Fingolimod Promotes Antibacterial Effect of Doripenem against Carbapenem-Resistant Escherichia coli
Abstract
:1. Introduction
2. Results
2.1. Detection of Carbapenem-Resistant Escherichia coli
2.2. Synergistic Action of Fingolimod in Combination with Doripenem
2.3. Inhibitory Effect of Fingolimod on Motility
2.4. Fingolimod Suppressed the Expression of Genes Associated with Antibiotic Resistance in E. coli
3. Discussions
4. Materials and Methods
4.1. Organisms, Growth Conditions, and Reagents
4.2. Minimum Inhibitory Concentration Assay
4.3. DNA Extraction and Polymerase Chain Reaction (PCR)
4.4. Synergy Checkerboard Assay
- (a)
- (b)
4.5. Time-Kill Assay
4.6. Motility Inhibition Assay
4.7. RNA Isolation and Quantitative PCR (qPCR)
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Allocati, N.; Masulli, M.; Alexeyev, M.F.; Di Ilio, C. Escherichia coli in Europe: An overview. Int. J. Environ. Res. Public Health. 2013, 10, 6235–6254. [Google Scholar] [CrossRef] [PubMed]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
- Huttner, A.; Hatz, C.; van den Dobbelsteen, G.; Abbanat, D.; Hornacek, A.; Frölich, R.; Dreyer, A.M.; Martin, P.; Davies, T.; Fae, K.; et al. Safety, immunogenicity, and preliminary clinical efficacy of a vaccine against extraintestinal pathogenic Escherichia coli in women with a history of recurrent urinary tract infection: A randomised, single-blind, placebo-controlled phase 1b trial. Lancet Infect. Dis. 2017, 17, 528–537. [Google Scholar] [CrossRef]
- Dumont, R.; Cinotti, R.; Lejus, C.; Caillon, J.; Boutoille, D.; Roquilly, A.; Podevin, G.; Gras-Le Guen, C.; Ashenoune, K. The microbiology of community-acquired peritonitis in children. Pediatr. Infect. Dis. J. 2011, 30, 131–135. [Google Scholar] [CrossRef] [Green Version]
- Marrie, T.J.; Fine, M.J.; Obrosky, D.S.; Coley, C.; Singer, D.E.; Kapoor, W.N. Community-acquired pneumonia due to Escherichia coli. Clin. Microbiol. Infect. 1998, 4, 717–723. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.R.; Eom, Y.B. Synergistic Activity of Equol and Meropenem against Carbapenem-Resistant Escherichia coli. Antibiotics 2021, 10, 161. [Google Scholar] [CrossRef]
- Doi, Y.; Paterson, D.L. Carbapenemase-producing enterobacteriaceae. Semin. Respir. Crit. Care Med. 2015, 36, 074–084. [Google Scholar] [CrossRef] [Green Version]
- Naas, T.; Oueslati, S.; Bonnin, R.A.; Dabos, M.L.; Zavala, A.; Dortet, L.; Retailleau, P.; Iorga, B.I. Beta-lactamase database (BLDB)–structure and function. J. Enzym. Inhib. Med. Chem. 2017, 32, 917–919. [Google Scholar] [CrossRef]
- Ye, Y.; Xu, L.; Han, Y.; Chen, Z.; Liu, C.; Ming, L. Mechanism for carbapenem resistance of clinical Enterobacteriaceae isolates. Exp. Ther. Med. 2018, 15, 1143–1149. [Google Scholar] [CrossRef] [Green Version]
- Suay-Garcia, B.; Perez-Gracia, M.T. Present and Future of Carbapenem-resistant Enterobacteriaceae (CRE) Infections. Antibiotics 2019, 8, 122. [Google Scholar] [CrossRef] [Green Version]
- Sun, J.; Deng, Z.; Yan, A. Bacterial multidrug efflux pumps: Mechanisms, physiology and pharmacological exploitations. Biochem. Biophys. Res. Commun. 2014, 453, 254–267. [Google Scholar] [CrossRef] [Green Version]
- Castro-Borrero, W.; Graves, D.; Frohman, T.C.; Flores, A.B.; Hardeman, P.; Logan, D.; Orchard, M.; Greenberg, B.; Frohman, E.M. Current and emerging therapies in multiple sclerosis: A systematic review. Ther. Adv. Neurol. Disord. 2012, 5, 205–220. [Google Scholar] [CrossRef] [Green Version]
- Tedesco-Silva, H.; Mourad, G.; Kahan, B.D.; Boira, J.G.; Weimar, W.; Mulgaonkar, S.; Nashan, B.; Madsen, S.; Charpentire, B.; Pellet, P.; et al. FTY720, A Novel Immunomodulator: Efficacy and Safety Results from the First Phase 2A Study in de novo Renal Transplantation. Transplantation 2005, 79, 1553–1560. [Google Scholar] [CrossRef]
- Gilbert-Girard, S.; Savijoki, K.; Yli-Kauhaluoma, J.; Fallarero, A. Screening of FDA-Approved Drugs Using a 384-Well Plate-Based Biofilm Platform: The Case of Fingolimod. Microorganisms 2020, 8, 1834. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Logan, L.K.; Weinstein, R.A. The epidemiology of carbapenem-resistant Enterobacteriaceae: The impact and evolution of a global menace. J. Infect. Dis. 2017, 215, S28–S36. [Google Scholar] [CrossRef] [Green Version]
- Shanmugam, P.; Meenakshisundaram, J.; Jayaraman, P. blaKPC gene Detection in Clinical Isolates of Carbapenem Resistant Enterobacteriaceae in a Tertiary Care Hospital. J. Clin. Diagn. Res. 2013, 7, 2736–2738. [Google Scholar] [CrossRef]
- Kluepfel, D.; Bagli, J.; Baker, H.; Charest, M.P.; Kudelski, A.; Sehgal, S.N.; Vézina, C. Myriocin, a new antifungal antibiotic from Myriococcum albomyces. J. Antibiot. 1972, 25, 109–115. [Google Scholar] [CrossRef] [Green Version]
- Horiyama, T.; Nishino, K. AcrB, AcrD, and MdtABC multidrug efflux systems are involved in enterobactin export in Escherichia coli. PLoS ONE 2014, 9, e108642. [Google Scholar] [CrossRef] [Green Version]
- Anes, J.; McCusker, M.P.; Fanning, S.; Martins, M. The ins and outs of RND efflux pumps in Escherichia coli. Front. Microbiol. 2015, 6, 587. [Google Scholar] [CrossRef] [Green Version]
- Elkins, C.A.; Nikaido, H. Substrate specificity of the RND-type multidrug efflux pumps AcrB and AcrD of Escherichia coli is determined predominately by two large periplasmic loops. J. Bacteriol. 2002, 184, 6490–6498. [Google Scholar] [CrossRef] [Green Version]
- Kobayashi, N.; Tamura, N.; van Veen, H.W.; Yamaguchi, A.; Murakami, S. β-Lactam selectivity of multidrug transporters AcrB and AcrD resides in the proximal binding pocket. J. Biol. Chem. 2014, 289, 10680–10690. [Google Scholar] [CrossRef] [Green Version]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef]
- Pantel, A.; Dunyach-Remy, C.; Ngba Essebe, C.; Mesureur, J.; Sotto, A.; Pagès, J.-M.; Nicolas-Chanoine, M.H.; Lavigne, J.P. Modulation of membrane influx and efflux in Escherichia coli sequence type 131 has an impact on bacterial motility, biofilm formation, and virulence in a Caenorhabditis elegans model. Antimicrob. Agents Chemother. 2016, 60, 2901–2911. [Google Scholar] [CrossRef] [Green Version]
- Chetri, S.; Bhowmik, D.; Paul, D.; Pandey, P.; Chanda, D.D.; Chakravarty, A.; Bora, D.; Bhattacharjee, A. AcrAB-TolC efflux pump system plays a role in carbapenem non-susceptibility in Escherichia coli. BMC Microbiol. 2019, 19, 210. [Google Scholar] [CrossRef] [Green Version]
- Kakkanat, A.; Phan, M.-D.; Lo, A.W.; Beatson, S.A.; Schembri, M.A. Novel genes associated with enhanced motility of Escherichia coli ST131. PLoS ONE 2017, 12, e0176290. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.-H.; Kim, Y.G.; Raorane, C.J.; Ryu, S.Y.; Shim, J.J.; Lee, J. The anti-biofilm and anti-virulence activities of trans-resveratrol and oxyresveratrol against uropathogenic Escherichia coli. Biofouling 2019, 35, 758–767. [Google Scholar] [CrossRef]
- Hindiyeh, M.; Smollen, G.; Grossman, Z.; Ram, D.; Davidson, Y.; Mileguir, F.; Vax, M.; Ben David, D.; Tal, I.; Rahav, G.; et al. Rapid detection of bla KPC carbapenemase genes by real-time PCR. J. Clin. Microbiol. 2008, 46, 2879–2883. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Orhan, G.; Bayram, A.; Zer, Y.; Balci, I. Synergy tests by E test and checkerboard methods of antimicrobial combinations against Brucella melitensis. J. Clin. Microbiol. 2005, 43, 140–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eumkeb, G.; Siriwong, S.; Thumanu, K. Synergistic activity of luteolin and amoxicillin combination against amoxicillin-resistant Escherichia coli and mode of action. J. Photochem. Photobiol. B-Biol. 2012, 117, 247–253. [Google Scholar] [CrossRef] [PubMed]
Strains | MIC (μg/mL) | ||||
---|---|---|---|---|---|
Fingolimod | Doripenem | Meropenem | Imipenem | Ertapenem | |
CLSI breakpoints E. coli KBN12P05816 | 16 | ≥4 64 | ≥4 16 | ≥4 ≥4 | ≥2 64 |
E. coli KBN12P05795 E. coli KBN12P06081 | 16 16 | 128 128 | 16 16 | ≥4 ≥4 | 32 32 |
Strain | MIC (μg/mL) | Synergistic Action | |||
---|---|---|---|---|---|
Fingolimod | Doripenem | Fingolimod + Doripenem | FICI | Interpretation * | |
E. coli KBN12P05816 | 8 | 64 | 4 + 4 | 0.3125 | S |
E. coli KBN12P05795 | 16 | 128 | 4 + 32 | 0.5 | S |
E. coli KBN12P06081 | 16 | 128 | 4 + 32 | 0.5 | S |
Primers | Target Gene | Primer Sequence (5′-3′) | Annealing Temp. (°C) | Reference |
---|---|---|---|---|
PCR primers | blaKPC | F: CGTCTAGTTCTGCTGTCTTG | 54 | [24] |
R: CTTGTCATCCTTGTTAGGCG | ||||
qPCR primers | acrB | F: CGTACACAGAAAGTGCTCAA | 51 | [25] |
R: CGCTTCAACTTTGTTTTCTT | ||||
acrD | F: GCCGTGCAGCAAGTACAAAA | 58 | [26] | |
R: GTATCGCCGGTTTTACGCAC | ||||
flhD | F: ACTTGCACAGCGTCTGATTG | 55 | [27] | |
R: AGCTTAACCATTTGCGGAAG | ||||
motA | F: ACAGGTAGCGCGTTCTCACT | 58 | [28] | |
R: AGCGTGGATAAACCGATACG | ||||
blaKPC | F: GATACCACGTTCCGTCTGG | 57 | [29] | |
R: GCAGGTTCCGGTTTTGTCTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, H.-W.; Kim, H.-R.; Eom, Y.-B. Fingolimod Promotes Antibacterial Effect of Doripenem against Carbapenem-Resistant Escherichia coli. Antibiotics 2022, 11, 1043. https://doi.org/10.3390/antibiotics11081043
Jin H-W, Kim H-R, Eom Y-B. Fingolimod Promotes Antibacterial Effect of Doripenem against Carbapenem-Resistant Escherichia coli. Antibiotics. 2022; 11(8):1043. https://doi.org/10.3390/antibiotics11081043
Chicago/Turabian StyleJin, Hye-Won, Hye-Rim Kim, and Yong-Bin Eom. 2022. "Fingolimod Promotes Antibacterial Effect of Doripenem against Carbapenem-Resistant Escherichia coli" Antibiotics 11, no. 8: 1043. https://doi.org/10.3390/antibiotics11081043
APA StyleJin, H. -W., Kim, H. -R., & Eom, Y. -B. (2022). Fingolimod Promotes Antibacterial Effect of Doripenem against Carbapenem-Resistant Escherichia coli. Antibiotics, 11(8), 1043. https://doi.org/10.3390/antibiotics11081043