Next Article in Journal
Detection of Potential Zoonotic Agents Isolated in Italian Shelters and the Assessment of Animal Welfare Correlation with Antimicrobial Resistance in Escherichia coli Strains
Next Article in Special Issue
Antimicrobial Resistance of Staphylococcus aureus Isolated between 2017 and 2022 from Infections at a Tertiary Care Hospital in Romania
Previous Article in Journal
Synergistic Antifungal Interaction between Pseudomonas aeruginosa LV Strain Metabolites and Biogenic Silver Nanoparticles against Candida auris
Previous Article in Special Issue
Multi-Drug Resistant Staphylococcus aureus Carriage in Abattoir Workers in Busia, Kenya
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 5
10.3390/antibiotics12050862
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Staphylococcus aureus and CA-MRSA Carriage among Brazilian Indians Living in Peri-Urban Areas and Remote Communities

by
Lígia Maria Abraão
1,2,*,
Carlos Magno Castelo Branco Fortaleza
1,
Carlos Henrique Camargo
3,
Thaís Alves Barbosa
1,
Eliane Patrícia Lino Pereira-Franchi
1,
Danilo Flávio Moraes Riboli
4,
Luiza Hubinger
4,
Mariana Fávero Bonesso
1,
Rodrigo Medeiros de Souza
5 and
Maria de Lourdes Ribeiro de Souza da Cunha
1,4,*
1
Department of Infectology, Dermatology, Diagnostic Imaging and Radiotherapy, Medical School (FMB) of Sao Paulo State University (UNESP), Botucatu 18618-970, Brazil
2
Nursing Research and Care Practices, Hospital Samaritano Higienopolis, São Paulo 01232-010, Brazil
3
Center of Bacteriology, Adolfo Lutz Institute—IAL, São Paulo 01246-000, Brazil
4
Department of Chemical and Biological Sciences, Biosciences Institute, UNESP—Universidade Estadual Paulista, Botucatu 18618-691, Brazil
5
Department of Nursing, Federal University of Acre—UFAC, Cruzeiro do Sul 69920-900, Brazil
*
Authors to whom correspondence should be addressed.
Antibiotics 2023, 12(5), 862; https://doi.org/10.3390/antibiotics12050862
Submission received: 27 March 2023 / Revised: 21 April 2023 / Accepted: 25 April 2023 / Published: 6 May 2023
(This article belongs to the Special Issue Epidemiology, Virulence Factors and Antimicrobial Resistance in Staphylococcus aureus)
Browse Figures
Review Reports Versions Notes

Abstract

:
The emergence of Community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) infections among indigenous populations has been reported. Usually, indigenous communities live in extreme poverty and are at risk of acquiring infections. In Brazil, healthcare inequality is observed in this population. To date, there are no reports of CA-MRSA infections, and no active search for asymptomatic S. aureus carriage has been conducted among Brazilian Indians. The aim of this study was to investigate the prevalence of colonization with S. aureus and CA-MRSA among Brazilian Indians. We screened 400 Indians (from near urban areas and remote hamlets) for S. aureus and CA-MRSA colonization. The isolates were submitted to clonal profiling by pulsed-field gel electrophoresis (PFGE), and selected isolates were submitted to multilocus sequence typing (MLST). Among 931 specimens (nasal and oral) from different indigenous individuals in remote hamlets, S. aureus was cultured in 190 (47.6%). Furthermore, CA-MRSA was found in three isolates (0.7%), all SCCmec type IV. PFGE analysis identified 21 clusters among the S. aureus isolates, and MLST analysis showed a predominance of sequence type 5 among these isolates. Our study revealed a higher prevalence of S. aureus carriage among Shanenawa ethnicity individuals (41.1%). Therefore, ethnicity appears to be associated with the prevalence of S. aureus in these populations.

1. Introduction

Infections caused by methicillin-resistant Staphylococcus aureus (MRSA) are of particular concern because they are harder to treat due to resistance to some antibiotics and because they are no longer limited to healthcare settings [1,2]. On the other hand, globally, strains of methicillin-sensitive S. aureus (MSSA) have been associated with a considerable burden of invasive disease, especially among indigenous communities [2,3,4,5]. Colonization by S. aureus represents a risk factor for the occurrence of autogenous infections and cross-transmission to other individuals [6]. Historically, indigenous populations have been affected by high rates of infectious diseases [2,7,8]. Outbreaks of Community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) were first described among indigenous communities. A remarkable observation was made in Australia in 1980 when a strain of MRSA arose spontaneously in remote Aboriginal communities [9,10]. There is a global trend of considerably higher rates of invasive S. aureus disease among indigenous populations [11,12,13,14].
According to the most recent Brazilian Census [15], 305 indigenous ethnic groups are found across the Brazilian territory, with a population of 896,917 indigenous people living in the country: 324,834 in urban areas and 572,083 in rural hamlets. Ethnic groups and tribes vary widely in their customs and living conditions, including food, personal hygiene, religious rituals, and housing.
To date, there are no reports of CA-MRSA infections among Brazilian Indigenous, and no active search for asymptomatic S. aureus carriage and virulence profile has been conducted. To improve our understanding of S. aureus epidemiology among Brazilian Indians, we investigated the contribution of individual, household, and pathogen-related factors associated with S. aureus carriage. The objectives of the study were to investigate the prevalence of colonization with overall S. aureus and CA-MRSA and virulence factors among Brazilian Indians. We were especially interested in comparing populations living close to urban centers with those from remote areas.

2. Results

A total of 190 S. aureus isolates were recovered from the nasal and oral mucosa of 400 individuals (116 from the São Paulo [SP] state and 284 from the Acre [AC] state). The overall prevalence of S. aureus colonization was 47.6% (95% confidence interval [CI], 42.6–52.6%) and did not differ among the two study groups (49.5% in AC, 43.1% in SP). Only three subjects (all from AC) carried CA-MRSA, with a prevalence of 0.7% (95% CI: 0.19–2.37). In addition, the CA-MRSA isolates were tested for susceptibility to penicillin, ceftaroline, quinupristin, sulfamethoxazole, clindamycin, erythromycin, and levofloxacin, showing resistance only to penicillin. All CA-MRSA strains harbored SCCmec type IV.
Among all S. aureus strains, the prevalence of the gene coding for toxic shock syndrome toxin 1 (TSST-1; tst) was 6.5%. Among genes encoding enterotoxins, sec was the most prevalent (19.9%), followed by seb (14.1%) and sea (9.4%). The genes for exfoliative toxins A (eta) and B (etb) were found in 3.6% and 6.8% of the isolates, respectively. Furthermore, 96.3%, 20.4%, and 80.6% of the isolates harbored genes for hemolysins alpha (hla), beta (hlb), and delta (hld), respectively. Biofilm genes (icaA, icaB, icaC, and icaD) were detected in 82.2%, 1.0%, 7.8%, and 72.7% of the isolates, respectively. The gene coding for Panton–Valentine leukocidin (PVL; lukS-PV) was found in 36 (13.5%) isolates. It is worth noting that all of these isolates were methicillin-susceptible.
In the analysis of risk factors associated with the carriage of S. aureus, the univariate Poisson regression model revealed a positive association with age and the number of baths (Table 1). When the factor ethnicity was observed in which the Shanenawa group (the largest group among the indigenous populations studied) was used as a reference, there was a negative association between the Teregua and Kaxinawa ethnicities and the outcome (Table 2). The Shanenawa ethnicity showed a positive association with S. aureus carriage when analyzed as a dichotomous variable and was therefore used as the reference in relation to the other ethnicities.
However, in the multivariate analysis, ethnicity was the only independent factor associated with S. aureus carriage. The age variable showed a marginally significant p-value (p = 0.08). Although age and the number of baths did not remain in the multivariate model, they seem to contribute to the outcome studied.
Considering the power of the association of ethnicity with the outcome, univariate analyses were performed comparing the prevalence of virulence factors associated with the ethnic types in order to identify differences in pathogenicity between the S. aureus isolates that colonize the indigenous groups studied. From the same perspective, risk factors (habits and customs) were analyzed, and demographic variables (income and the number of household members) were associated with S. aureus carriage according to ethnic group. The results show that the Shanenawa ethnicity stands out in relation to the prevalence of the virulence genes, as well as the variables related to habits, customs, and demographics (Table 2, Table 3 and Table 4).
PFGE typing identified 21 clusters of S. aureus isolates, most of them grouping strains from SP and AC. The dendrogram in Figure 1 shows the electrophoresis typing of the main S. aureus clusters identified in indigenous populations from the southeast and northern regions of Brazil. Of these, the following 17 isolates were typed by MLST: ST 5 (4—the most prevalent), ST 8 (2), ST 25 (2), ST 97 (2), ST 188 (2), ST 1 (1), ST 6 (1), ST 15 (1), ST 1635 (1), and SLV 7067 (1).

3. Discussion

In this study, we found that ethnicity was the only predictor associated with S. aureus colonization in Brazilian Indians. Furthermore, we identified that income was associated with the prevalence of S. aureus carriage among almost all ethnicities. Previous studies also identified a possible association between race, ethnicity, and socioeconomic status, suggesting that these factors seem to contribute to the phenomenon of S. aureus colonization [15,16]. Ethnicity is related to the collectivity of individuals, and it is distinguished by their sociocultural specificity, mainly reflected in the language, religion, habits, and living conditions of populations. Considering these facts, it is important to emphasize that most Indian populations live in agglomerations under poor hygiene and sanitation conditions, with large socioeconomic disparities that can contribute to S. aureus carriage [17].
The traditional epidemiological factors for S. aureus colonization, such as young age, male sex, underlying comorbidities, smoking, and previous hospitalization, were not relevant in the population studied, in agreement with a study investigating an Aboriginal community in Canada [18].
Despite widespread knowledge of the process of S. aureus carriage as a predictor of S. aureus infections, in Brazil, little is known about the dynamics of colonization and infection with S. aureus among indigenous populations. Our study identified a prevalence of S. aureus and CA-MRSA carriage of 47.6% and 1.0%, respectively. CA-MRSA strains were restricted to indigenous people belonging to the Amazon region of Brazil, all of them harboring SCCmec IV. A study conducted on the Amerindian population of Wayampi in the village of Trois Sauts, an isolated region in the Amazon forest of French Guiana, demonstrated rates of nasal carriage and persistent colonization with S. aureus of 57.8% and 26%, respectively. None of the isolates showed resistance to methicillin [19].
Our findings revealed that CA-MRSA was rare and, as also reported in a population-based survey conducted in Brazil, all CA-MRSA harbored SCCmec IV [20]. On the other hand, the prevalence of S. aureus was higher than that reported for the general population [20]. Antimicrobial susceptibility testing of the MRSA isolates using disks impregnated with penicillin, ceftaroline, quinupristin, sulfamethoxazole, clindamycin, erythromycin, and levofloxacin revealed sensitivity to all antimicrobials, except for penicillin. All isolates were also resistant to penicillin. According to Sader et al. [21], sensitivity rates of CA-MRSA strains are generally higher when compared to hospital-associated MRSA, especially for clindamycin and levofloxacin. The same was observed for ceftaroline, a drug that has recently been introduced on the market as an option for the treatment of infections caused by MRSA.
The results obtained regarding the detection of virulence genes show diversity in the pathogenicity profile of S. aureus isolated from indigenous populations, similar to those already identified in non-indigenous populations [22]. Among the most prevalent virulence factors were genes coding for hemolysins hla and hld and the icaA and icaD genes involved in biofilm formation. According to Bride et al. [23], these genes are often produced by a large number of S. aureus strains. The findings obtained in the present study showed 13.5% of isolates carrying the PVL gene, none of them associated with CA-MRSA. According to Boan et al. [24], infections with PVL-positive S. aureus strains disproportionately affect young indigenous people or subjects with fewer healthcare-related risk factors. In a previous study involving a non-indigenous population, only five isolates were found to harbor the gene coding for PVL, corresponding to 2.2% of all isolates [22]. Considering the specific living conditions of the indigenous populations mentioned above, it is possible to infer that such factors may contribute to S. aureus carriage and the occurrence of skin infections associated with the PVL gene (lukS-PV) [24].
The univariate analyses compared the prevalence of virulence genes associated with ethnicity type and also analyzed the risk factors (habits, customs, and demographic factors) associated with S. aureus carriage according to ethnicity; significant results were obtained for the sec, hld, tst, icaA, and icaD genes. Regarding habits, customs, and demographics, all variables tested were statistically significant: skin pigmentation, number of baths, use of medicinal herbs, baths in the river, monthly income, and number of household members. It is worth noting that individuals of the Shanenawa ethnicity, which was used as a reference and showed a positive association with S. aureus when tested as a dichotomous variable, carried the most virulent and resistant S. aureus strains. Commonly, this ethnicity more frequently exhibits habits, customs, and demographic factors that may be associated with a higher prevalence of colonization by S. aureus.
Regarding PFGE analysis, 21 clusters circulating among the indigenous populations from southeastern and northern Brazil were identified. Of these, five major clusters (1, 4, 6, 10, and 14) contained a larger number of isolates that were more prevalent among the regions studied. Interesting data were observed for these clusters in which isolates from indigenous communities in the southeast formed clusters with isolates identified in the Amazon region. Another interesting finding was that, although not one of the most prevalent, cluster 7 contained sensitive isolates that grouped with one resistant isolate belonging to ST 5. According to Robinson and Enright [25], the dissemination of genotypes occurs not only among individuals but also through the ability to transmit the mobile genetic element SCCmec IV through MSSA strains. The remaining CA-MRSA isolates formed clusters with clone USA800. This clone represents a lineage of pandemic MRSA such as CC5 [26].
The sequence type (ST) number 5 was the most frequent. This ST is one of the most prevalent clonal complexes in both hospital and community settings [27,28]. Moreover, the other STs identified in the indigenous populations studied resemble those commonly disseminated in other types of populations [29,30]. ST 5 associates with different types of SCCmec (I, II, and IV) and represents the ancestor of the clone described as a Cordobes/Chilean clone and of the MRSA pediatric epidemic clone detected in 1999 [26,31].

4. Materials and Methods

4.1. Study Design, Subjects, and Procedures

A cross-sectional, population-based study was conducted. Individuals of indigenous populations from two different Brazilian states were included. One state was São Paulo, the largest urban center of the country with an area of 1,521,110 km2 and 11,253,503 inhabitants, and the other state was Acre, located in the remote region of the Amazon forest, which comprises a large area of 8,835,520 km2 and has 377,057 inhabitants according to IBGE [14].
Our sample size was established by calculating proportions, assuming a level of significance of 5% and accuracy of 5%, according to the number of individuals in each village/hamlet. A total of 400 subjects were included in the study. Of those, 116 lived in a peri-urban village in the city of Bauru, São Paulo State (SP), southeastern Brazil, and 284 lived in small hamlets in Acre State (AC), Brazilian Amazon region. Nasal and oropharyngeal swabs were collected from September to November 2014. Data on demographics (including ethnicity), habits and customs, comorbidities, and clinical variables were collected in interviews with the subjects. Table 5 lists the variables analyzed.

4.2. Specimen Collection, Culture, and Antimicrobial Susceptibility Tests

Nasopharyngeal and oral swabs were collected, transported in Stuart medium, and cultured on a selective medium (Baird-Parker Agar) for up to 48 h. Staphylococcus aureus was identified based on colony morphology and standard biochemical tests [32]. Susceptibility to methicillin was tested by disk diffusion using cefoxitin (30 µg) disks according to the recommendations of the Clinical Laboratory Standards Institute [33]. For the MRSA isolates, susceptibility to penicillin, clindamycin, levofloxacin, erythromycin, sulfamethoxazole–trimethoprim, quinupristin–dalfopristin, and ceftaroline was tested by disk diffusion and to oxacillin and vancomycin by the E test (BioMerieux) [32].

4.3. Identification of Virulence Genes

PCR assays for the detection of virulence genes (sea, seb, sec, hla, hlb, hld, eta, etb, etd, icaA, icaB, icaC, and icaD) were performed following established protocols [34,35,36,37,38,39]. The primers and references used in this step are listed in Table 6.

4.4. Molecular Methods

Methicillin resistance was also assessed through the detection of the mecA gene by real-time PCR performed in a LightCycler system (Roche) [39]. The staphylococcal cassette chromosome (SCCmec) was characterized using the protocol described by Milheiriço et al. [40]. Pulsed-field gel electrophoresis (PFGE) was performed on SmaI-digested chromosomal DNA according to the protocol described by McDougal et al. [41]. Band patterns were analyzed with BioNumerics 7.6 (Applied Maths), and a dendrogram was generated using the unweighted pair group method with arithmetic mean (UPGMA). Clusters were defined as any group of more than four isolates with a Dice similarity coefficient ≥ 80%, assuming tolerance and optimization of 0.5 and 1.25%, respectively [41].
Representative isolates of the PFGE clusters were submitted to multilocus sequence typing (MLST) [42]. The arcC, aroE, glpF, gmk, pta, tpi, and yqIL genes were amplified separately with the specific primers described by Enright et al. [26], and both strands were sequenced. Sequence types (ST) were assigned using the BioNumerics 7.6 software [26].

4.5. Epidemiological Analysis

Data were collected and analyzed using Epi Info for Windows, version 3.5.1 (© Centers for Disease Control and Prevention, Atlanta, GA, USA) and SPSS 20.0 (IBM, Armonk, NY, USA). The base of the study was formed by subjects (indigenous people) with a culture positive for S. aureus. Univariate and multivariate Poisson regression models were built. A stepwise forward strategy was used to select variables for the multivariate models, with a p-value of 0.05 as a limit for inclusion/removal [42,43].
Figure A1 (Appendix A) shows the workflow of the methodological steps.

4.6. Ethical Issues

This study was approved by the National Committee of Ethics in Research (CONEP/CNS/MS), CAAE: 08428912.3.0000.5411, Approval number 674.368.

5. Conclusions

In conclusion, ethnicity appears to be associated with a higher prevalence of S. aureus and virulence in special populations, even though the prevalence of CA-MRSA was low. These results might be related to specific habits and customs since poor housing conditions, hygiene, and sanitation are features present in most ethnical groups and can influence the carriage and dissemination of S. aureus among populations. It is, therefore, extremely important that these factors be considered for the development and implementation of strategies designed to control the spread of microorganisms among different human populations, especially considering the health inequality of indigenous populations in Brazil.

Author Contributions

Conceptualization, L.M.A., M.d.L.R.d.S.d.C. and C.M.C.B.F.; methodology, L.M.A., R.M.d.S., T.A.B., C.H.C., M.F.B., L.H. and E.P.L.P.-F.; software, D.F.M.R. and C.H.C.; formal analysis, C.M.C.B.F.; writing—original draft preparation, L.M.A.; writing—review and editing, L.M.A., M.d.L.R.d.S.d.C., C.H.C. and C.M.C.B.F.; supervision, M.d.L.R.d.S.d.C. and C.M.C.B.F.; project administration, L.M.A. All authors have read and agreed to the published version of the manuscript.

Funding

Coordination for the Improvement of Higher Education Personnel (CAPES, number: 110938-3) and National Council for Scientific and Technological Development (CNPq—Grant 303603/2020-8).

Institutional Review Board Statement

This study was conducted in accordance with the Declaration of Helsinki, and approved by the National Committee of Ethics in Research (CONEP/CNS/MS), protocol code 08428912.3.0000.5411, approval number: 674.368, 06/09/2014.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data presented in this study are original and have not been published in scientific journals. The only document that contains these data is the doctoral thesis of Lígia Maria Abraão, openly available in [Institutional Repository of UNESP] at [https://repositorio.unesp.br/handle/11449/151310?locale-attribute=en] (accessed on 1 March 2023).

Conflicts of Interest

All authors declare no conflict of interest.

Appendix A

Antibiotics 12 00862 g0a1 550
Figure A1. Workflow of the methodological steps.
Figure A1. Workflow of the methodological steps.
Antibiotics 12 00862 g0a1

References

  1. David, M.Z.; Daum, R.S. Community-associated methicillin-resistant Staphylococcus aureus: Epidemiology and clinical consequences of an emerging epidemic. Clin. Microbiol. Rev. 2010, 23, 616–687. [Google Scholar] [CrossRef]
  2. Sutcliffe, C.G.; Grant, L.R. High Burden of Staphylococcus aureus Among Native American Individuals on the White Mountain Apache Tribal Lands. Open Forum Infect. Dis. 2020, 7, ofaa061. [Google Scholar] [CrossRef]
  3. Kanjilal, S.; Sater, M.R.A. Trends in antibiotic susceptibility in Staphylococcus aureus in Boston, Massachusetts, from 2000 to 2014. J. Clin. Microbiol. 2018, 56, e01160-17. [Google Scholar] [CrossRef]
  4. Sutcliffe, C.G.; Grant, L.R. The burden of Staphylococcus aureus among Native Americans on the Navajo Nation. PLoS ONE 2019, 14, e0213207. [Google Scholar] [CrossRef] [PubMed]
  5. Cella, C.; Sutcliffe, C.G. Carriage prevalence and genomic epidemiology of Staphylococcus aureus among Native American children and adults in the Southwestern USA. Microb. Genom. 2022, 8, mgen000806. [Google Scholar] [CrossRef] [PubMed]
  6. Mehraj, J.; Witte, W. Epidemiology of Staphylococcus aureus Nasal Carriage Patterns in the Community. Curr. Top. Microbiol. Immunol. 2016, 398, 55–87. [Google Scholar] [PubMed]
  7. Butler, J.C.; Crengle, S. Emerging infectious diseases among indigenous peoples. Emerg. Infect. Dis. 2001, 7, 554–555. [Google Scholar] [CrossRef] [PubMed]
  8. Landen, M.G.; McCumber, B.J. Asam ED, Egeland GM. Outbreak of boils in an Alaskan village: A case-control study. West. J. Med. 2000, 172, 235–239. [Google Scholar] [CrossRef]
  9. Groom, A.V.; Wolsey, D.H. Community-acquired methicillin-resistant Staphylococcus aureus in a rural American Indian community. JAMA 2001, 286, 1201–1205. [Google Scholar] [CrossRef] [PubMed]
  10. Muileboom, J.; Hamilton, M. Community-associated methicillin-resistant Staphylococcus aureus in northwest Ontario: A five-year report of incidence and antibiotic resistance. Can. J. Infect. Dis. Med. Microbiol. 2013, 24, e42–e44. [Google Scholar] [CrossRef] [PubMed]
  11. Abelson, W.H.; Banerji, A. Community-associated methicillin-resistant Staphylococcus aureus in indigenous communities in Canada. Paediatr. Child. Health 2012, 17, 395–398. [Google Scholar]
  12. Ng, J.W.S.; Holt, D.C. Phylogenetically distinct Staphylococcus aureus lineage prevalent among indigenous communities in northern Australia. J. Clin. Microbiol. 2009, 47, 2295–2300. [Google Scholar] [CrossRef] [PubMed]
  13. Tong, S.Y.C.; Varrone, L. Progressive increase in community-associated methicillin-resistant Staphylococcus aureus in indigenous populations in northern Australia from 1993 to 2012. Epidemiol. Infect. 2015, 143, 1519–1523. [Google Scholar] [CrossRef]
  14. IBGE. Instituto Brasileiro de Geografia e Estatística [Internet]. Brazil: Censo Polulações Indígenas. Available online: https://www.gov.br/funai/pt-br/assuntos/noticias/2022-02/ultimo-censo-do-ibge-registrou-quase-900-mil-indigenas-no-pais-dados-serao-atualizados-em-2022#:~:text=%C3%9Altimo%20censo%20do%20IBGE%20regi-trou,Funda%C3%A7%C3%A3o%20Nacional%20dos%20Povos%20Ind%C3%ADgenas (accessed on 12 February 2023).
  15. Tong, S.Y.; McDonald, M.I. Global implications of the emergence of community-associated methicillin-resistant Staphylococcus aureus in Indigenous populations. Clin. Infect. Dis. 2008, 46, 1871–1878. [Google Scholar] [CrossRef]
  16. Wertheim, H.F.; Melles, D.C. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 2005, 12, 751–762. [Google Scholar] [CrossRef] [PubMed]
  17. Verhagen, L.M.; Hermsen, M. Nasopharyngeal carriage of respiratory pathogens in Warao Amerindians: Significant relationship with stunting. Trop. Med. Int. Health 2017, 22, 407–414. [Google Scholar] [CrossRef] [PubMed]
  18. Daley, P.; Bajgai, J. A cross sectional study of animal and human colonization with methicillin-resistant Staphylococcus aureus (MRSA) in an Aboriginal community. BMC Public. Health 2016, 16, 1–7. [Google Scholar] [CrossRef]
  19. Ruimy, R.; Angebault, C.C. Are host genetics the predominant determinant of persistent nasal Staphylococcus aureus carriage in humans? J. Infect. Dis. 2010, 202, 924–934. [Google Scholar] [CrossRef]
  20. Pires, F.V.; Da Cunha, M.D.L.R.D.S. Nasal carriage of Staphylococcus aureus in Botucatu, Brazil: A population-based survey. PLoS ONE 2014, 9, e92537. [Google Scholar] [CrossRef]
  21. Sader, H.S.; Gales, A.C. Pathogen frequency and resistance patterns in Brazilian hospitals: Summary of results from three years of the SENTRY Antimicrobial Surveillance Program. Braz. J. Infect. Dis. 2001, 5, 200–214. [Google Scholar] [CrossRef]
  22. Abraão, L.M. Detection of Virulence Genes and Identification of the Clonal Profile of Staphylococcus aureus Isolates Colonizing the Nasopharynx Obtained in a Popular Base Study. Master’s Degree. Paulista State University “Júlio de Mesquita Filho” (UNESP), Botucatu, São Paulo State, Brazil, February 2013. Available online: https://repositorio.unesp.br/handle/11449/110458?show=full (accessed on 20 February 2023).
  23. Bride, L.L.; Pereira, M.F. Differences in resistance profiles and virulence genes among methicillin-resistant and methicillin-susceptible Staphylococcus aureus of different lineages at a public tertiary hospital. Rev. Soc. Bras. Med. Trop. 2019, 52, e20190095. [Google Scholar] [CrossRef]
  24. Boan, P.; Tan, H. Epidemiological, clinical, outcome and antibiotic susceptibility differences between PVL positive and PVL negative Staphylococcus aureus infections in Western Australia: A case control study. BMC Infect. Dis. 2015, 15, 10. [Google Scholar] [CrossRef] [PubMed]
  25. Robinson, D.A.; Enright, M.C. Evolutionary models of the emergence of methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2003, 47, 3926–3934. [Google Scholar] [CrossRef] [PubMed]
  26. Enright, M.C.; Day, N.P.J. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef] [PubMed]
  27. Shettigar, K.; Murali, T.S. Virulence factors and clonal diversity of Staphylococcus aureus in colonization and wound infection with emphasis on diabetic foot infection. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 2235–2246. [Google Scholar] [CrossRef]
  28. McGuinness, S.L.; Holt, D.C. Clinical and molecular epidemiology of an emerging Panton Valentine leukocidin-positive ST5 methicillin-resistant Staphylococcus aureus clone in northern Australia. mSphere 2021, 6, e00651-20. [Google Scholar] [CrossRef] [PubMed]
  29. Jian, Y.; Zhao, L. Increasing Prevalence of Hypervirulent ST5 Methicillin Susceptible Staphylococcus aureus Subtype Poses a Serious Clinical Threat. Emerg. Microbes Infect. 2020, 10, 109–122. [Google Scholar] [CrossRef] [PubMed]
  30. Witzel, C.; Fortaleza, C.M.C.B. Nasopharyngeal carriage of Staphylococcus aureus among imprisoned males from Brazil without exposure to healthcare: Risk factors and molecular characterization. Ann. Clin. Microbiol. Antimicrob. 2014, 13, 25. [Google Scholar] [CrossRef] [PubMed]
  31. Sola, C.; Paganini, H. Spread of epidemic MRSA-ST5-IV clone encoding PVL as a major cause of community onset staphylococcal infections in Argentinean children. PLoS ONE 2012, 7, e30487. [Google Scholar] [CrossRef] [PubMed]
  32. Konemman, E.V.; Allen, S.D. Introdução à microbiologia médica. In Diagnóstico Microbiológico: Texto e Atlas Colorido, 5th ed.; Medsi: Rio de Janeiro, Brazil, 2001; pp. 200–210. [Google Scholar]
  33. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Susceptibility Tests, 31st ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PE, USA, 2021. [Google Scholar]
  34. Johnson, W.M.; Tyler, S.D. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 1991, 29, 426–430. [Google Scholar] [CrossRef]
  35. Cunha, M.D.L.R.S.; Calsolari, R.O. Detection of enterotoxin and toxic shock syndrome toxin 1 genes in Staphylococcus, with emphasis on coagulase-negative staphylococci. Microbiol. Immunol. 2007, 51, 381–390. [Google Scholar] [CrossRef] [PubMed]
  36. Marconi, C.; Cunha, M.L.R.S. Standardization of the PCR technique for the detection of delta toxin in Staphylococcus spp. J. Venom. Anim. Toxins Incl. Trop. Dis. 2005, 11, 117–128. [Google Scholar] [CrossRef]
  37. Koning, S.; Van, B.A. Severity of nonbullous Staphylococcus aureus impetigo in children is associated with strains harboring genetic markers for exfoliative toxin B, Panton-Valentine leukocidin, and the multidrug resistance plasmid pSK41. J. Clin. Microbiol. 2003, 41, 3017–3021. [Google Scholar] [CrossRef] [PubMed]
  38. Arciola, C.R.; Gamberini, S. A multiplex PCR method for the detection of all five individual genes of ica locus in Staphylococcus epidermidis. A survey on 400 clinical isolates from prosthesis-associated infections. J. Biomed. Mater. Res. A 2005, 75, 408–413. [Google Scholar] [CrossRef] [PubMed]
  39. Fang, H.; Hedin, G. Rapid Screening and Identification of Methicillin-Resistant Staphylococcus aureus from Clinical Samples by Selective-Broth and Real-Time PCR Assay. J. Clin. Microbiol. 2003, 41, 2894–2899. [Google Scholar] [CrossRef]
  40. Milheirico, C.; Oliveira, D.C. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob. Agents Chemother. 2007, 51, 4537. [Google Scholar] [CrossRef]
  41. McDougal, L.K.; Steward, C.D. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: Establishing a National Database. J. Clin. Microbiol. 2003, 41, 5113–5120. [Google Scholar] [CrossRef]
  42. Coutinho, L.M.S.; Scazufca, M. Methods for estimating prevalence ratios in cross-sectional studies. Rev. Saude Publica 2008, 42, 992–998. [Google Scholar] [CrossRef] [PubMed]
  43. Barros, A.J.D.; Hirakata, V.N. Alternatives for logistic regression in cross-sectional studies: An empirical comparison of models that directly estimate the prevalence ratio. BMC Med. Res. Methodol. 2003, 21, 21. [Google Scholar] [CrossRef]
Antibiotics 12 00862 g001 550
Figure 1. Dendrogram showing pulsed-field gel electrophoresis and multilocus sequence typing of the main S. aureus and CA-MRSA clusters identified in Indian populations from the southeast (SO) and north (NO) regions of Brazil. ST—sequence type; RE—region; ET—ethnicity; SH—Shanenawa; PU—Puyanawa; KO—Kopenoti; TE—Teregua; KA—Kaxinawa.
Figure 1. Dendrogram showing pulsed-field gel electrophoresis and multilocus sequence typing of the main S. aureus and CA-MRSA clusters identified in Indian populations from the southeast (SO) and north (NO) regions of Brazil. ST—sequence type; RE—region; ET—ethnicity; SH—Shanenawa; PU—Puyanawa; KO—Kopenoti; TE—Teregua; KA—Kaxinawa.
Antibiotics 12 00862 g001
Table
Table 1. Poisson regression model for the analysis of risk factors associated with S. aureus.
Table 1. Poisson regression model for the analysis of risk factors associated with S. aureus.
Univariate AnalysisMultivariate Analysis
PredictorsS. aureusNegative (95% CI)p Value RR (95% CI)p Value
Demographic Variables
Women113 (59.5)112 (53.6)1.12 (0.93–1.35)0.24
Age, median (quartiles)21 (11.5–34)27 (14–43)…0.03 *0.99 (0.98–1.00)0.08
Ethnicity
Shanenawa (reference) *78 (41.1)57 (27.3)……1.36 (CI, 1.02–1.82)0.03 *
Puyanawas I22 (11.1)30 (14.4)0.73 (0.52–1.04)0.060,74 (0.46–1.20)0.22
Kaxinawa16 (8.4)34 (16.3)0.55 (0.36–0.85)0.002 *0.55 (0.32–0.94)0.03 *
Kopenoti31 (16.3)33 (15.8)0.84 (0.63–1.12)0.220.87 (0.57–1.32)0.52
Teregua19 (10.0)33 (15.8)0.63 (0.43–0.93)0.009 *0.67 (0.40–1.11)0.11
Ashaninka4 (2.1)1 (10.5)1.34 (0.87–2.20)0.321.32 (0.48–3.62)0.58
Puyanawas II21 (11.1)21 (10.1)0.87 (0.62–1.21)0.380.91 (0.56–1.38)0.7
Group (São Paulo x Acre)50 (26.3) 66 (31.6)0.89 (0.73–1.08)0.25
Income in R$, median (quartiles)688 (430–800)700 (422–815) 0.97
Schooling
Illiterate (reference)13 (6.8)23 (11.0)……
Incomplete elementary school77 (40.5)91 (43.5)1.27 (0.80–2.002)0.29
Continuing
Univariate AnalysisMultivariate AnalysisUnivariate AnalysisMultivariate AnalysisUnivariate AnalysisMultivariate AnalysisUnivariate Analysis
Complemente elementary school56 (29.5)46 (22.0)1.52 (0.45–2.43)0.052
Complete high school39 (20.5)41(19.6)1.35 (0.83–2.20)0.21
College degree5 (2.6)8 (3.8)1.07 (0.47–2.40)1.0
Brickhouse60 (31.6)71 (33.9)0.95 (0.78–1.16)0.61
Sewerage system85 (44.7)83 (39.7)1.10 (0.91–1.51)0.31
Number of household members, median (quartiles)5.5 (4.5–7)5.0 (3.0–7.5)
Distance from the health unit, median (quartiles)2.5 (2.5–5.0)2.0 (2.0–5.5) 0.52
Habits and Customs
Tattoo
Collective sports		18 (9.4)
87 (45.7)		24 (11.4)
93 (44.5)		0.90 (0.68–1.20)
1.02 (0.84–1.23)		0.62
0.80
Earrings45 (32.3)23 (44.2)0.69 (0.44–1.10)0.17
Skin pigmentation70 (36.8)76 (36.3)1.00 (0.83–1.22)0.92
Urucum55 (29.0)68 (32.5)0.92 (0.75–1.12)0.50
Jenipapo67 (35.2)38 (59.3)0.85 (0.68–1.08)0.22
Number of daily baths, median (quartiles)3.5 (2.5–4.0)3.0 (2.0–4.0)…0.04 *
Baths in the river61 (43.7)79 (37.8)0.88 (0.73–1.07)0.27
Showers131 (68.9)135 (64.5)1.09 (0.90–1.32)0.35
Use of medicinal herbs33 (17.)40 (19.1)0.94 (0.74–1.19)0.64
Use of herbal drink for rituals1 (0.53)6 (2.87)0.60 (0.44–0.82)0.07
Use of topical medicinal substances 26 (40.6)38 (59.3)0.85 (0.68–1.08)0.22
Drinking29 (15.2)32 (15.3)0.99 (0.77–1.29)0.98
Smoking34 (17.8)42 (20.1)0.93 (0.74–1.17)0.57
Clinical Variables
Diabetes8 (4.2)11 (5.2)0.90 (0.60–1.33)0.62
Skin infections A3 (1.58)2 (0.96)1.31 (0.44–3.85)0.57
Skin infections R6 (3.16)8 (3.83)0.91 (0.57–1.45)0.71
Antibiotics 22 (11.5)19 (9.0)1.14 (0.81–1.61)0.41
Recent outpatient consultations32 (16.8)26 (12.4)1.19 (0.88–1.61)0.21
Surgery17 (8.95)11 (5.26)1.35 (0.84–2.17)0.15
Hospitalization27 (14.2)34 (16.2)0.92 (0.72–1.18)0.56
Pneumonia1 (0.53)1 (0.48)1.04 (0.26–4.20)0.94
Data in numbers (%). RR, rate ratio (prevalence ratio); CI confidence interval. * Statistically significant data.
Table
Table 2. Results of the univariate analysis of risk factors associated with S. aureus carriage according to ethnicity.
Table 2. Results of the univariate analysis of risk factors associated with S. aureus carriage according to ethnicity.
ShanenawaPuyanawas IPuyanawas IIKaxinawaKopenotiTeregua
Age21 (11–33)27 (11–38)27 (11–49) *20 (10–34) *27 (13–42)31 (13–54) *
Women71 (52.6%)24 (47.1%)29 (69.0%)28 (56%)40 (62.5%)30 (57.7%)
S. aureus78 (57.8%)21 (41.2%)21 (50.0%)16 (32.0%) *31 (48.4%)19 (36.5%)
MRSA3 (2.2%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)
Number of household members, median (quartiles)6 (4–8)5 (4–5) *4 (3–8) *6 (4–8) *4 (4–6) *4 (3–6) *
Number of baths, median (quartiles)3 (3–4)3 (3–4)4 (3–4)3 (3–4)2 (1–2) *2 (2–3) *
Baths in the river68 (50.4%)15 (29.4%)9 (21.4%) *43 (86.0%) *0 (0.0%) *0 (0.0%) *
Tattoo31 (23%)3 (5.9%) *1 (2.4%) *4 (8.0%) *0 (0.0%) *3 (5.8%) *
Skin pigmentation76 (56.3%)22 (43.1%)17 (40.5%)26 (52.0%)0 (0.0%) *0 (0.0%) *
Earrings1 (0.7%)0 (0.0%)0 (0.0%)0 (0.0%)1 (1.6%)2 (3.8%)
Smoking40 (29.6%)4 (7.8%) *7 (16.7%)10 (20.0%)7 (10.9%) *7 (13.5%)
Use of snuff for rituals1 (0.7%)1 (2.0)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)
Use of herbal drink for rituals1 (0.7%)6 (11.8%) *0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)
Use of medicinal herbs **39 (28.9%)19 (37.3%)5 (11.9%)7 (14%)0 (0.0%) *1 (1.9%) *
Drinking39 (28.9%)5 (9.8%) *3 (7.1%) *9 (18.0%)3 (4.7%) *1 (1.9%) *
Collective sports80 (59.3%)31 (60.8%)20 (47.6%)33 (66%)5 (7.8%) *10 (19.2%) *
Brickhouse2 (1.5%)4 (7.8%)8 (19.0%) *3 (6.0%)63 (98.4%) *51 (98.1%) *
Income in R$, median (quartiles)632 (334–800) *600 (400–700) *670 (490–1000) *550 (200–684) *700 (550–750) *760 (700–1150)
Data in numbers (%).* Statistically significant data. ** Mixture of medicinal herbs typically used by indigenous people for the empirical treatment of diseases.
Table
Table 3. Results of the univariate analysis of risk factors associated with S. aureus carriage according to ethnicity.
Table 3. Results of the univariate analysis of risk factors associated with S. aureus carriage according to ethnicity.
Ethnicities—São Paulo & Acre
Shanenawa (%)Puyanawa I (%)Kaxinawa (%)Kopenoti (%)Teregua (%)Ashaninka (%)Puyanawas II (%)p Value
Habits and Customs PositiveNegativePositiveNegativePositiveNegativePositiveNegativePositiveNegativePositiveNegativePositiveNegative
Skin pigmentation76 (52.1)59 (23.3)22 (15.1)29 (11.5)26 (17.8)24 (9.5)-64 25.6)-52 (20.6)5 (3.4)-17 (11.6)25 (9.9)<0.01 *
Use of medicinal herbs **39 (53.4)96 (29.4)19 (26.0)32 (9.8)7 (9.6)43 (13.2)-64 (19.6)1 (1.4)51 (15.6)2 (2.7)3 (0.9)5 (6.8)37 (11.3)<0.01 *
Baths in the river68 (48.6)67 (25.9)15 (10.7)36 (13.9)43 (30.7)7 (2.7)-64 (24.7)-52 (20.1)5 (3.6)-9 (6.4)33 (12.7)<0.01 *
Number of baths, median (quartiles)3.2 (1–4)3.1 (1–4)3.2 (1–4)1.7 (1–4)2.1 (1–4)3.0 (2–4)3.5 (2–4)
Income in R$, median (quartiles)696 (50–4000)781 (70–3550)505 (60–2000)810 (134–4000)1013 (300–2500)710 (250–1400)837 (649–4000)<0.01 *
Household members, median (quartiles)6.3 (1–20)4.0 (1–9)6.0 (2–11)4.6 (1–9)3.9 (1–6)8.0 (8–8)5.2 (2–11)<0.01 *
Data in numbers (%). Positive: S. aureus. * Statistically significant data. ** Mixture of medicinal herbs typically used by indigenous people for empirical treatment of diseases.
Table
Table 4. Results of the univariate analysis of virulence factors associated with ethnicities.
Table 4. Results of the univariate analysis of virulence factors associated with ethnicities.
Univariate Analysis-Ethnicities—Acre & Sao Paulo State
Shanenawa (%)Puyanawa I (%)Kaxinawa (%)Ashaninka (%)Puyanawas II (%)Kopenoti-Sp (%)Teregua-Sp (%)
GenesPositiveNegativePositiveNegativePositiveNegativePositiveNegativePositiveNegativePositiveNegativePositiveNegativep Value
S. aureus (sau)78 (41.1)57 (27.3)21 (11.1)30 (14.4)16 (8.4)34 (16.3)4 (2.1)1 (0.5)21 (11.1)21 (10.0)31 (16.3)33 (15.8)19 (10.0)33 (15.8)0.01 *
Sea7 (38.9)72 (41.6)1 (5.6)20 (11.6) - 16 (9.2)1 (5.6)3 (1.7)1 (5.6)20 (11.6)6 (33.3)25 (14.5)2 (11.1)17 (9.8)0.27
Seb10 (37.0)69 (42.1)1 (3.7)20 (12.2)3 (11.1)13 (7.9) - 4 (2.4)2 (7.4)19 (11.6)7 (25.9)24 (14.6)4 (14.8)15 (9.1)0.47
Sec18 (47.4)61 (39.9)5 (13.2)16 (10.5)3 (7.9)13 (8.5)3 (7.9)1 (0.7)4 (10.5)17 (11.1)5 (13.2)26 (17.0) - 19 (12.4)0.03 *
Hla75 (40.8)4 (57.1)20 (10.9)1 (1.3)15 (8.2)1 (14.3)4 (2.2) - 20 (10.9)1 (14.3)31 (16.8) - 19 (10.3) - 0.81
Hld66 (42.9)13 (35.1)13 (8.4)8 (21.6)11 (7.1)5 (13.5)3 (1.9)1 (2.7)14 (9.1)7 (18.9)29 (18.8)2 (5.4)18 (11.7)1 (2.7)0.02 *
PVL14 (38.9)65 (41.7)3 (8.3)18 (11.5)2 (5.6)14 (9.0)1 (2.8)3 (1.9)5 (13.9)16 (10.3)9 (25.0)22 (14.1)2 (5.6)18 (11.5)0.62
Eta5 (71.4)74 (40.2) - 21 (11.4)1 (14.3)15 (8.2) - 4 (2.2) - 21 (11.4)1 (14.3)30 (16.3) - 19 (10.3)0.62
Etd5 (38.5)74 (41.6) - 21 (11.8)2 (15.4)14 (7.9) - 4 (2.2) - 21 (11.8)6 (46.2)25 (14.0) - 19 (10.7)0.03
TSST-11 (8.3)75 (43.6) - 21 (12.2) - 15 (8.7) - 3 (1.7) - 20 (11.6)4 (33.3)26 (15.1)7 (58.3)12 (7.0)<0.01 *
icaA65 (41.4)14 (41.2)20 (12.7)1 (2.9)15 (9.6)1 (2.9) - 4 (11.8)20 (12.7)1 (2.9)22 (14.0)9 (26.5)15 (9.6)4 (11.8)<0.01 *
icaD53 (38.1)26 (50.0)17 (12.2)4 (7.7)13 (9.4)3 (5.8)1 (0.7)3 (5.8)20 (14.4)1 (1.9)21 (15.1)10 (19.2)14 (10.1)10 (19.2) 004 *
Data in numbers (%). Positive: S. aureus. * Statistically significant data.
Table
Table 5. Variables included in the analysis.
Table 5. Variables included in the analysis.
Variables Analyzed
CategoryDescriptionExamples or Additional Information
Demographic Gender, age
Ethnicity
Income in R$
SchoolingIlliterate, incomplete elementary school, complete elementary school, complete high school, college degree
Type of housingBrickhouse (house built with bricks and cement), houses made of wood/straw or rammed earth
Sewerage system
Median number of household members
Distance from the health unit in kilometers
Habits and customsTattoo
Collective sports
Earrings
Skin pigmentationIn general, indigenous peoples have the habit of body painting. In Brazil, dyes are made from natural compounds, such as Urucum and Jenipapo. These dyes remain on the skin for a period of 15 to 20 days.
Urucum
Jenipapo
Number of daily bathsIndigenous people living in remote areas have the habit of bathing in the river, and they commonly take many baths throughout the day.
Baths in the river
Use of medicinal herbs
Use of herbal drink for ritualsAyahuasca
Use of topical medicinal substances
Drinking
SmokingSnuff, cigarette
Clinical variablesDiabetes
Skin infections A (in the last year)
Skin infections R (recent)
Antibiotic use
Recent outpatient consultations
Surgery
Hospitalization
Pneumonia
Table
Table 6. Primers used for the amplification of toxin and biofilm genes.
Table 6. Primers used for the amplification of toxin and biofilm genes.
Virulence Factor GenePrimerSequence (5′-3′)ProductControlReferences
Enterotoxin ASeaSEA-1TTGGAAACGGTTAAAACGAA120 bpATCC13565[34,35]
SEA-2GAACCTTCCATCAAAAACA
Enterotoxin BsebSEB-1TCGCATCAAACTGACAAACG478 bpATCC 14458[34,35]
SEB-2GACGGTACTCTATAAGTGCC
Enterotoxin CSecSEC-1GACATAAAAGCTAGGAATTT257 bpATCC 19095[34,35]
SEC-2AAATCGGATTAACATTATCC
SEE-2TAACTTACCGTGGACCCTTC
Toxic shock syndrome toxin 1TstTSST-1ATGGCAGCATCAGCTTGATA350 bpN315 [36]
TSST-2TTTCCAATAACCACCCGTTT
Exfoliative toxin AEtaETA-1CTAGTGCATTTGTTATTCAA119 bpN5 [37]
ETA-2TGCATTGACACCATAGTACT
Exfoliative toxin BEtbETB-1ACGGCTATATACATTCAATT200 bpZM [37]
ETB-2TCCATCGATAATATACCTAA
Exfoliative toxin DEtdETD-1AACTATCATGTATCAAGG376 bp [37]
ETD-2CAGAATTTCCCGACTCAG
Hemolysin αhlaHLA-1CTGATTACTATCCAAGAAATTCGATTG209 bpN315[38]
HLA-2CTTTCCAGCCTACTTTTTTATCAGT
Hemolysin βhlbHLB-1GTGCACTTACTGACAATAGTGC309 bpRN4420 [38]
HLB-2GTTGATGAGTAGCTACCTTCAGT
Hemolysin δhldHLD-1ATGGCAGCAGATATCATTTC357 bpN315[38]
HLD-2CGTGAGCTTGGGAGAGAC
BiofilmicaAicaA-1ACA GTC GCT ACG AAA AGA AA 103 bp [39]
icaA-2GGA AAT GCC ATA ATG AGA AC
BiofilmicaBicaB-1CTG ATC AAG AAT TTA AAT CAC AAA302 bp [39]
icaB-2AAA GTC CCA TAA GCC TGT TT
BiofilmicaCicaC-1TAA CTT TAG GCG CAT ATG TTT 400 bp [39]
icaC-2TTC CAG TTA GGC TGG TAT TG
BiofilmicaDicaD-1ATG GTC AAG CCC AGA CAG AG198 bp [39]
icaD-2CGT GTT TTC AAC ATT TAA TGC AA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Abraão, L.M.; Fortaleza, C.M.C.B.; Camargo, C.H.; Barbosa, T.A.; Pereira-Franchi, E.P.L.; Riboli, D.F.M.; Hubinger, L.; Bonesso, M.F.; Medeiros de Souza, R.; Ribeiro de Souza da Cunha, M.d.L. Staphylococcus aureus and CA-MRSA Carriage among Brazilian Indians Living in Peri-Urban Areas and Remote Communities. Antibiotics 2023, 12, 862. https://doi.org/10.3390/antibiotics12050862

AMA Style

Abraão LM, Fortaleza CMCB, Camargo CH, Barbosa TA, Pereira-Franchi EPL, Riboli DFM, Hubinger L, Bonesso MF, Medeiros de Souza R, Ribeiro de Souza da Cunha MdL. Staphylococcus aureus and CA-MRSA Carriage among Brazilian Indians Living in Peri-Urban Areas and Remote Communities. Antibiotics. 2023; 12(5):862. https://doi.org/10.3390/antibiotics12050862

Chicago/Turabian Style

Abraão, Lígia Maria, Carlos Magno Castelo Branco Fortaleza, Carlos Henrique Camargo, Thaís Alves Barbosa, Eliane Patrícia Lino Pereira-Franchi, Danilo Flávio Moraes Riboli, Luiza Hubinger, Mariana Fávero Bonesso, Rodrigo Medeiros de Souza, and Maria de Lourdes Ribeiro de Souza da Cunha. 2023. "Staphylococcus aureus and CA-MRSA Carriage among Brazilian Indians Living in Peri-Urban Areas and Remote Communities" Antibiotics 12, no. 5: 862. https://doi.org/10.3390/antibiotics12050862

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop