background/Objectives: Klebsiella pneumoniae ST258 and ST11 are global high-risk antimicrobial-resistant clones known for their virulence and resistance gene dissemination. This study aims to identify these clones in a Greek tertiary hospital and understand their resistance profiles and transmission dynamics. Methods: In January 2025, we isolated two distinct carbapenem-resistant K. pneumoniae in a Greek tertiary hospital: INT18S from an ICU patient’s bronchioalveolar lavage and INT20U from a urine sample in the emergency unit. Antimicrobial susceptibility testing (via Microscan system) and Whole-Genome Sequencing (WGS) were conducted on both isolates and their genomes were submitted to the NCBI. Results: The INT18S isolate carried the blaKPC-2 gene and belonged to the ST258 clone. The INT20U isolate carried the blaNDM-1 gene and belonged to the ST11 clone lineage. Both isolates contained at least one of the extended spectra β-lactamase genes tested (TEM, SHV, OXA-1 and CTX-M group). Conclusions: The co-existence of the high-risk K. pneumoniae clones ST258 and ST11 in different hospital departments increases the risk of resistance gene transfer and suggests potential intra-hospital transmission pathways. Understanding their resistance profiles is critical for guiding treatment strategies and preventing the spread of multidrug-resistant pathogens.

1. Introduction

Klebsiella pneumoniae is a high-risk bacterial pathogen, which can lead to severe pneumonia and bloodstream and urinary infections [1,2]. Carbapenem-resistant K. pneumoniae (CRKP) strains—especially those producing carbapenemases, like KPC and NDM—pose a significant threat to public health due to their multidrug-resistant nature [3,4]. These carbapenemases, since they are mainly located on a variety of plasmids, facilitate horizontal gene transfer, contributing to the spread of resistance [5]. Infections caused by CPKP are associated with high mortality rates, but certain enzymes like NDM and VIM that confer resistance to a broader range of drug classes may be linked to even worse patient outcomes [3,4,5]. These enzymes often coexist with extended-spectrum β-lactamases (ESBLs) or other resistance factors, leading to extensively drug-resistant (XDR) or even pan-drug-resistant (PDR) phenotypes [6].
Strain-specific K. pneumoniae has been shown to exhibit within-host diversity during prolonged infections with certain variants persisting through adaptation [7]. Notably also, CRKP isolates from the blood of a single patient have shown heterogenicity in their antibiotic susceptibility, capsular polysaccharide production and mucoviscosity [8,9,10]. These CRKP strains frequently isolated in ICUs and other hospital settings are associated with prolonged hospitalization, increased mortality rates and limited treatment options [11].
The majority of CRKP strains worldwide belong to the notorious clonal complex 258 CC258, including sequence types (STs) ST258, ST11, ST340, ST437 and ST512 [12]. These strains combine invasive virulence features with resistance to last-resort antibiotics and have been linked to both community-and hospital-associated outbreaks [13].
In Greece, the epidemiological landscape of K. pneumoniae is dominated by CC258, particularly sequence types ST258 and ST11. Several studies have documented the isolation of K. pneumoniae ST258 strains with similar resistance profiles in Greece [14,15]. These strains are often associated with the blaKPC-2 gene and various plasmid types, contributing to their multidrug resistance. A study analyzed 378 K. pneumoniae isolates collected from 40 Greek hospitals between January 2009 and April 2010 and found that all isolates were positive for blaKPC-2, with ST258 being the predominant sequence type (n = 322) [15]. Another comprehensive survey covering the period from 2013 to 2022 identified ST258/512 as one of the five most prevalent sequence types among carbapenem-resistant K. pneumoniae isolates in Greek hospitals [16]. Despite this evidence, the genomic context and intra-hospital transmission dynamics of these high-risk clones remain underexplored.
In the present study we aimed to elucidate the molecular and transmission characteristics of two separate K. pneumoniae isolates belonging to the high-risk clones ST258 and ST11, each carrying distinct carbapenemase genes (blaKPC-2 and blaNDM-1) co-existing in the same tertiary hospital in Irakleio, Crete, Greece. This co-occurrence suggests possible intra-hospital transmission pathways that have not been previously explored. Also, by focusing on these two high-risk clones from different hospital departments, we aim to deepen the understanding of their genetic backgrounds and transmission potential, guiding the infection control and antibiotic stewardship strategies.

2. Results

2.1. Isolate Identification

Whole-Genome Sequencing (WGS) identified the isolates as K. pneumoniae INT18S and INT20U, with a genome completeness of 97.5% and 97.85%, respectively, assigned at taxid 573. The assembly resulted in 147 contigs for INT18S and 137 contigs (≥500 bp) for INT20U, with N50values of 138,249 and 124,403 and total contig lengths of 5,684,851 and 5,551,402 bp, respectively, ensuring high-quality assemblies. The average sequencing depth was 185.4× for INT18S and 225.9× for INT20U. Multilocus sequence typing (MLST) showed that the INT18S isolate belongs to the ST258 clone, and the INT20U isolate belongs to the ST11 clone. Phylogenetic trees of both isolates are shown in Figure 1. Both isolates were predicted as capsule-null, with the K-locus 106 (KL106/O2v2) and K-locus 48(KL48/O2v1) detected for INT18S and INT20U, respectively.

2.2. Antimicrobial Resistance Genes (ARGs)

All the detected ARGs in both isolates are shown in Table 1. In the two isolates, different ARGs were detected, and the common ones were the aac(6′)-lb, conferring resistance to aminoglycosides, and the OqxA and OqxB which confer resistance to fluoroquinolones. INT18S carried a total of 13 ARGs, while INT20U carried 11 ARG, with 3 ARGs shared between them. This was determined using PATRIC’s k-mer-based ARGs detection method. The detection was further validated using AMRFinderPlus to ensure accuracy.
The aadA2, aph(3′)-la, qacE, sul1, catA1, blaKPC-2, blaSHV-12 and mph(A) genes were detected only in INT18S, and the blaCTX-M-15, blaNDM-1, blaOXA-1, blaSHV-182, catB3 and dfrA14 genes were detected only in INT20U. The blaKPC-2 gene that was identified in INT18S encodes the predominant carbapenemase in Greece, particularly among ST258 strains, and is strongly associated with healthcare-associated outbreaks. The blaSHV-12 gene is an extended-spectrum β-lactamase (ESBL) that confers resistance to third-generation cephalosporins and is often co-transferred with carbapenemases. Aminoglycoside-modifying genes such as aac(6′)-Ib, aac(6′)-Ibcr, aadA2 and aph(3′)-Ia provide high-level resistance to aminoglycosides, further limiting treatment choices. Other resistance determinants found, such as catA1 (chloramphenicol), dfrA12 (trimethoprim), fosA6 (fosfomycin), mph(A) (macrolides), qacE (quaternary ammonium compounds) and sul1 (sulfonamides), contribute to multidrug resistance.

2.3. Antimicrobial Susceptibility

The susceptibility of isolates to common antibiotics used in hospitals was tested, including third- and fourth- generation cephalosporins, β-lactam/β-lactamase inhibitors, cephamycin, aztreonam, quinolones, aminoglycosides and colistin. The antibiotic susceptibility profiles of K. pneumoniae INT18S and INT20U are detailed in Table 2. Both strains exhibited a resistance to carbapenems (ertapenem, imipenem and meropenem), amikacin, aztreonam, amoxicillin/clavulanate, ampicillin, chloramphenicol, cefuroxime, ceftazidime, cefoxitin, cefepime, ciprofloxacin, levofloxacin, piperacillin/tazobactam, trimethoprim/sulfamethoxazole, nalidixic acid and tobramycin. INT20U has been shown to be resistant to gentamicin, ceftazidime/avibactam, imipenem/relebactam and meropenem/vaborbactam whereas INT18S was susceptible. Both isolates remained susceptible to colistin and aztreonam/avibactam. European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints were applied for the interpretation of the susceptibility testing results of antibiotics (https://www.eucast.org/clinical_breakpoints, accessed on 20 September 2025).

2.4. Plasmid Detection and Additional Genomic Features

The in-silico predictions for the plasmid typing, including the identification of replicon, relaxase and mate-pair formation protein types for INT18S and INT20U, are shown in Table 3. The IncFIB(K) is the only common plasmid detected in both isolate genomes.
In INT18S, three ColRNAI plasmids were detected, which are notable for their ability to be mobilized and participate in plasmid fusion events, but no respective plasmids were detected in the INT20U isolate. In addition, three relaxase-type genes were detected in INT18S, denoted as MOBC, MOBF, and MOBP, and only MOBF was detected in INT20U. All plasmids were denoted as conjugative mobilizable types. The detection of ColRNAI, IncFIB(K), IncFIB(pQil) and IncX3 plasmids suggests an efficient horizontal transfer of resistance determinants through highly mobile genetic elements. Relaxase and conjugation systems and the presence of relaxase types MOBC, MOBF and MOBP, together with the MPF_T conjugation system, strongly indicate that the isolates are conjugative and capable of horizontal gene transfer.

2.5. Yersiniabactin

The sequencing data of the two strains were subjected to a Kleborate v3.1.3 analysis for Yersiniabactin sequence type (YbST) and Yersiniabactin Lineage ICE (ICEKp) predictions. Allele numbers of different yersiniabactin (ybt) locus and lineage results are shown in Table 4, with notable differences. It was found that the INT18S isolate carried the yersiniabactin gene cluster ybt13 and the respective encoding integrative conjugative element ICEKp2. INT20U carried the ybt gene cluster ybt15 and the respective integrative conjugative element ICEKp11. In isolate INT18S, three to six times more alleles for irp2, irp1 and ybtE genes were identified, whereas isolate INT20U showed four times more alleles for the ybtX gene and six times more alleles for the ybtU gene. These differences could imply enhanced iron acquisition and survival capabilities in the host, contributing to the pathogenicity of INT18S. A resistance score three for INT18S indicates a higher potential for virulence compared to a score of two for INT20U. These scores are based on the presence of carbapenemase genes and colistin resistance determinants, and provide a quantitative measure of the virulence potential, reflecting the genetic composition of the isolates’ yersiniabactin clusters [17].

3. Discussion

This study conducted a molecular and phenotypic analysis of two distinct clinical K. pneumoniae isolates obtained from different departments in a Greek hospital. The use of WGS techniques enabled the precise identification of ST258 and ST11, revealing complex resistance profiles and potential intra-hospital transmission dynamics.
Our findings are consistent with previous reports of high carbapenem resistance rates in Greece, driven largely by the spread of blaKPC-2 in ST258 clones. Between 2001 and 2008, Greece reported some of the highest rates of carbapenem resistance in Gram-negative bacteria globally, with the carbapenemase prevalence increasing by 30% in hospital wards and 60% in intensive care units (ICUs) [18,19]. A study performed in 21 Greek hospitals indicated that by the end of 2008, 96% of K. pneumoniae isolates carrying blaKPC belonged to the ST258 lineage which accounted for nearly 40% of all isolates [20]. The surveillance in Greece from 2013 to 2022 has demonstrated that blaKPC, originally carried almost exclusively by the hyperepidemic ST258 clone, now circulates across numerous STs, including ST147, ST323 and three other high-risk clones (ST11, ST15 and ST39), representing over 90% of the CRKP in Greek hospitals [16,21,22,23]. The surveillance by the European Centre for Disease Prevention and Control (ECDC) between 2022 and 2023 involving 15 Greek hospitals confirmed that the emerging high-risk clones ST39 and ST323 have become endemic, across the hospital network and in multiple health institutions, respectively [24]. Another study conducted in an ICU in Thessaloniki performed between 2016 and 2019 with 165 patients, demonstrated the polyclonal transmission of blaKPC identifying 128 pulsotypes within 17 clusters, and found that 74% of CRKP isolates harbored blaKPC genes [25].
The present study provides a detailed molecular and phenotypic analysis of two novel isolated carbapenem-resistant K. pneumoniae isolates, collected at a regional hospital in Crete, Greece, and annotated as INT18S and INT20U. Our findings reveal a complex and evolving epidemiological landscape of CRKP in Greek hospitals, with a predominance of high-risk clones ST258 and ST11, extensive resistance gene co-carriage and potential intra-hospital transmission. K. pneumoniae strains in ICUs and emergency units can differ in terms of virulence, antibiotic resistance and the types of infections they cause [26]. Strains isolated from ICU settings are typically linked with hospital-acquired infections, including CRKP, and can lead to severe respiratory and bloodstream infections with high morbidity and mortality rates. On the other hand, emergency unit strains, while also capable of causing infections, may be more associated with community-acquired pneumonia and other infections and often display distinct antibiotic resistance profiles [27]. The identification of CRKP in the Emergency Department suggests possible healthcare-associated transmission from prior hospital stays or nursing home residents, whereas the co-existence of multiple carbapenemases reflects ongoing gene exchange and selective pressure.
In the current study, it was determined that the INT18S and INT20U K. pneumoniae isolates belong to the ST258 and ST11 sequence types, respectively. The latter types belong to clonal complex 258 (CC258), but they differ primarily in their genomic makeup and more specifically at the region containing the capsule polysaccharide (cps) gene [28]. ST258 is considered a hybrid clone, with a ST11 backbone and a segment from ST442, including the cps operon, whereas ST11 is a single-locus variant of ST258 [29]. While ST258 is prevalent in North America, Latin America and Europe, ST11 dominates in Asia, and especially in China. Furthermore, ST11 isolates have shown higher serum resistance and phagocytic rates compared to ST258 [30]. It was shown that the ICU-detected INT18S isolate is resistant to carbapenems, which is consistent with data supporting the strong resistance of ST258 clonal populations in tertiary hospitals due to integrative conjugative elements such as ICEKp10 and the harboring of yersiniabactin and colibactin virulence factors [31]. INT18S showed more yersiniabactin alleles than INT20U. The detection of yersiniabactin (ybt) loci in K. pneumoniae isolates is significant because it is a major virulence factor that facilitates iron acquisition, a critical process for bacterial growth and survival in the host. Moreover, it is often found in highly pathogenic and multidrug-resistant strains, and its presence can indicate a higher risk of severe invasive infections, such as bacteremia and liver abscesses [31,32].
The K. pneumoniae INT18S isolate exhibits a concerning resistance profile that is characteristic of epidemic clones responsible for nosocomial infections in Greece [33]. Its resistome includes blaKPC-2 together with multiple resistance genes such as aac(6′)-Ib, aac(6′)-Ibcr, aadA2, aph(3′)-Ia, blaSHV-12, catA1, dfrA12, fosA6, mph(A), OqxA, OqxB, qacE and sul1, which confer resistance to aminoglycosides, fosfomycin, macrolide, sulfonamide and β-lactams. The latter are hosted on diverse plasmid types with known mobility functions, such as ColRNAI, IncFIB(K), IncFIB(pQil) and IncX3, indicating high transmissibility; dissemination dynamics within and between species, particularly in healthcare environments; and severely limited treatment options [34,35,36,37]. In parallel, the coexistence of multiple plasmid replicons with relaxase systems (MOBF, MOBC and MOBP) supports a high potential for horizontal gene transfer. Multireplicon plasmids, such as IncFIB variants, often carry multiple resistance operons, increasing the genetic payload and potentially enabling co-selection under antibiotic pressure (e.g., using aminoglycosides also selects for β-lactam resistance) [4]. This constellation of genes and plasmids likely contributes to persistence and spread in hospital environments, especially in high-antibiotic-pressure settings such as ICUs.
On the other hand, the urine-derived isolate INT20U of a patient admitted to the Emergency Department was assigned to ST11, another pandemic lineage often associated with blaNDM-1 and blaCTX-M-15 dissemination, particularly in Asia, the Balkans and parts of the Mediterranean [38]. This isolate harbored blaNDM-1 together with class A β-lactamase blaOXA-1 and blaSHV-182. Interestingly, INT20U did not exhibit porin gene mutations, suggesting that its carbapenem resistance was primarily enzyme-mediated. Its plasmid content (IncFIA(HI1), IncFII(K) and, IncR) supports a distinct mobilome compared with INT18S and may indicate exposure to different ecological niches, reservoirs or selective pressures, including community or early healthcare settings [39]. Phenotypically, INT20U showed resistance to ceftazidime/avibactam and imipenem/relebactam, aligning with the typical drug resistance pattern of NDM-producing isolates and emphasizing limited therapeutic options.
Our study identified the presence of the IncFIB(K) plasmid replicon in both INT18S and INT20U K. pneumoniae isolates. The co-occurrence of this plasmid in both isolates, despite their origin from different departments (ICU and emergency unit) suggests a potential mechanism for the local transmission of resistant genes. IncFIB(K) is well known for its high mobility due to its conjugative properties. This capability is further augmented by the presence of MOBF relaxase, which was also detected in our isolates [14].
Neither isolate harbored hypervirulence-associated rmp loci (rmpA and rmpD) excluding a hypermucoid K. pneumoniae phenotype and indicating that their capsule-null phenotype may enhance high adaptability and tissue tropism affecting virulence and resistance dynamics [15,40]. This adaptability may facilitate strain evolution and increased transmission rates [41,42].
This study has some limitations. Additional experiments and analyses are required, such as conjugation experiments to assess the horizontal transfer potential of the resistance plasmids. Also, the isolates were obtained from two separate patients in a tertiary hospital setting, raising the possibility of selection bias and limiting the generalization of our findings.
In conclusion, CRKP in this regional hospital in Crete, Greece shows diverse resistance profiles. The presence of both ST258 harboring blaKPC-2 and ST11 harboring blaNDM-1 lineages highlights the need for enhanced molecular diagnostics, active genomic surveillance, and strict antimicrobial stewardship programs in Greek hospitals and beyond. These are critical to mitigating spread and improving patient outcomes.

4. Materials and Methods

4.1. Collection and Identification of Bacterial Strains

The K. pneumoniae strain INT8S was isolated from bronchial secretion of a male patient who was hospitalized in the intensive care unit (ICU) of a Greek tertiary Hospital in Irakleio, Crete, Greece. The patient with underlying hematologic disease and kidney failure was treated with ceftazidime and teicoplanin. Four days after sampling the patient passed away. The K. pneumoniae strain INT20U was isolated from urine sample of a male patient admitted to the Emergency Department of the hospital. At admission, the patient was treated with ampicillin/sulbactam (500 + 1000 mg), twice a day.
The hospital has granted ethical approval (5/6 May 2025), and patients’ samples were further processed in the hospital’s Microbiology Department and cultured in routine media. Antimicrobial susceptibility testing was carried out by the Microscan Walk away 96 plus automated system (Beckman Coulter, Brea, California, USA) according to manufacturer’s instructions. Susceptibility testing for newer antimicrobial combinations of ceftazidime/avibactam, aztreonam/avibactam, imipenem/relebactam and meropenem/vaborbactam was performed using minimal inhibitory concentration (MIC) gradient strips (Liofilchem Roseto degli Abruzzi, Italy). Moreover, susceptibility to colistin was tested using a cation adjusted Mueller–Hinton broth (CAMHB) microdilution method (Liofilchem, Roseto degli Abruzzi, Italy). Tigecycline susceptibility was evaluated using susceptibility breakpoints (susceptible ≤ 2mg/L, intermediate 4 mg/L, resistant ≥ 8 mg/L), approved by the US Food and Drug Administration. European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints were applied for the interpretation of the susceptibility testing results of all other antibiotics (https://www.eucast.org/clinical_breakpoints, accessed on 20 September 2025). Both isolates were phenotypically tested for metallo-β-lactamase (MBL) and K. pneumoniae carbapenemase (KPC) production using ethylene diamine tetraacetic acid (EDTA) and phenylboronic acid (BA).

4.2. DNA Isolation and Real-Time PCR Gene Detection

Genomic DNA was extracted from overnight bacterial culture using the PureLink Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol for Gram-negative bacteria. Detection of resistance genes (KPC, VIM, NDM and OXA-48) was conducted by real-time polymerase chain reaction (qPCR) using the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Fostercity, CA, USA) in combination with the Platinum® Quantitative PCR SuperMix-UDG (Invitrogen, Carlsbad, CA, USA). This master mix included uracil-N-glycosylase (UNG) to prevent carryover contamination from previously amplified PCR products containing uracil. Each reaction was prepared according to the manufacturer’s guidelines, with final concentrations of 40 nM for each primer and probe. Primers and probes were selected based on the study by Ellington et al., 2016 [43] and are shown in Table 5. The amplification protocol followed the same reference with minor modifications, consisting of an initial UNG activation step at 50 °C for 2 min, initial denaturation at 95 °C for 2 min, followed by 40 amplification cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. A final extension step was performed at 60 °C for 5 min. Data analysis was carried out using the QuantStudio™ Design and Analysis Software. For quality control, a no-template control (NTC) and positive control DNA from well-characterized strains harboring each resistance gene were included in every run.

4.3. Whole-Genome Sequencing

Libraries were prepared using Ion Torrent technology and Ion Chef workflows (Thermo Scientific, Waltham, MA, USA). Sequencing was performed in the S5XLS system, and analysis of the raw sequencing data was conducted by Ion Torrent Suite v.5.10.0, according to manufacturer’s instructions. Raw sequencing data were quality checked and trimmed by fastp to keep only the reads that match the minimum length and quality criteria.

4.4. Bioinformatics Analysis

Libraries were prepared using Ion Torrent technology and Ion Chef workflows (Thermo Scientific). Sequencing was performed in the S5XLS system and analysis of primary data was conducted with Ion Torrent Suite (v.5.10.0). Kraken2 v2.13 was used for the taxonomy classification built on the standard database that includes NCBI taxonomic information, complete RefSeq microbe genomes, human genomes and a vector collection. Genomes were de novo assembled by Assembler SPAdes and SPAdes v3.15.5 using the default settings for the k-mers and the Ion Torrent configuration. BUSCO v5.7.1 (lineage: enterobacterales_odb10) was used to evaluate the assembled genome completeness of the synthesized genomes. PATRIC BV-BRC platform v3.54.6 was used to implement a comprehensive analysis of the genomes, including quality control, genome annotation, AMR detection and phylogenetic analysis. Complementary analysis for quality assessment and strain annotation was applied using tools such as QUAST v5.3.0 for assembly QC, staramr v0.10.0 for AMR validation, Kaptive v1.3.0 and kleborate v3.1.3. MOB-Suite v3.0.1 was used to determine plasmid replicon types and predict plasmid mobility. Finally, after they were trimmed of foreign species fragment contigs and converted to fasta files, bacterial genomes were submitted to NCBI genome database and received the respective accession numbers JBRBEL000000000 for INT18S and JBPXMH000000000 for INT20U, respectively.

Author Contributions

I.S.F.: Writing—original draft preparation, investigation, data interpretation, writing—review and editing; E.K.: resources, laboratory analysis, investigation, methodology, data curation; G.M.: data curation, writing—review and editing; A.M.: data curation, data analysis; M.A.K.: writing—review and editing; F.C.: molecular laboratory analysis, data curation; I.A.: laboratory analysis, writing—review and editing; K.K.: molecular laboratory analysis, writing—review and editing; M.M.: investigation, laboratory analysis, data curation; S.M.: supervising, editing; E.P.: resources, data curation, supervising; M.C.: conceptualization, methodology and design of the study, resources, data curation, writing—original draft preparation, and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This study was conducted in accordance with the Declaration of Helsinki. It was approved by the Bioethics Committee of the International Hellenic University, No 18/28-07-2025. Also, ethical approval was obtained from the hospital’s scientific committee (Scientific 69 Council Meeting Minutes No. 5 (6 May 2025), Agenda Item 10).

Informed Consent Statement

Patient consent was waived due to retrospective anonymized data analysis.

Data Availability Statement

The whole genomes of K. pneumoniae INT18S and INT20U were deposited in DDBJ/ENA/Genbank under the accession numbers JBRBEL000000000 for INT18S (https://www.ncbi.nlm.nih.gov/nuccore/JBRBEL000000000, BioProject ID: PRJNA1291179 accessed on 28 August 2025) and JBPXMH000000000, (https://www.ncbi.nlm.nih.gov/nuccore/JBPXMH000000000, BioProject ID: PRJNA1291402 accessed on 28 August 2025) for INT20U, respectively.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Abbas, R.; Chakkour, M.; Zein El Dine, H.; Obaseki, E.F.; Obeid, S.T.; Jezzini, A.; Ghssein, G.; Ezzeddine, Z. General overview of Klebsiella pneumoniae: Epidemiology and the role of siderophores in its pathogenicity. Biology 2024, 13, 78. [Google Scholar] [CrossRef] [PubMed]
  2. Munoz-Price, L.S.; Poirel, L.; Bonomo, R.A.; Schwaber, M.J.; Daikos, G.L.; Cormican, M.; Cornaglia, G.; Garau, J.; Gniadkowski, M.; Hayden, M.K.; et al. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect. Dis. 2013, 13, 785–796. [Google Scholar] [CrossRef]
  3. Dela Fuente, J.; Diaz-Colunga, J.; Sanchez, A.; San Millan, A. Global epistasis in plasmid-mediated antimicrobial resistance. Mol. Syst. Biol. 2024, 20, 311–320. [Google Scholar] [CrossRef]
  4. Chen, T.; Ying, L.; Xiong, L.; Wang, X.; Lu, P.; Wang, Y.; Shen, P.; Xiao, Y. Understanding carbapenem-resistant hypervirulent Klebsiella pneumoniae: Key virulence factors and evolutionary convergence. hLife 2024, 2, 611–624. [Google Scholar] [CrossRef]
  5. Mohammadpour, D.; Memar, M.H.; Leylabadlo, H.E.; Ghotaslou, A.; Ghotaslou, R. Carbapenem-resistant Klebsiella pneumoniae: A comprehensive review of phenotypic and genotypic methods for detection. Microbe 2025, 6, 100246. [Google Scholar] [CrossRef]
  6. Meletis, G. Carbapenem resistance: Overview of the problem and future perspectives. Ther. Adv. Infect. Dis. 2016, 3, 15–21. [Google Scholar] [CrossRef]
  7. Li, L.; Jiang, Z.; Wang, X.; Yang, S.; Li, F.; Xiao, Y.; Qu, J. Carbapenem-resistant Klebsiella pneumoniae ST11 index from a single strain enhances rapid parallel evolution during persistent infection. hLife 2025, 3, 517–520. [Google Scholar] [CrossRef]
  8. Pu, D.; Zhao, J.; Lu, B.; Zhang, Y.; Wu, Y.; Li, Z.; Zhuo, X.; Cao, B. Within-host resistance evolution of a fatal ST11 hypervirulent carbapenem-resistant Klebsiella pneumoniae. Int. J. Antimicrob. Agents 2023, 61, 106747. [Google Scholar] [CrossRef]
  9. Cheng, S.; Fleres, G.; Chen, L.; Liu, G.; Hao, B.; Newbrough, A.; Driscoll, E.; Shields, R.K.; Squires, K.M.; Chu, T.-Y.; et al. Within-host genotypic and phenotypic diversity of contemporaneous carbapenem-resistant Klebsiella pneumoniae from blood cultures of patients with bacteremia. mBio 2022, 13, e0290622. [Google Scholar] [CrossRef] [PubMed]
  10. Yoshino, M.; Aihara, M.; Gotoh, Y.; Akimoto, M.; Tatsuhara, W.; Kiyosuke, M.; Matsushima, Y.; Uchiumi, T.; Hayashi, T.; Kang, D. Stepwise evolution of a Klebsiella pneumoniae clone within a host leading to increased multidrug resistance. mSphere 2021, 6, e0073421. [Google Scholar] [CrossRef] [PubMed]
  11. Hafiz, T.A.; Alanazi, S.; Alghamdi, S.S.; Mubaraki, M.A.; Aljabr, W.; Madkhali, N.; Alharbi, S.R.; Binkhamis, K.; Alotaibi, F. Klebsiella pneumoniae bacteraemia epidemiology, resistance profiles and clinical outcome of King Fahad Medical City isolates, Riyadh, Saudi Arabia. BMC Infect. Dis. 2023, 23, 579. [Google Scholar] [CrossRef]
  12. Cuzon, G.; Naas, T.; Nordmann, P. Functional characterization of Tn4401, a Tn3-based transposon involved in blaKPC gene mobilization. Antimicrob. Agents Chemother. 2011, 55, 5370–5373. [Google Scholar] [CrossRef] [PubMed]
  13. Budia-Silva, M.; Kostyanev, T.; Ayala-Montaño, S.; Acosta, J.B.-F.; Garcia-Castillo, M.; Cantón, R.; Goossens, H.; Rodriguez-Baño, J.; Grundmann, H.; Reuter, S. International and regional spread of carbapenem-resistant Klebsiella pneumoniae in Europe. Nat. Commun. 2024, 15, 5092. [Google Scholar] [CrossRef] [PubMed]
  14. Sun, Z.; Zhang, J.; Wang, C.; Chen, J.; Li, P.; Su, J.; Xu, X.; Wang, M. The pivotal role of IncFIB(Mar) plasmid in the emergence and spread of hypervirulent carbapenem-resistant Klebsiella pneumoniae. Sci Adv. 2025, 11, eado9097. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  15. Yang, X.; Liu, X.; Chan, E.W.; Zhang, R.; Chen, S. Functional characterization of plasmid-borne rmpADC homologues in Klebsiella pneumoniae. Microbiol. Spectr. 2023, 11, e0308122. [Google Scholar] [CrossRef] [PubMed]
  16. Tryfinopoulou, K.; Linkevicius, M.; Pappa, O.; Alm, E.; Karadimas, K.; Svartström, O.; Polemis, M.; Mellou, K.; Maragkos, A.; Brolund, A.; et al. Emergence and persistent spread of carbapenemase-producing Klebsiella pneumoniae high-risk clones in Greek hospitals, 2013 to 2022. Eurosurveillance 2023, 28, 2300571. [Google Scholar] [CrossRef]
  17. Lam, M.M.C.; Wick, R.R.; Watts, S.C.; Cerdeira, L.T.; Wyres, K.L.; Holt, K.E. A genomic surveillance framework and genotyping tool for Klebsiella pneumoniae and its related species complex. Nat. Commun. 2021, 12, 4188. [Google Scholar] [CrossRef]
  18. Souli, M.; Galani, I.; Antoniadou, A.; Papadomichelakis, E.; Poulakou, G.; Panagea, T.; Vourli, S.; Zerva, L.; Armaganidis, A.; Kanellakopoulou, K.; et al. An outbreak of infection due to beta-Lactamase Klebsiella pneumoniae Carbapenemase 2-producing K. pneumoniae in a Greek University Hospital: Molecular characterization, epidemiology, and outcomes. Clin. Infect. Dis. 2010, 50, 364–373. [Google Scholar] [CrossRef]
  19. Vatopoulos, A. High rates of metallo-beta-lactamase-producing Klebsiella pneumoniae in Greece: A review of the current evidence. Eurosurveillance 2008, 13, 8023. [Google Scholar] [CrossRef]
  20. Giakkoupi, P.; Maltezou, H.; Polemis, M.; Pappa, O.; Saroglou, G.; Vatopoulos, A.; The Greek System for the Surveillance of Antimicrobial Resistance Collective. KPC-2-producing Klebsiella pneumoniae infections in Greek hospitals are mainly due to a hyperepidemic clone. Eurosurveillance 2009, 14, 19218. [Google Scholar] [CrossRef]
  21. Tsolakidou, P.; Kyriazidi, M.A.; Varlamis, S.; Chatzopoulou, F.; Frydas, I.; Kyriazidis, K.A.; Kalinderi, K.; Mitka, S.; Skepastianos, P.; Chatzidimitriou, M. NDM-1 and VIM-1 dual metallo-β-lactamase producing Klebsiella pneumoniae ST15 high-risk clone from a blood culture of a patient at intensive care unit in a Greek tertiary care hospital. Acta Microbiol. Immunol. Hung. 2025, 72, 93–98. [Google Scholar] [CrossRef]
  22. Chatzidimitriou, M.; Tsolakidou, P.; Panagiota, C.; Mylona, E.; Mitka, S. KPC-2 and VIM-1 producing Klebsiella pneumoniae ST39 high-risk clone isolated from a clinical sample in Volos, Greece. Acta Microbiol. Immunol. Hung. 2024, 71, 43–51. [Google Scholar] [CrossRef]
  23. Chatzidimitriou, M.; Tsolakidou, P.; Kyriazidi, M.A.; Chatzopoulou, F.; Varlamis, S.; Mavridou, M.; Kalinderi, K.; Kyriazidis, K.A.; Mitka, S. Identification of NDM-1 producing and colistin-resistant Klebsiella pneumoniae ST11: A highly drug-resistant strain detected in intensive care unit of a Greek tertiary care hospital. Acta Microbiol. Immunol. Hung. 2025, 72, 16–22. [Google Scholar] [CrossRef] [PubMed]
  24. European Centre for Disease Prevention and Control. Carbapenem- and/or Colistin-Resistant Klebsiella pneumoniae in Greece: Molecular Follow-Up Survey 2022; ECDC: Stockholm, Sweden, 2023. [Google Scholar]
  25. Protonotariou, E.; Meletis, G.; Pilalas, D.; Mantzana, P.; Tychala, A.; Kotzamanidis, C.; Papadopoulou, D.; Papadopoulos, T.; Polemis, M.; Metallidis, S.; et al. Polyclonal endemicity of carbapenemase-producing Klebsiella pneumoniae in ICUs of a Greek tertiary care hospital. Antibiotics 2022, 11, 149. [Google Scholar] [CrossRef] [PubMed]
  26. Basso, M.; Di Pilato, V.; Riccobono, E.; Giachi, F.; Pupillo, F.; Lanzafame, M.; Meini, S.; Antonelli, A.; Rossolini, G.M. Intra-hospital acquisition of colonization and infection by Klebsiella pneumoniae strains producing carbapenemases and carriage evolution: A longitudinal analysis in an Italian teaching hospital from January 2017 to August 2019. Int. J. Infect. Dis. 2020, 92, 81–88. [Google Scholar] [CrossRef] [PubMed]
  27. Li, L.; Huang, L.; Liu, X.; Ye, Y.; Sai, F.; Huang, H. Intensive care unit-acquired pneumonia caused by Klebsiella pneumoniae in China: Risk factors and prediction model of mortality. Medicine 2023, 102, e33269. [Google Scholar] [CrossRef]
  28. Zhang, M.; Li, J.; Lu, Y.; Wu, W.; Wu, J.; Xu, Y.; Zhong, Y.; Liu, S.; Lin, C.; Xu, S.; et al. Expanding of ST11 Carbapenemase-Producing Klebsiella pneumoniae Subclones in a Chinese Hospital, Shenzhen, China. Infect. Drug Resist. 2021, 14, 1415–1422. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  29. Chen, L.; Chavda, K.D.; Melano, R.G.; Jacobs, M.R.; Levi, M.H.; Bonomo, R.A.; Kreiswirth, B.N. Complete sequence of a blaKPC-2-harboring IncFII(K1) plasmid from a Klebsiella pneumoniae sequence type 258 strain. Antimicrob. Agents Chemother. 2013, 57, 1542–1545. [Google Scholar] [CrossRef]
  30. Peirano, G.; Bradford, P.A.; Kazmierczak, K.M.; Chen, L.; Kreiswirth, B.N.; Pitout, J.D. Importance of clonal complex 258 and IncFK2-like plasmids among a global collection of Klebsiella pneumoniae with blaKPC. Antimicrob. Agents Chemother. 2017, 61, e02610-16. [Google Scholar] [CrossRef]
  31. Marsh, J.W.; Mustapha, M.M.; Griffith, M.P.; Evans, D.R.; Ezeonwuka, C.; Pasculle, A.W.; Shutt, K.A.; Sundermann, A.; Ayres, A.M.; Shields, R.K.; et al. Evolution of outbreak-causing carbapenem-resistant Klebsiella pneumoniae ST258 at a tertiary care hospital over 8 years. mBio 2019, 10, e01945-19. [Google Scholar] [CrossRef]
  32. Jia, P.; Li, P.; Yu, W.; Chu, X.; Zhang, H.; Zhang, J.; Kang, W.; Zhang, G.; Zhang, Q.; Chen, S.; et al. Clinical imipenem non-susceptible Klebsiella pneumoniae isolates from China: Epidemiology, molecular characterization and in vitro activity of imipenem/relebactam. J. Glob. Antimicrob. Resist. 2025, 44, 1–7. [Google Scholar] [CrossRef]
  33. Galani, I.; Karaiskos, I.; Karantani, I.; Papoutsaki, V.; Maraki, S.; Papaioannou, V.; Kazila, P.; Tsorlini, H.; Charalampaki, N.; Toutouza, M.; et al. Epidemiology and resistance phenotypes of carbapenemase-producing Klebsiella pneumoniae in Greece, 2014 to 2016. Eurosurveillance 2018, 23, 1700775. [Google Scholar] [CrossRef]
  34. Takei, S.; Lu, Y.J.; Tohya, M.; Watanabe, S.; Misawa, S.; Tabe, Y.; Miida, T.; Mya, S.; Tin, H.H.; Tada, T.; et al. Spread of carbapenem-resistant Klebsiella pneumoniae clinical isolates producing NDM-type metallo-β-lactamase in Myanmar. Microbiol. Spectr. 2022, 10, e0067322. [Google Scholar] [CrossRef]
  35. Lam, M.M.; Wyres, K.L.; Duchêne, S.; Wick, R.R.; Judd, L.M.; Gan, Y.-H.; Hoh, C.-H.; Archuleta, S.; Molton, J.S.; Kalimuddin, S.; et al. Population genomics of hypervirulent Klebsiella pneumoniae clonal-group 23 reveals early emergence and rapid global dissemination. Nat. Commun. 2018, 9, 2703. [Google Scholar] [CrossRef]
  36. Karaiskos, I.; Daikos, G.L.; Gkoufa, A.; Adamis, G.; Stefos, A.; Symbardi, S.; Chrysos, G.; Filiou, E.; Basoulis, D.; Mouloudi, E.; et al. Ceftazidime/avibactam in the era of carbapenemase-producing Klebsiella pneumoniae: Experience from a national registry study. J. Antimicrob. Chemother. 2021, 76, 775–783. [Google Scholar] [CrossRef]
  37. Fang, L.; Chen, R.; Li, C.; Liu, R.; Shen, Y.; Guo, X.; Sun, J. The association between the genetic structures of commonly incompatible plasmids in Gram-negative bacteria, their distribution and the resistance genes. Front. Cell. Infect. Microbiol. 2024, 14, 1472876. [Google Scholar] [CrossRef]
  38. Li, S.; Zhang, D.; Zhang, X.; Ma, X.; Zheng, S.; Zhou, D.; Hou, Q.; Li, G.; Han, H. Genomic epidemiology and anti-biofilm mechanisms of Lactobacillus in ST11 carbapenem-resistant Klebsiella pneumoniae in China. Front. Microbiol. 2025, 16, 1619621. [Google Scholar] [CrossRef] [PubMed]
  39. Feldgarden, M.; Brover, V.; Haft, D.H.; Prasad, A.B.; Slotta, D.J.; Tolstoy, I.; Tyson, G.H.; Zhao, S.; Hsu, C.H.; McDermott, P.F.; et al. Validating the AMR Finder tool and resistance gene database by using antimicrobial resistance genotype-phenotype correlations in a collection of isolates. Antimicrob. Agents Chemother. 2019, 63, e00483-19. [Google Scholar] [CrossRef] [PubMed]
  40. Teo, T.H.; Ayuni, N.N.; Yin, M.; Liew, J.H.; Chen, J.Q.; Kurepina, N.; Chen, L.; Bifani, P. Differential mucosal tropism and dissemination of classical and hypervirulent Klebsiella pneumoniae infection. iScience 2024, 27, 108875. [Google Scholar] [CrossRef]
  41. Singh, R.P.; Kapoor, A.; Sinha, A.; Manoharan, S. Virulence factors of Klebsiella pneumoniae: Insights into canonical and emerging mechanisms driving pathogenicity and drug resistance. Microbe 2025, 7, 100289. [Google Scholar] [CrossRef]
  42. Wang, Q.; Yu, H.; Pan, X.; Huang, W.; Lalsiamthara, J.; Ullah, S.; Xu, Y.; Lu, A. Exploring current hypervirulent Klebsiella pneumoniae infections: Insights into pathogenesis, drug resistance, and vaccine prospects. Front. Microbiol. 2025, 16, 1604763. [Google Scholar] [CrossRef] [PubMed]
  43. Ellington, M.J.; Findlay, J.; Hopkins, K.L.; Meunier, D.; Alvarez-Buylla, A.; Horner, C.; McEwan, A.; Guiver, M.; McCrae, L.X.; Woodford, N.; et al. Multicentre evaluation of a real-time PCR assay to detect genes encoding clinically relevant carbapenemases in cultured bacteria. Int. J. Antimicrob. Agents 2016, 47, 151–154. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The National Center for Biotechnology Information (NCBI) staff manually select and categorize reference and representative genomes, which they consider to be of high quality and importance to the research community. PATRIC provides the reference and representative genomes, and includes them in the phylogenetic analysis that is part of the Comprehensive Genome Analysis report. The closest reference and representative genomes were identified by Mash/MinHash. PATRIC global protein families (PGFams) were selected from these genomes to determine the phylogenetic placement of this genome. The protein sequences from these families were aligned with MUSCLE, and the nucleotides for each of those sequences were mapped to the protein alignment. The joint set of amino acid and nucleotide alignments were concatenated into a data matrix, and RaxM was used to analyze this matrix, with fast bootstrapping used to generate the support values in the tree. INT18S and INT20U isolates are displayed in red color in (A) and (B) respectively.
Figure 1. The National Center for Biotechnology Information (NCBI) staff manually select and categorize reference and representative genomes, which they consider to be of high quality and importance to the research community. PATRIC provides the reference and representative genomes, and includes them in the phylogenetic analysis that is part of the Comprehensive Genome Analysis report. The closest reference and representative genomes were identified by Mash/MinHash. PATRIC global protein families (PGFams) were selected from these genomes to determine the phylogenetic placement of this genome. The protein sequences from these families were aligned with MUSCLE, and the nucleotides for each of those sequences were mapped to the protein alignment. The joint set of amino acid and nucleotide alignments were concatenated into a data matrix, and RaxM was used to analyze this matrix, with fast bootstrapping used to generate the support values in the tree. INT18S and INT20U isolates are displayed in red color in (A) and (B) respectively.
Antibiotics 14 01146 g001
Table 1. Antimicrobial resistance (AMR) genes annotated in both INT18S and INT20U isolates using the k-mer-based AMR gene detection method of the Genome Annotation Service in PATRIC. Gene names in boldface denote genes detected in both isolates, and antibiotic names in boldface denote antibiotic resistance phenotypes predicted for both isolates.
Table 1. Antimicrobial resistance (AMR) genes annotated in both INT18S and INT20U isolates using the k-mer-based AMR gene detection method of the Genome Annotation Service in PATRIC. Gene names in boldface denote genes detected in both isolates, and antibiotic names in boldface denote antibiotic resistance phenotypes predicted for both isolates.
IsolateMLSTAMR GenesCenter for Genomic Epidemiology—DTU-Predicted Resistance Phenotypes
INT18SST258aac(6′)-Ib, aac(6′)-Ibcr, fosA6, OqxA, OqxB, aadA2, aph(3′)-Ia, blaKPC-2, blaSHV-12, catA1, dfrA12, qacE, sul1, mph(A)Amikacin, Tobramycin, Netilmicin, Fluoroquinolones, Amoxicillin, Amoxicillin/Clavulanic Acid, Ampicillin, Ampicillin/Clavulanic Acid, Aztreonam, Cefepime, Cefotaxime, Cefoxitin, Ceftazidime, Ertapenem, Imipenem, Meropenem, Piperacillin, Piperacillin/Tazobactam, Ticarcillin, Ceftriaxone, Chloramphenicol, Trimethoprim, Fosfomycin, Nalidixic Acid, Streptomycin, Neomycin, Kanamycin, Ticarcillin/Clavulanic Acid, Erythromycin, Azithromycin, Sulfamethoxazole
INT20UST11aac(6′)-Ib, aac(6′)-Ibcr, fosA6, OqxA, OqxB, aac(6′)-Ib-cr, blaCTXM-15, blaNDM-1, blaOXA-1, blaSHV-182, catB3, dfrA14Amikacin, Tobramycin, Netilmicin, Fluoroquinolones, Amoxicillin, Ampicillin, Aztreonam, Cefepime, Cefotaxime, Ceftazidime, Ceftriaxone, Piperacillin, Ticarcillin, Amoxicillin/Clavulanic Acid, Ampicillin/Clavulanic Acid, Cefoxitin, Ertapenem, Imipenem, Meropenem, Piperacillin/Tazobactam, Chloramphenicol, Trimethoprim, Fosfomycin, Nalidixic Acid, Cefixime, Temocillin
Table 2. Antibiotic susceptibility of K. pneumoniae INT18S and INT20U isolates. R: Resistant, S: Susceptible and MIC: Minimum Inhibitory Concentration. Differences in susceptibilities between the two isolates are highlighted in yellow.
Table 2. Antibiotic susceptibility of K. pneumoniae INT18S and INT20U isolates. R: Resistant, S: Susceptible and MIC: Minimum Inhibitory Concentration. Differences in susceptibilities between the two isolates are highlighted in yellow.
INT18SINT20U
AntibioticMIC (mg/L)InterpretationMIC (mg/L)Interpretation
Amikacin>16R>16R
Amoxicillin/Clavulanate>8/4R>8/4R
Ampicillin>8R>8R
Aztreonam>4R>4R
Cefepime>8R>8R
Cefotaxime>16R>16R
Cefoxitin>8R>8R
Ceftazidime>8R>8R
Cefuroxime>8R>8R
Chloramphenicol>8R>8R
Ciprofloxacin>1R>1R
Colistin≤2S≤2S
Ertapenem>1R>1R
Gentamicin≤2S>4R
Imipenem>8R>8R
Levofloxacin>1R>1R
Meropenem>8R>8R
Nalidixic Acid>16R>16R
Nitrofurantoin>64R>64R
Piperacillin/Tazobactam>16R>16R
Tigecycline2S2S
Tobramycin>4R>4R
Trimethoprim/
Sulfamethoxazole
>4/76R>4/76R
Aztreonam/Avibactam0.19S0.25S
Ceftazidime/Avibactam0.75S32R
Imipenem/Relebactam0.75S16R
Meropenem/Vaborbactam0.50S32R
Table 3. In-silico predictions for plasmid typing, including identification of replicon, relaxase and mate pair formation protein types. MOB types also predict mobility of a plasmid, such as conjugative, mobilizable and non-mobilizable. Features in bold denote common detection in both isolates. (Abbreviations. MOB types (MOBC, MOBF, MOBP): mobility types of relaxase proteins. MPF: mate pair formation protein types).
Table 3. In-silico predictions for plasmid typing, including identification of replicon, relaxase and mate pair formation protein types. MOB types also predict mobility of a plasmid, such as conjugative, mobilizable and non-mobilizable. Features in bold denote common detection in both isolates. (Abbreviations. MOB types (MOBC, MOBF, MOBP): mobility types of relaxase proteins. MPF: mate pair formation protein types).
Plasmid TypeRelaxase TypeMPF TypePredicted Mobility
INT18SColRNAI, ColRNAI, ColRNAI, IncFIB(K), IncFIB(pQil), IncX3MOBC, MOBF, MOBPMPF_TConjugative
INT20UIncFIA(HI1), IncFIB(K), IncFII(K), IncRMOBFMPF_FConjugative
Table 4. Genomic differences in INT18S and INT20U K. pneumoniae isolates based on yersiniabactin sequence types, lineage and allele numbers in ybt genetic loci. Predicted data were calculated by Kleborate v3.1.3.
Table 4. Genomic differences in INT18S and INT20U K. pneumoniae isolates based on yersiniabactin sequence types, lineage and allele numbers in ybt genetic loci. Predicted data were calculated by Kleborate v3.1.3.
INT18SINT20U
YbST299-1LV230-2LV
Yersiniabactin LineageYbt13; ICEKp2Ybt15; ICEKp11
Alleles
ybtS66
ybtX415
ybtQ2022
ybtP144
ybtA11
irp222037
irp113134
ybtU214
ybtT41
ybtE524
fyuA217
Table 5. RT-PCR primers used to detect common carbapenem-resistant genes in the isolated strains.
Table 5. RT-PCR primers used to detect common carbapenem-resistant genes in the isolated strains.
TargetGeneTypeNameSequence (5′ → 3′)5′ Label3′ Label
KPCPrimer (forward)KPC_fwdGCAGCGGCAGCAGTTTGTTGATT
Primer (reverse)KPC_revGTAGACGGCCAACACAATAGGTGC
ProbeKPC_probeCAGTCGGAGACAAAACCGGAACCTGCROXBHQ-2
NDMPrimer (forward)NDM_fwdCCAGCAAATGGAAACTGGCGAC
Primer (reverse)NDM_revATCCAGTTGAGGATCTGGGCG
Probe (ABI7500)NDM_probe_ABI7500ACCGAATGTCTGGCAGCACACTTCTAMBHQ-2
OXA-48Primer (forward)OXA48_fwdGATTATGGTAATGAGGACATTTCGGGC
Primer (reverse)OXA48_revCATATCCATATTCATCGCAAAAAACCACAC
Probe (ABI7500)OXA48_probe_ABI7500CCATTGGCTTCGGTCAGCATGGCTTGTTTJOEBHQ-1
VIMPrimer (forward)VIM_fwdTTGCTTTTGATTGATACAGCGTGGGG
Primer (reverse)VIM_revGTACGTTGCCACCCCAGCC
ProbeVIM_probeTCTCGCGGAGATTGAAAAGCAAATTGGACTTCCCY5BHQ-3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Frydas, I.S.; Kouklakis, E.; Meletis, G.; Malousi, A.; Kyriazidi, M.A.; Chatzopoulou, F.; Amargianitaki, I.; Kalinderi, K.; Mavridou, M.; Mitka, S.; et al. Genomic and Phenotypic Characterization of Two High-Risk Klebsiella pneumoniae Clones (ST258-blaKPC-2 and ST11-blaNDM-1) from a Greek Tertiary Hospital. Antibiotics 2025, 14, 1146. https://doi.org/10.3390/antibiotics14111146

AMA Style

Frydas IS, Kouklakis E, Meletis G, Malousi A, Kyriazidi MA, Chatzopoulou F, Amargianitaki I, Kalinderi K, Mavridou M, Mitka S, et al. Genomic and Phenotypic Characterization of Two High-Risk Klebsiella pneumoniae Clones (ST258-blaKPC-2 and ST11-blaNDM-1) from a Greek Tertiary Hospital. Antibiotics. 2025; 14(11):1146. https://doi.org/10.3390/antibiotics14111146

Chicago/Turabian Style

Frydas, Ilias S., Emmanouil Kouklakis, Georgios Meletis, Andigoni Malousi, Maria Anna Kyriazidi, Fani Chatzopoulou, Irini Amargianitaki, Kallirhoe Kalinderi, Maria Mavridou, Stella Mitka, and et al. 2025. "Genomic and Phenotypic Characterization of Two High-Risk Klebsiella pneumoniae Clones (ST258-blaKPC-2 and ST11-blaNDM-1) from a Greek Tertiary Hospital" Antibiotics 14, no. 11: 1146. https://doi.org/10.3390/antibiotics14111146

APA Style

Frydas, I. S., Kouklakis, E., Meletis, G., Malousi, A., Kyriazidi, M. A., Chatzopoulou, F., Amargianitaki, I., Kalinderi, K., Mavridou, M., Mitka, S., Panagiotaki, E., & Chatzidimitriou, M. (2025). Genomic and Phenotypic Characterization of Two High-Risk Klebsiella pneumoniae Clones (ST258-blaKPC-2 and ST11-blaNDM-1) from a Greek Tertiary Hospital. Antibiotics, 14(11), 1146. https://doi.org/10.3390/antibiotics14111146

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop