Gene emrC Associated with Resistance to Quaternary Ammonium Compounds Is Common among Listeria monocytogenes from Meat Products and Meat Processing Plants in Poland
Abstract
1. Introduction
1.1. Listeria Monocytogenes and Food Safety
1.2. Aim of the Study
2. Results
3. Discussion
4. Materials and Methods
4.1. Isolates
4.2. Phenotypic Analysis
4.3. Genetic Analyses
4.4. Data Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fung, F.; Wang, H.-S.; Menon, S. Food Safety in the 21st Century. Biomed. J. 2018, 41, 88–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Erickson, M.C.; Doyle, M.P. The Challenges of Eliminating or Substituting Antimicrobial Preservatives in Foods. Annu. Rev. Food Sci. Technol. 2017, 8, 371–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.Y.; Henao, O.L.; Griffin, P.M.; Vugia, D.J.; Cronquist, A.B.; Hurd, S.; Tobin-D’Angelo, M.; Ryan, P.; Smith, K.; Lathrop, S.; et al. Infection with Pathogens Transmitted Commonly Through Food and the Effect of Increasing Use of Culture-Independent Diagnostic Tests on Surveillance—Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2012–2015. MMWR Morb. Mortal. Wkly. Rep. 2016, 65, 368–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaptchouang Tchatchouang, C.-D.; Fri, J.; De Santi, M.; Brandi, G.; Schiavano, G.F.; Amagliani, G.; Ateba, C.N. Listeriosis Outbreak in South Africa: A Comparative Analysis with Previously Reported Cases Worldwide. Microorganisms 2020, 8, 135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osek, J.; Lachtara, B.; Wieczorek, K. Listeria Monocytogenes—How This Pathogen Survives in Food-Production Environments? Front. Microbiol. 2022, 13, 866462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiktorczyk-Kapischke, N.; Skowron, K.; Wałecka-Zacharska, E. Genomic and Pathogenicity Islands of Listeria Monocytogenes-Overview of Selected Aspects. Front. Mol. Biosci. 2023, 10, 1161486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Q.; Gooneratne, R.; Hussain, M.A. Listeria Monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels. Foods 2017, 6, 21. [Google Scholar] [CrossRef] [Scilit]
- Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.-A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne Illness Acquired in the United States--Major Pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef]
- Rogalla, D.; Bomar, P.A. Listeria Monocytogenes. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2020. [Google Scholar]
- Osek, J.; Lachtara, B.; Wieczorek, K. Listeria Monocytogenes in Foods-From Culture Identification to Whole-Genome Characteristics. Food Sci. Nutr. 2022, 10, 2825–2854. [Google Scholar] [CrossRef] [Scilit]
- Jordan, K.; McAuliffe, O. Listeria Monocytogenes in Foods. In Advances in Food and Nutrition Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 86, pp. 181–213. ISBN 978-0-12-813977-6. [Google Scholar]
- Elhanafi, D.; Dutta, V.; Kathariou, S. Genetic Characterization of Plasmid-Associated Benzalkonium Chloride Resistance Determinants in a Listeria Monocytogenes Strain from the 1998–1999 Outbreak. Appl Environ. Microbiol 2010, 76, 8231–8238. [Google Scholar] [CrossRef] [Scilit]
- Palaiodimou, L.; Fanning, S.; Fox, E.M. Genomic Insights into Persistence of Listeria Species in the Food Processing Environment. J. Appl. Microbiol. 2021, 131, 2082–2094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kovacevic, J.; Ziegler, J.; Wałecka-Zacharska, E.; Reimer, A.; Kitts, D.D.; Gilmour, M.W. Tolerance of Listeria Monocytogenes to Quaternary Ammonium Sanitizers Is Mediated by a Novel Efflux Pump Encoded by emrE. Appl. Environ. Microbiol. 2016, 82, 939–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tezel, U.; Pavlostathis, S.G. Quaternary Ammonium Disinfectants: Microbial Adaptation, Degradation and Ecology. Curr. Opin. Biotechnol. 2015, 33, 296–304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Xu, T.; Li, S.; Mann, D.A.; Britton, B.; Oliver, H.F.; den Bakker, H.C.; Deng, X. Integrative Assessment of Reduced Listeria Monocytogenes Susceptibility to Benzalkonium Chloride in Produce Processing Environments. Appl. Environ. Microbiol. 2022, 88, e0126922. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Li, Y.; Zahid, M.S.H.; Yamasaki, S.; Shi, L.; Li, J.; Yan, H. Benzalkonium Chloride and Heavy-Metal Tolerance in Listeria Monocytogenes from Retail Foods. Int. J. Food Microbiol. 2014, 190, 24–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Müller, A.; Rychli, K.; Muhterem-Uyar, M.; Zaiser, A.; Stessl, B.; Guinane, C.M.; Cotter, P.D.; Wagner, M.; Schmitz-Esser, S. Tn6188—A Novel Transposon in Listeria Monocytogenes Responsible for Tolerance to Benzalkonium Chloride. PLoS ONE 2013, 8, e76835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roedel, A.; Dieckmann, R.; Brendebach, H.; Hammerl, J.A.; Kleta, S.; Noll, M.; Al Dahouk, S.; Vincze, S. Biocide-Tolerant Listeria Monocytogenes Isolates from German Food Production Plants Do Not Show Cross-Resistance to Clinically Relevant Antibiotics. Appl. Environ. Microbiol. 2019, 85, e01253-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, T.; Jiang, X.; Zhang, Y.; Ji, S.; Gao, W.; Shi, L. Effect of Benzalkonium Chloride Adaptation on Sensitivity to Antimicrobial Agents and Tolerance to Environmental Stresses in Listeria Monocytogenes. Front. Microbiol. 2018, 9, 2906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolten, S.; Harrand, A.S.; Skeens, J.; Wiedmann, M. Nonsynonymous Mutations in fepR Are Associated with Adaptation of Listeria Monocytogenes and Other Listeria Spp. to Low Concentrations of Benzalkonium Chloride but Do Not Increase Survival of L. Monocytogenes and Other Listeria Spp. after Exposure to Benzalkonium Chloride Concentrations Recommended for Use in Food Processing Environments. Appl. Environ. Microbiol. 2022, 88, e00486-22. [Google Scholar] [CrossRef] [Scilit]
- Douarre, P.-E.; Sévellec, Y.; Le Grandois, P.; Soumet, C.; Bridier, A.; Roussel, S. FepR as a Central Genetic Target in the Adaptation to Quaternary Ammonium Compounds and Cross-Resistance to Ciprofloxacin in Listeria Monocytogenes. Front. Microbiol. 2022, 13, 864576. [Google Scholar] [CrossRef] [Scilit]
- Bland, R.; Waite-Cusic, J.; Weisberg, A.J.; Riutta, E.R.; Chang, J.H.; Kovacevic, J. Adaptation to a Commercial Quaternary Ammonium Compound Sanitizer Leads to Cross-Resistance to Select Antibiotics in Listeria Monocytogenes Isolated From Fresh Produce Environments. Front. Microbiol. 2021, 12, 782920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kode, D.; Nannapaneni, R.; Bansal, M.; Chang, S.; Cheng, W.-H.; Sharma, C.S.; Kiess, A. Low-Level Tolerance to Fluoroquinolone Antibiotic Ciprofloxacin in QAC-Adapted Subpopulations of Listeria Monocytogenes. Microorganisms 2021, 9, 1052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kode, D.; Nannapaneni, R.; Chang, S. Low-Level Tolerance to Antibiotic Trimethoprim in QAC-Adapted Subpopulations of Listeria Monocytogenes. Foods 2021, 10, 1800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quereda, J.J.; Morón-García, A.; Palacios-Gorba, C.; Dessaux, C.; García-del Portillo, F.; Pucciarelli, M.G.; Ortega, A.D. Pathogenicity and Virulence of Listeria Monocytogenes: A Trip from Environmental to Medical Microbiology. Virulence 2021, 12, 2509–2545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawacka, I.; Pietrzak, B.; Schmidt, M.; Olejnik-Schmidt, A. Listeria Monocytogenes Isolates from Meat Products and Processing Environment in Poland Are Sensitive to Commonly Used Antibiotics, with Rare Cases of Reduced Sensitivity to Ciprofloxacin. Life 2023, 13, 821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawacka, I.; Olejnik-Schmidt, A. High Prevalence of Virulence-Associated Genes and Length Polymorphism in actA and inlB Genes Identified in Listeria Monocytogenes Isolates from Meat Products and Meat-Processing Environments in Poland. Pathogens 2024, 13, 444. [Google Scholar] [CrossRef] [Scilit]
- Daeschel, D.; Pettengill, J.B.; Wang, Y.; Chen, Y.; Allard, M.; Snyder, A.B. Genomic Analysis of Listeria Monocytogenes from US Food Processing Environments Reveals a High Prevalence of QAC Efflux Genes but Limited Evidence of Their Contribution to Environmental Persistence. BMC Genom. 2022, 23, 488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurpas, M.; Osek, J.; Moura, A.; Leclercq, A.; Lecuit, M.; Wieczorek, K. Genomic Characterization of Listeria Monocytogenes Isolated From Ready-to-Eat Meat and Meat Processing Environments in Poland. Front. Microbiol. 2020, 11, 1412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cooper, A.L.; Carrillo, C.D.; DeschÊnes, M.; Blais, B.W. Genomic Markers for Quaternary Ammonium Compound Resistance as a Persistence Indicator for Listeria Monocytogenes Contamination in Food Manufacturing Environments. J. Food Prot. 2021, 84, 389–398. [Google Scholar] [CrossRef] [Scilit]
- El-Zamkan, M.A.; Hendy, B.A.; Diab, H.M.; Marraiki, N.; Batiha, G.E.-S.; Saber, H.; Younis, W.; Thangamani, S.; Alzahrani, K.J.; Ahmed, A.S. Control of Virulent Listeria Monocytogenes Originating from Dairy Products and Cattle Environment Using Marine Algal Extracts, Silver Nanoparticles Thereof, and Quaternary Disinfectants. Infect. Drug Resist. 2021, 14, 2721–2739. [Google Scholar] [CrossRef] [Scilit]
- Chmielowska, C.; Korsak, D.; Szuplewska, M.; Grzelecka, M.; Maćkiw, E.; Stasiak, M.; Macion, A.; Skowron, K.; Bartosik, D. Benzalkonium Chloride and Heavy Metal Resistance Profiles of Listeria Monocytogenes Strains Isolated from Fish, Fish Products and Food-Producing Factories in Poland. Food Microbiol. 2021, 98, 103756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaskulski, I.B.; Scheik, L.K.; Kleinubing, N.; Haubert, L.; Kroning, I.; Lopes, G.V.; Silva, W. Listeria Monocytogenes from Food and Food Industry Environments with Reduced Susceptibility to Benzalkonium Chloride, Sodium Hypochlorite, and Peracetic Acid. FEMS Microbiol. Lett. 2023, 370, fnad019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minarovičová, J.; Véghová, A.; Mikulášová, M.; Chovanová, R.; Šoltýs, K.; Drahovská, H.; Kaclíková, E. Benzalkonium Chloride Tolerance of Listeria Monocytogenes Strains Isolated from a Meat Processing Facility Is Related to Presence of Plasmid-Borne bcrABC Cassette. Antonie Van Leeuwenhoek 2018, 111, 1913–1923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mullapudi, S.; Siletzky, R.M.; Kathariou, S. Heavy-Metal and Benzalkonium Chloride Resistance of Listeria Monocytogenes Isolates from the Environment of Turkey-Processing Plants. Appl. Environ. Microbiol. 2008, 74, 1464–1468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moura, A.; Lefrancq, N.; Wirth, T.; Leclercq, A.; Borges, V.; Gilpin, B.; Dallman, T.J.; Frey, J.; Franz, E.; Nielsen, E.M.; et al. Emergence and Global Spread of Listeria Monocytogenes Main Clinical Clonal Complex. Sci. Adv. 2021, 7, eabj9805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guidi, F.; Lorenzetti, C.; Centorotola, G.; Torresi, M.; Cammà, C.; Chiaverini, A.; Pomilio, F.; Blasi, G. Atypical Serogroup IVb-v1 of Listeria Monocytogenes Assigned to New ST2801, Widely Spread and Persistent in the Environment of a Pork-Meat Producing Plant of Central Italy. Front. Microbiol. 2022, 13, 930895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawacka, I.; Olejnik-Schmidt, A. Genoserotyping of Listeria Monocytogenes Strains Originating from Meat Products and Meat Processing Environments. ŻNTJ 2022, 2, 34–44. [Google Scholar] [CrossRef] [Scilit]
- Richard, C.; Brillet, A.; Pilet, M.F.; Prevost, H.; Drider, D. Evidence on Inhibition of Listeria Monocytogenes by Divercin V41 Action. Lett. Appl. Microbiol. 2003, 36, 288–292. [Google Scholar] [CrossRef] [Scilit]
- Kropac, A.C.; Eshwar, A.K.; Stephan, R.; Tasara, T. New Insights on the Role of the pLMST6 Plasmid in Listeria Monocytogenes Biocide Tolerance and Virulence. Front. Microbiol. 2019, 10, 1538. [Google Scholar] [CrossRef] [Scilit]
- Clayton, E.M.; Daly, K.M.; Guinane, C.M.; Hill, C.; Cotter, P.D.; Ross, P.R. Atypical Listeria Innocua Strains Possess an Intact LIPI-3. BMC Microbiol. 2014, 14, 58. [Google Scholar] [CrossRef] [Scilit]
- Morgulis, A.; Coulouris, G.; Raytselis, Y.; Madden, T.L.; Agarwala, R.; Schäffer, A.A. Database Indexing for Production MegaBLAST Searches. Bioinformatics 2008, 24, 1757–1764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A Greedy Algorithm for Aligning DNA Sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Response to BC | Number of Isolates (%) |
|---|---|
| Sensitivity | 71 (46.4%) |
| Intermediate | 3 (2.0%) |
| Reduced sensitivity | 79 (51.6%) |
| Gene Profile | Number of Isolates (%) | |||
|---|---|---|---|---|
| emrC | bcrABC | qacH | ilsA | |
| − | − | − | − | 69 (45.1%) |
| + | − | − | − | 59 (38.6%) |
| − | − | − | + | 15 (9.8%) |
| − | + | − | − | 5 (3.3%) |
| + | − | − | + | 3 (2.0)% |
| + | − | + | − | 1 (0.7)% |
| + | + | − | − | 1 (0.7)% |
| Gene | Primers | Amplicon Size [bp] | Cycling Conditions | Reference |
|---|---|---|---|---|
| bcrABC | F: CATTAGAAGCAGTCGCAAAGCA R: GTTTTCGTGTCAGCAGATCTTTGA | 1100 | 94 °C 5 min; (94 °C 30 s; 57 °C 50 s; 72 °C 60 s) × 30; 72 °C 5 min | [12] |
| emrC | F: TTATTCCATTTTATTACTGGCAATG R: CGTATTTATATTTAACACTAGCCA | 387 | 94 °C 2 min; (94 °C 15 s; 50 °C 30 s; 72 °C 30 s) × 36; 72 °C 5 min | [41] |
| qacH | F: ATGTCATATCTATATTTAGC R: TCACTCTTCATTAATTGTAATAG | 366 | 95 °C 5 min; (95 °C 25 s; 48 °C 40 s; 72 °C 40 s) × 35; 72 °C 5 min | [32] |
| ilsA | F: CGATTTCACAATGTGATAGGATG R: GCACATGCACCTCATAAC | 280 | 94 °C 5 min; (94 °C 30 s; 52 °C 30 s; 72 °C 60 s) × 30; 72 °C 5 min | [42] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kawacka, I.; Olejnik-Schmidt, A. Gene emrC Associated with Resistance to Quaternary Ammonium Compounds Is Common among Listeria monocytogenes from Meat Products and Meat Processing Plants in Poland. Antibiotics 2024, 13, 749. https://doi.org/10.3390/antibiotics13080749
Kawacka I, Olejnik-Schmidt A. Gene emrC Associated with Resistance to Quaternary Ammonium Compounds Is Common among Listeria monocytogenes from Meat Products and Meat Processing Plants in Poland. Antibiotics. 2024; 13(8):749. https://doi.org/10.3390/antibiotics13080749
Chicago/Turabian StyleKawacka, Iwona, and Agnieszka Olejnik-Schmidt. 2024. "Gene emrC Associated with Resistance to Quaternary Ammonium Compounds Is Common among Listeria monocytogenes from Meat Products and Meat Processing Plants in Poland" Antibiotics 13, no. 8: 749. https://doi.org/10.3390/antibiotics13080749
APA StyleKawacka, I., & Olejnik-Schmidt, A. (2024). Gene emrC Associated with Resistance to Quaternary Ammonium Compounds Is Common among Listeria monocytogenes from Meat Products and Meat Processing Plants in Poland. Antibiotics, 13(8), 749. https://doi.org/10.3390/antibiotics13080749

