Emergence of Rarely Reported Extensively Drug-Resistant Salmonella Enterica Serovar Paratyphi B among Patients in East China
Abstract
1. Introduction
2. Results
2.1. Salmonella Paratyphi B Isolates in Jiangsu
2.2. Pan-Genome and Phylogenetic Analysis of Salmonella Paratyphi B Isolates Collected from Jiangsu
2.3. Phylogenetic Analysis of the Global Sequences of ST2814 and ST42
2.4. Antibiotic Resistance Profile and Associated Resistance Determinants
2.5. Quinolone, Third-Generation Cephalosporin, and Tetracycline Resistance Mechanism
2.6. Transferability Test of Plasmids of XDR Strains
2.7. Genetic Localization of the MDR Region on Plasmids
2.8. Analysis of Multidrug-Resistance ramAp-Related Genes’ Expression and Genetic Environment
2.9. Genetic Localization of the MDR Region on Chromosomes
3. Discussion
4. Materials and Methods
4.1. Bacterial Strain Collection and Identification
4.2. Antimicrobial Susceptibility Testing
4.3. Whole Genome Sequencing, Assembly, Typing, and Plasmid Replicon Identification
4.4. Pan-Genome Analysis
4.5. Phylogenetic Analysis
4.6. Analysis of Resistance Genes and Islands
4.7. MDR-Harboring Plasmids and ICE Analysis
4.8. Transferability Analysis and Conjugation Experiment
4.9. Analysis of ramAp-Related Genes’ Expression and Genetic Localization
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stanaway, J.D.; Reiner, R.C.; Blacker, B.F.; Goldberg, E.M.; Khalil, I.A.; Troeger, C.E.; Andrews, J.R.; Bhutta, Z.A.; Crump, J.A.; Im, J.; et al. The Global Burden of Typhoid and Paratyphoid Fevers: A Systematic Analysis for the Global Burden of Disease Study 2017. Lancet Infect. Dis. 2019, 19, 369–381. [Google Scholar] [CrossRef]
- Sahastrabuddhe, S.; Carbis, R.; Wierzba, T.F.; Ochiai, R.L. Increasing Rates of Salmonella Paratyphi A and the Current Status of Its Vaccine Development. Expert Rev. Vaccines 2013, 12, 1021–1031. [Google Scholar] [CrossRef]
- Sánchez-Vargas, F.M.; Abu-El-Haija, M.A.; Gómez-Duarte, O.G. Salmonella Infections: An Update on Epidemiology, Management, and Prevention. Travel Med. Infect. Dis. 2011, 9, 263–277. [Google Scholar] [CrossRef]
- Denny, J.; Threlfall, J.; Takkinen, J.; Lofdahl, S.; Westrell, T.; Varela, C.; Adak, B.; Boxall, N.; Ethelberg, S.; Torpdahl, M.; et al. Multinational Salmonella Paratyphi B Variant Java (Salmonella Java) Outbreak, August–December 2007. Euro Surveill. 2007, 12, 3332. [Google Scholar] [CrossRef]
- Krishnasamy, V.; Stevenson, L.; Koski, L.; Kellis, M.; Schroeder, B.; Sundararajan, M.; Ladd-Wilson, S.; Sampsel, A.; Mannell, M.; Classon, A.; et al. Notes from the Field: Investigation of an Outbreak of Salmonella Paratyphi B Variant L(+) Tartrate + (Java) Associated with Ball Python Exposure—United States, 2017. MMWR Morb. Mortal. Wkly. Rep. 2018, 67, 562–563. [Google Scholar] [CrossRef]
- Hernández, E.; Rodriguez, J.L.; Herrera-León, S.; García, I.; de Castro, V.; Muniozguren, N. Salmonella Paratyphi B Var Java Infections Associated with Exposure to Turtles in Bizkaia, Spain, September 2010 to October 2011. Eurosurveillance 2012, 17, 20201. [Google Scholar]
- Fidler, K.; Dudley, J.; Cloke, R.; Nicholls, M.; Greig, D.R.; Dallman, T.J.; Chattaway, M.A.; Godbole, G. Salmonella Paratyphi B. Public Health and Parental Choice: When to Treat Asymptomatic Carriers of Infection? Pediatr. Infect. Dis. J. 2021, 40, E374–E378. [Google Scholar] [CrossRef]
- Chattaway, M.A.; Shersby, N.; Katwa, P.; Adair, K.; Painset, A.; Godbole, G. Genomic Sentinel Surveillance: Salmonella Paratyphi B Outbreak in Travellers Coinciding with a Mass Gathering in Iraq. Microb. Genom. 2023, 9, 000940. [Google Scholar] [CrossRef]
- Hassan, R.; Tecle, S.; Adcock, B.; Kellis, M.; Weiss, J.; Saupe, A.; Sorenson, A.; Klos, R.; Blankenship, J.; Blessington, T.; et al. Multistate Outbreak of Salmonella Paratyphi B Variant L(+) Tartrate(+) and Salmonella Weltevreden Infections Linked to Imported Frozen Raw Tuna: USA, March-July 2015. Epidemiol. Infect. 2018, 146, 1461–1467. [Google Scholar] [CrossRef]
- Heiman Marshall, K.E.; Booth, H.; Harrang, J.; Lamba, K.; Folley, A.; Ching-Lee, M.; Hannapel, E.; Greene, V.; Classon, A.; Whitlock, L.; et al. New Product, Old Problem(s): Multistate Outbreak of Salmonella Paratyphi B Variant L(+) Tartrate(+) Infections Linked to Raw Sprouted Nut Butters, October, 2015. Epidemiol. Infect. 2018, 147, e20. [Google Scholar] [CrossRef]
- Toboldt, A.; Tietze, E.; Helmuth, R.; Fruth, A.; Junker, E.; Malorny, B. Human Infections Attributable to the D-Tartrate-Fermenting Variant of Salmonella enterica Serovar Paratyphi B in Germany Originate in Reptiles and, on Rare Occasions, Poultry. Appl. Environ. Microbiol. 2012, 78, 7347–7357. [Google Scholar] [CrossRef]
- Stratton, J.; Stefaniw, L.; Grimsrud, K.; Werker, D.H.; Ellis, A.; Ashton, E.; Chui, L.; Blewett, E.; Ahmed, R.; Clark, C.; et al. Outbreak of Salmonella Paratyphi B Var Java Due to Contaminated Alfalfa Sprouts in Alberta, British Columbia and Saskatchewan. Can. Commun. Dis. Rep. 2001, 27, 133. [Google Scholar]
- Levings, R.S.; Lightfoot, D.; Hall, R.M.; Djordjevic, S.P. Aquariums as Reservoirs for Multidrug-Resistant Salmonella Paratyphi B. Emerg. Infect. Dis. 2006, 12, 507–510. [Google Scholar] [CrossRef]
- Ricardo Castellanos, L.; van der Graaf-Van Bloois, L.; Donado-Godoy, P.; Veldman, K.; Duarte, F.; Acuña, M.T.; Jarquín, C.; Weill, F.X.; Mevius, D.J.; Wagenaar, J.A.; et al. Antimicrobial Resistance in Salmonella enterica Serovar Paratyphi B Variant Java in Poultry from Europe and Latin America. Emerg. Infect. Dis. 2020, 26, 1164–1173. [Google Scholar] [CrossRef]
- Doumith, M.; Godbole, G.; Ashton, P.; Larkin, L.; Dallman, T.; Day, M.; Day, M.; Muller-Pebody, B.; Ellington, M.J.; de Pinna, E.; et al. Detection of the Plasmid-Mediated Mcr-1 Gene Conferring Colistin Resistance in Human and Food Isolates of Salmonella enterica and Escherichia coli in England and Wales. J. Antimicrob. Chemother. 2016, 71, 2300–2305. [Google Scholar] [CrossRef]
- Kuehn, R.; Stoesser, N.; Eyre, D.; Darton, T.C.; Basnyat, B.; Parry, C.M. Treatment of Enteric Fever (Typhoid and Paratyphoid Fever) with Cephalosporins. Cochrane Database Syst. Rev. 2022, 2022, CD010452. [Google Scholar] [CrossRef]
- Kehrenberg, C.; de Jong, A.; Friederichs, S.; Cloeckaert, A.; Schwarz, S. Molecular Mechanisms of Decreased Susceptibility to Fluoroquinolones in Avian Salmonella serovars and Their Mutants Selected during the Determination of Mutant Prevention Concentrations. J. Antimicrob. Chemother. 2007, 59, 886–892. [Google Scholar] [CrossRef]
- de Toro, M.; Sáenz, Y.; Cercenado, E.; Rojo-Bezares, B.; García-Campello, M.; Undabeitia, E.; Torres, C. Genetic Characterization of the Mechanisms of Resistance to Amoxicillin/Clavulanate and Third-Generation Cephalosporins in Salmonella enterica from Three Spanish Hospitals. Int. Microbiol. 2011, 14, 173–181. [Google Scholar] [CrossRef]
- Sharma, P.; Kumari, B.; Dahiya, S.; Kulsum, U.; Kumar, S.; Manral, N.; Pandey, S.; Kaur, P.; Sood, S.; Das, B.K.; et al. Azithromycin Resistance Mechanisms in Typhoidal Salmonellae in India: A 25 Years Analysis. Indian J. Med. Res. 2019, 149, 404–411. [Google Scholar] [CrossRef]
- Sajib, M.S.I.; Tanmoy, A.M.; Hooda, Y.; Rahman, H.; Andrews, J.R.; Garrett, D.O.; Endtz, H.P.; Saha, S.K.; Saha, S. Tracking the Emergence of Azithromycin Resistance in Multiple Genotypes of Typhoidal Salmonella. mBio 2021, 12, e03481-20. [Google Scholar] [CrossRef]
- Kinana, A.D.; Vargiu, A.V.; May, T.; Nikaido, H. Aminoacyl β-Naphthylamides as Substrates and Modulators of AcrB Multidrug Efflux Pump. Proc. Natl. Acad. Sci. USA 2016, 113, 1405–1410. [Google Scholar] [CrossRef]
- Hong, Y.P.; Wang, Y.W.; Chen, B.H.; Song, H.Y.; Chiou, C.S.; Chen, Y.T. RamAp Is an Efflux Pump Regulator Carried by an IncHI2 Plasmid. Antimicrob. Agents Chemother. 2022, 66, e0115221. [Google Scholar] [CrossRef]
- Borowiak, M.; Fischer, J.; Hammerl, J.A.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a Novel Transposon-Associated Phosphoethanolamine Transferase Gene, Mcr-5, Conferring Colistin Resistance in d-Tartrate Fermenting Salmonella enterica Subsp. enterica Serovar Paratyphi B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef]
- Wei, Z.-Q.; Chang, H.-L.; Li, Y.-F.; Xu, X.-B.; Zeng, M. Clinical Epidemiology and Antimicrobial Resistance of Nontyphoidal Salmonella Enteric Infections in Children: 2012-2014. Zhonghua Er Ke Za Zhi = Chin. J. Pediatr. 2016, 54, 489–495. [Google Scholar]
- Zakir, M.; Khan, M.; Umar, M.I.; Murtaza, G.; Ashraf, M.; Shamim, S. Emerging Trends of Multidrug-Resistant (Mdr) and Extensively Drug-Resistant (Xdr) Salmonella Typhi in a Tertiary Care Hospital of Lahore, Pakistan. Microorganisms 2021, 9, 2484. [Google Scholar] [CrossRef]
- Luo, Q.; Wan, F.; Yu, X.; Zheng, B.; Chen, Y.; Gong, C.; Fu, H.; Xiao, Y.; Li, L. MDR Salmonella enterica Serovar Typhimurium ST34 Carrying Mcr-1 Isolated from Cases of Bloodstream and Intestinal Infection in Children in China. J. Antimicrob. Chemother. 2020, 5, 92–95. [Google Scholar] [CrossRef]
- She, Y.; Jiang, Y.; Luo, M.; Duan, X.; Xie, L.; Yang, C.; Xu, L.; Fu, Y.; Lv, Z.; Cai, R.; et al. Emergence of Chromosomally Located BlaCTX-M-14b and QnrS1 in Salmonella enterica Serotype Kentucky ST198 in China. Int. J. Antimicrob. Agents 2023, 62, 106896. [Google Scholar] [CrossRef]
- Manesh, A.; Meltzer, E.; Jin, C.; Britto, C.; Deodhar, D.; Radha, S.; Schwartz, E.; Rupali, P. Typhoid and Paratyphoid Fever: A Clinical Seminar. J. Travel Med. 2021, 28, taab012. [Google Scholar] [CrossRef]
- Cao, Y.; Han, Y.; Liu, F.; Liao, Q.; Li, J.; Diao, B.; Fan, F.; Kan, B.; Yan, M. Epidemiological Characteristics and Molecular Typing of Typhoid and Paratyphoid in China, 2009–2013. Chin. J. Endem. 2018, 39, 337–341. [Google Scholar]
- Cao, C.; Niu, Q.; Chen, J.; Xu, X.; Sheng, H.; Cui, S.; Liu, B.; Yang, B. Epidemiology and Characterization of CTX-M-55-Type Extended-Spectrum β-Lactamase-Producing Salmonella enterica Serovar Enteritidis Isolated from Patients in Shanghai, China. Microorganisms 2021, 9, 260. [Google Scholar] [CrossRef]
- Zhang, C.-Z.; Ding, X.-M.; Lin, X.-L.; Sun, R.-Y.; Lu, Y.-W.; Cai, R.-M.; Webber, M.-A.; Ding, H.-Z.; Jiang, H.-X. The Emergence of Chromosomally Located BlaTX-M-55 in Salmonella from Foodborne Animals in China. Front. Microbiol. 2019, 10, 1268. [Google Scholar] [CrossRef]
- Nadimpalli, M.; Fabre, L.; Yith, V.; Sem, N.; Gouali, M.; Delarocque-Astagneau, E.; Sreng, N.; Le Hello, S. CTX-M-55-Type ESBL-Producing Salmonella enterica Are Emerging among Retail Meats in Phnom Penh, Cambodia. J. Antimicrob. Chemother. 2019, 74, 342–348. [Google Scholar] [CrossRef]
- Octavia, S.; Chew, K.L.; Lin, R.T.P.; Teo, J.W.P. Whole Genome Sequencing of Salmonella enterica Serovar Saintpaul for Elucidating the Mechanisms of Resistance to Third Generation Cephalosporins. Pathology 2021, 53, 768–772. [Google Scholar] [CrossRef]
- Yang, J.-T.; Zhang, L.-J.; Lu, Y.; Zhang, R.-M.; Jiang, H.-X. Genomic Insights into Global Bla CTX-M-55 -Positive Escherichia coli Epidemiology and Transmission Characteristics. Microbiol. Spectr. 2023, 11, e01089-23. [Google Scholar] [CrossRef]
- Eaves, D.J.; Randall, L.; Gray, D.T.; Buckley, A.; Woodward, M.J.; White, A.P.; Piddock, L.J.V. Prevalence of Mutations within the Quinolone Resistance-Determining Region of GyrA, GyrB, ParC, and ParE and Association with Antibiotic Resistance in Quinolone-Resistant Salmonella enterica. Antimicrob. Agents Chemother. 2004, 48, 4012–4015. [Google Scholar] [CrossRef]
- Ruiz, J. Transferable Mechanisms of Quinolone Resistance from 1998 Onward. Clin. Microbiol. Rev. 2019, 32, e00007-19. [Google Scholar] [CrossRef]
- Sjölund-Karlsson, M.; Howie, R.; Rickert, R.; Krueger, A.; Tran, T.-T.; Zhao, S.; Ball, T.; Haro, J.; Pecic, G.; Joyce, K.; et al. Plasmid-Mediated Quinolone Resistance among Non-Typhi Salmonella enterica Isolates, USA. Emerg. Infect. Dis. 2010, 16, 1789–1791. [Google Scholar] [CrossRef]
- Tuckman, M.; Petersen, P.J.; Projan, S.J. Mutations in the Interdomain Loop Region of the TetA(A) Tetracycline Resistance Gene Increase Efflux of Minocycline and Glycylcyclines. Microb. Drug Resist. 2000, 6, 277–282. [Google Scholar] [CrossRef]
- Chiu, S.K.; Huang, L.Y.; Chen, H.; Tsai, Y.K.; Liou, C.H.; Lin, J.C.; Siu, L.K.; Chang, F.Y.; Yeh, K.M. Roles of RamR and Tet(A) Mutations in Conferring Tigecycline Resistance in Carbapenem-Resistant Klebsiella Pneumoniae Clinical Isolates. Antimicrob. Agents Chemother. 2017, 61, e00391-17. [Google Scholar] [CrossRef]
- Du, D.; Wang, Z.; James, N.R.; Voss, J.E.; Klimont, E.; Ohene-Agyei, T.; Venter, H.; Chiu, W.; Luisi, B.F. Structure of the AcrAB-TolC Multidrug Efflux Pump. Nature 2014, 509, 512–515. [Google Scholar] [CrossRef]
- Chen, W.; Fang, T.; Zhou, X.; Zhang, D.; Shi, X.; Shi, C. IncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates. Front. Microbiol. 2016, 7, 1566. [Google Scholar] [CrossRef]
- Weill, F.X.; Fabre, L.; Grandry, B.; Grimont, P.A.D.; Casin, I. Multiple-Antibiotic Resistance in Salmonella enterica Serotype Paratyphi B Isolates Collected in France between 2000 and 2003 Is Due Mainly to Strains Harboring Salmonella Genomic Islands 1, 1-B, and 1-C. Antimicrob. Agents Chemother. 2005, 49, 2793–2801. [Google Scholar] [CrossRef]
- Ahmed, A.M.; Furuta, K.; Shimomura, K.; Kawamoto, H.; Shimamoto, T. Characterization of a Multidrug-Resistant Isolate of Salmonella Paratyphi B from Japan. J. Antimicrob. Chemother. 2005, 56, 250–250a. [Google Scholar] [CrossRef]
- Arai, N.; Sekizuka, T.; Tamamura, Y.; Kusumoto, M.; Hinenoya, A.; Yamasaki, S.; Iwata, T.; Watanabe-Yanai, A.; Kuroda, M.; Akiba, M. Salmonella Genomic Island 3 Is an Integrative and Conjugative Element and Contributes to Copper and Arsenic Tolerance of Salmonella enterica. Antimicrob. Agents Chemother. 2019, 63, e00429-19. [Google Scholar] [CrossRef]
- CLSI M100; Performance Standards for Antimicrobial Susceptibility Testing, 32th ed. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2022.
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, 14th ed.; The European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2024. [Google Scholar]
- Akram, J.; Khan, A.S.; Khan, H.A.; Gilani, S.A.; Akram, S.J.; Ahmad, F.J.; Mehboob, R. Extensively Drug-Resistant (XDR) Typhoid: Evolution, Prevention, and Its Management. BioMed Res. Int. 2020, 2020, 6432580. [Google Scholar] [CrossRef]
- Zhou, Z.; Alikhan, N.F.; Mohamed, K.; Fan, Y.; Achtman, M. The EnteroBase User’s Guide, with Case Studies on Salmonella Transmissions, Yersinia pestis Phylogeny, and Escherichia Core Genomic Diversity. Genome Res. 2020, 30, 138–152. [Google Scholar] [CrossRef]
- Tonkin-Hill, G.; Lees, J.A.; Bentley, S.D.; Frost, S.D.W.; Corander, J. RhierBAPs: An R Implementation of the Population Clustering Algorithm Hierbaps. Wellcome Open Res. 2018, 3, 93. [Google Scholar] [CrossRef]
- Yoshida, C.E.; Kruczkiewicz, P.; Laing, C.R.; Lingohr, E.J.; Gannon, V.P.J.; Nash, J.H.E.; Taboada, E.N. The Salmonella in Silico Typing Resource (SISTR): An Open Web-Accessible Tool for Rapidly Typing and Subtyping Draft Salmonella Genome Assemblies. PLoS ONE 2016, 11, e0147101. [Google Scholar] [CrossRef]
- Carattoli, A.; Hasman, H. PlasmidFinder and In Silico PMLST: Identification and Typing of Plasmid Replicons in Whole-Genome Sequencing (WGS). In Methods in Molecular Biology; Humana: New York, NY, USA, 2020. [Google Scholar]
- Carattoli, A.; Bertini, A.; Villa, L.; Falbo, V.; Hopkins, K.L.; Threlfall, E.J. Identification of Plasmids by PCR-Based Replicon Typing. J. Microbiol. Methods 2005, 63, 219–228. [Google Scholar] [CrossRef]
- Emms, D.M.; Kelly, S. OrthoFinder: Solving Fundamental Biases in Whole Genome Comparisons Dramatically Improves Orthogroup Inference Accuracy. Genome Biol. 2015, 16, 157. [Google Scholar] [CrossRef]
- Seemann, T. Snippy. Fast Bacterial Variant Calling from NGS. Version 4.6.0. Available online: https://github.com/tseemann/snippy (accessed on 2 April 2024).
- Croucher, N.J.; Page, A.J.; Connor, T.R.; Delaney, A.J.; Keane, J.A.; Bentley, S.D.; Parkhill, J.; Harris, S.R. Rapid Phylogenetic Analysis of Large Samples of Recombinant Bacterial Whole Genome Sequences Using Gubbins. Nucleic Acids Res. 2015, 43, e15. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML Version 8: A Tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Kehrenberg, C.; Friederichs, S.; de Jong, A.; Michael, G.B.; Schwarz, S. Identification of the Plasmid-Borne Quinolone Resistance Gene QnrS in Salmonella enterica Serovar Infantis. J. Antimicrob. Chemother. 2006, 58, 18–22. [Google Scholar] [CrossRef]
- Alikhan, N.F.; Petty, N.K.; Ben Zakour, N.L.; Beatson, S.A. BLAST Ring Image Generator (BRIG): Simple Prokaryote Genome Comparisons. BMC Genom. 2011, 12, 402. [Google Scholar] [CrossRef]
- Yuki, S. PyGenomeViz: A Genome Visualization Python Package for Comparative Genomics. Version 0.4.4. Available online: https://github.com/moshi4/pyGenomeViz (accessed on 2 April 2024).
- Hyatt, D.; Chen, G.L.; LoCascio, P.F.; Land, M.L.; Larimer, F.W.; Hauser, L.J. Prodigal: Prokaryotic Gene Recognition and Translation Initiation Site Identification. BMC Bioinform. 2010, 11, 119. [Google Scholar] [CrossRef]
- Schwengers, O.; Jelonek, L.; Dieckmann, M.A.; Beyvers, S.; Blom, J.; Goesmann, A. Bakta: Rapid and Standardized Annotation of Bacterial Genomes via Alignment-Free Sequence Identification. Microb. Genom. 2021, 7, 000685. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- O’Leary, N.A.; Wright, M.W.; Brister, J.R.; Ciufo, S.; Haddad, D.; McVeigh, R.; Rajput, B.; Robbertse, B.; Smith-White, B.; Ako-Adjei, D.; et al. Reference Sequence (RefSeq) Database at NCBI: Current Status, Taxonomic Expansion, and Functional Annotation. Nucleic Acids Res. 2016, 44, D733–D745. [Google Scholar] [CrossRef]
- Schmartz, G.P.; Hartung, A.; Hirsch, P.; Kern, F.; Fehlmann, T.; Müller, R.; Keller, A. PLSDB: Advancing a Comprehensive Database of Bacterial Plasmids. Nucleic Acids Res. 2022, 50, D273–D278. [Google Scholar] [CrossRef]
- Liu, M.; Li, X.; Xie, Y.; Bi, D.; Sun, J.; Li, J.; Tai, C.; Deng, Z.; Ou, H.Y. ICEberg 2.0: An Updated Database of Bacterial Integrative and Conjugative Elements. Nucleic Acids Res. 2019, 47, D660–D665. [Google Scholar] [CrossRef]
- Johansson, M.H.K.; Bortolaia, V.; Tansirichaiya, S.; Aarestrup, F.M.; Roberts, A.P.; Petersen, T.N. Detection of Mobile Genetic Elements Associated with Antibiotic Resistance in Salmonella enterica Using a Newly Developed Web Tool: MobileElementFinder. J. Antimicrob. Chemother. 2021, 76, 101–109. [Google Scholar] [CrossRef]
- Siguier, P.; Perochon, J.; Lestrade, L.; Mahillon, J.; Chandler, M. ISfinder: The Reference Centre for Bacterial Insertion Sequences. Nucleic Acids Res. 2006, 34, D32–D36. [Google Scholar] [CrossRef]
- Tansirichaiya, S.; Rahman, M.A.; Roberts, A.P. The Transposon Registry. Mob. DNA 2019, 10, 40. [Google Scholar] [CrossRef]
- Li, X.; Xie, Y.; Liu, M.; Tai, C.; Sun, J.; Deng, Z.; Ou, H.Y. OriTfinder: A Web-Based Tool for the Identification of Origin of Transfers in DNA Sequences of Bacterial Mobile Genetic Elements. Nucleic Acids Res. 2018, 46, W229–W234. [Google Scholar] [CrossRef]
- Moura, A.; Soares, M.; Pereira, C.; Leitão, N.; Henriques, I.; Correia, A. INTEGRALL: A Database and Search Engine for Integrons, Integrases and Gene Cassettes. Bioinformatics 2009, 25, 1096–1098. [Google Scholar] [CrossRef]
- Smillie, C.; Garcillán-Barcia, M.P.; Francia, M.V.; Rocha, E.P.C.; de la Cruz, F. Mobility of Plasmids. Microbiol. Mol. Biol. Rev. 2010, 4, 434–452. [Google Scholar] [CrossRef]
- Dionisio, F.; Zilhão, R.; Gama, J.A. Interactions between Plasmids and Other Mobile Genetic Elements Affect Their Transmission and Persistence. Plasmid 2019, 102, 29–36. [Google Scholar] [CrossRef]







| Gene | Primer | Primer Sequence (5′→3′) |
|---|---|---|
| acrA | acrA-F | CCTACCAGGCGACTTACGAC |
| acrA-R | CGCCTGATCGTATTCCTGCT | |
| acrB | acrB-F | TGCCCTGTATGCTATCTCGC |
| acrB-R | ACCAGCATTACGGAGAACGG | |
| tolC | tolC-F | GATCCTGCTCGTTCAGCGTA |
| tolC-R | TTGACGTACTGGATGCCACC | |
| rpoB | rpoB-F | GTTGAAAAAGGCCGTCGCAT |
| rpoB-R | GCTCGCCAGTAGATTCGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, J.; Feng, J.; Ji, H.; Kong, X.; Hong, J.; Zhu, L.; Qian, H. Emergence of Rarely Reported Extensively Drug-Resistant Salmonella Enterica Serovar Paratyphi B among Patients in East China. Antibiotics 2024, 13, 519. https://doi.org/10.3390/antibiotics13060519
Peng J, Feng J, Ji H, Kong X, Hong J, Zhu L, Qian H. Emergence of Rarely Reported Extensively Drug-Resistant Salmonella Enterica Serovar Paratyphi B among Patients in East China. Antibiotics. 2024; 13(6):519. https://doi.org/10.3390/antibiotics13060519
Chicago/Turabian StylePeng, Jiefu, Jingchao Feng, Hong Ji, Xiaoxiao Kong, Jie Hong, Liguo Zhu, and Huimin Qian. 2024. "Emergence of Rarely Reported Extensively Drug-Resistant Salmonella Enterica Serovar Paratyphi B among Patients in East China" Antibiotics 13, no. 6: 519. https://doi.org/10.3390/antibiotics13060519
APA StylePeng, J., Feng, J., Ji, H., Kong, X., Hong, J., Zhu, L., & Qian, H. (2024). Emergence of Rarely Reported Extensively Drug-Resistant Salmonella Enterica Serovar Paratyphi B among Patients in East China. Antibiotics, 13(6), 519. https://doi.org/10.3390/antibiotics13060519

