Next Article in Journal
Phytochemical Profile of the Ethanol Extract of Malvaviscus arboreus Red Flower and Investigation of the Antioxidant, Antimicrobial, and Cytotoxic Activities
Next Article in Special Issue
Staphylococcus aureus-Cure-Associated Antigens Elicit Type 3 Immune Memory T Cells
Previous Article in Journal
Irrigation Ponds as Sources of Antimicrobial-Resistant Bacteria in Agricultural Areas with Intensive Use of Poultry Litter
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 11
10.3390/antibiotics11111651
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ecological Distribution of Virulent Multidrug-Resistant Staphylococcus aureus in Livestock, Environment, and Dairy Products

by
Basma Badawy
1,*,
Mahmoud Elafify
2,
Alshimaa M. M. Farag
3,
Samar M. Moustafa
4,
Mohamed Z. Sayed-Ahmed
5,
Amira A. Moawad
6,7,
Abdelazeem M. Algammal
8,
Hazem Ramadan
1,* and
Mahmoud Eltholth
9,10,11
1
Department of Hygiene and Zoonoses, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
2
Department of Food Hygiene and Control, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
3
Department of Internal Medicine, Infectious and Fish Diseases, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
4
Department of Zoonoses, Faculty of Veterinary Medicine, Benha University, Benha 13511, Egypt
5
Department of Pharmacy Practice, College of Pharmacy, Jazan University, Jazan 82722, Saudi Arabia
6
Friedrich-Loeffler-Institut Institute of Bacterial Infections and Zoonoses, Naumburger Str. 96a, 07743 Jena, Germany
7
Animal Health Research Institute, Agriculture Research Center (ARC), Giza 12618, Egypt
8
Department of Bacteriology, Immunology and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522, Egypt
9
Global Academy of Agriculture and Food Systems, The Royal (Dick) School of Veterinary Studies, University of Edinburgh, Easter Bush Campus, Midlothian, Edinburgh EH25 9RG, UK
10
Department of Animal Medicine, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
11
Department of Health Studies, Royal Holloway University of London, Egham TW20 0EX, UK
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Authors to whom correspondence should be addressed.
Antibiotics 2022, 11(11), 1651; https://doi.org/10.3390/antibiotics11111651
Submission received: 19 September 2022 / Revised: 13 November 2022 / Accepted: 15 November 2022 / Published: 18 November 2022
(This article belongs to the Special Issue Mastitis: Causative Agents, Drug Resistance, and Treatment Approaches)
Browse Figure
Versions Notes

Abstract

:
Staphylococcus aureus is one of the most common causes of mastitis, leading to severe economic losses in the dairy industry. It is also zoonotic, with potential risks to public health. This study aimed to detect the occurrence of S. aureus-resistant strains isolated from cattle, buffalo, their environment, milk and dairy products; and to investigate the extent of animal, ecological, and food contamination by methicillin-resistant (MRSA) or enterotoxigenic S. aureus. Samples (n = 350) were collected from four animal (two cattle and two buffalo) farms, i.e., their environment. Thirty Karish cheese samples were collected from 10 markets in Mansoura, Egypt. S. aureus was detected in 17.9%, 17.6%, and 16.7% of samples collected from cattle, buffalo and Karish cheese, respectively. About 19% of isolated S. aureus strains carried the mecA gene. The distribution of the mecA gene was high in isolates from Karish cheese (60%), followed by samples collected from buffalo (16.2%) and cattle (16%). More than 34% of isolated S. aureus strains were enterotoxigenic, and the presence of enterotoxin genes was higher in isolates from Karish cheese (80%) than those from cattle (48%) and buffalo (18.9%). The most predominant enterotoxin gene among isolated S. aureus strains was the sea gene (26.9%), followed by sec (4.5%) and sed (3%) genes. Isolated strains were resistant to clindamycin (100%), kanamycin (97%), nalidixic acid (86.6%), cefotaxime (73.1%) sulphamethazole—trimethoprim (65.6%). Meanwhile, 95.5%, 94%, 86.6% and 77.7% of S. aureus strains were sensitive to ciprofloxacin, amikacin, imipenem and both cefoxitin and gentamycin, respectively. In conclusion, the presence of enterotoxigenic- and methicillin-resistant S. aureus strains in animals, their environment, and dairy products represents a public health concern, particularly in small-scale dairy farms in Egypt. To reduce the risk of infection of livestock and humans with resistant strains, strict regulations and guidelines for antimicrobial use in such a system are urgently required.

1. Introduction

Staphylococcus aureus (S. aureus) is an opportunistic pathogen that is considered to be one of the leading causes of mastitis in dairy cattle [1,2,3,4]. A significant proportion (49.7%) of subclinical bovine mastitis was caused by Staphylococci, of which S. aureus was the predominant species (64.95%) [5]. Mammary gland infection with Staphylococcus aureus remains a main worldwide problem to the dairy industry due to its contagiousness, pathogenicity, persistence in the cow environment, colonization of skin or mucosal epithelia, and the poor therapeutic efficacy of different applied antimicrobials [6]. Globally, mastitis is one of the most common diseases affecting dairy herds, leading to significant economic losses due to the increased somatic cell count (SCC), physical changes in milk, decreased milk production, increased costs of veterinary drugs, and early culling of infected animals [7]. Most S. aureus strains (94%) are resistant to penicillin and its derivatives due to the production of the penicillinase enzyme [8,9]. Strains of S. aureus that are resistant to methicillin are known as methicillin-resistant Staphylococcus aureus (MRSA) [10]. The latter could be determined phenotypically by antimicrobial susceptibility testing to cefoxitin and/or oxacillin and genetically by the detection of the mecA gene using PCR. The mecA gene mainly encodes for a modified penicillin-binding protein (PBP2a) that leads to antimicrobial resistance (AMR) [11]. S. aureus possesses different virulence factors, such as extracellular toxins, of which the enterotoxins cause food poisoning and others are responsible for causing many clinical manifestations in humans and animals [11]. Enterotoxins are thermostable and cause food poisoning in humans when contaminated foods are consumed [11,12]. S. aureus and its enterotoxins are the third highest cause of foodborne illnesses globally [2,13]. It can colonize and persist in different environments, inanimate objects, or media [14]. Virulence factors that have an important role in pathogenicity are adhesins and surface proteins, such as proteins A, Staphylococcal enterotoxins (SEs), and β-Hemolysin (Hlb) [15]. The organism has numerous ways to overcome phagocytosis and invade the udder, causing chronic inflammation [16].
The presence of S. aureus in milk indicates low hygienic standards adopted during the milking process [17]. Dairy farms are major reservoirs of S. aureus; it can be transmitted from cattle, farm environment, and farm workers to bulk tank milk (BTM), causing a public health hazard [2].
The resistance of S. aureus to antimicrobial agents is a growing challenge and can hinder the treatment of infections [1]. In Egypt, a high proportion of S. aureus isolates from humans and bovines were resistant to antibiotics [18]. Unfortunately, the use of antimicrobials in livestock production is poorly regulated in Egypt [19]. This resistance might be due to the fact that antimicrobials such as tetracycline, quinolones, and beta lactams are still used as growth promotors and feed additives for animals [20,21]. However, Egypt has launched a five-year National Action Plan (NAP) on AMR (2017–2022), aiming for the consistent investigation of AMR and promoting the judicious use of antimicrobials for humans and animals [21].
In Egypt, the prevalence and genotypes of circulating S. aureus and other Staphylococci among dairy cattle and buffaloes have been reported in several studies [22,23], yet scarce and very limited data about the occurrence of antimicrobial-resistant strains of S. aureus in animals and their environment still exist. This study was carried out to detect the occurrence of antimicrobial-resistant S. aureus strains isolated from cattle, buffalo, their environment, and milk and dairy products and investigate the extent of animal, ecological, and food contamination by MRSA or enterotoxigenic S. aureus.

2. Results

2.1. Occurrence of Staphylococcus aureus in Examined Samples

Generally, there was no significant difference between the occurrence of S. aureus in samples from different sources (Table 1). The occurrence of S. aureus from cattle environments (15%) was insignificantly (p = 0.640) lower than buffaloes (17.5%). There was no significant difference in the level of contamination of milk and feed samples by S. aureus (p = 0.470 and p = 0.058, respectively) either in cattle or buffalo farms. S. aureus was isolated from 16.7% of Karish cheese samples.

2.2. Occurrence and Distribution of Staphylococcus aureus at the Farm Level

Results (Table 2) showed that there is no significant difference between different types of samples among cattle farms. S. aureus was isolated from 17.9% of samples collected from cattle farms (14.3% and 21.4% from farms I and II, respectively). On buffalo farms, it was isolated from 17.6% (5.7% and 29.5% from farms III and IV, respectively). There was a statistically significant difference (p = 0.027) in animal samples collected from buffalo farms III and IV (8.9%, and 26.8%, respectively). Milk samples from buffalo farm IV were contaminated with S. aureus (40%, p = 0.003). Environmental contamination by S. aureus was significantly (p ≤ 0.001) higher in buffalo farm IV (31.7%) than in farm III (3.3%). Feed contamination was recorded only in farms II and IV (20% and 66.7%, respectively). There was a significant difference (p = 0.001) in the presence of S. aureus between buffalo farms III (5.7%) and IV (29.5%). There was no significant difference (p = 0.06) in the level of contamination of water samples collected from cattle farms.

2.3. Occurrence and Distribution of MRSA and Enterotoxigenic Staphylococcus aureus Isolated from Different Sources

More than 19% of isolated S. aureus strains were mecA gene positive, of which 60%, 16.2%, and 16% of the gene were from Karish cheese, buffalo and cattle samples, respectively). Around 34% of isolated S. aureus strains were enterotoxigenic; enterotoxin genes were detected in samples from Karish cheese (80%), cattle (48%), and buffalo (18.9%). The most predominant enterotoxin gene among isolated S. aureus strains was the sea gene (26.9%) followed by sec (4.5%) and sed (3%) genes. The enterotoxin seb gene was not detected in this study (Table 3).

2.4. Antimicrobial Resistence and Multiple Antimicrobial Resistance (MAR) Index of Isolated Staphylococcus aureus Strains

The results for antimicrobial resistance (Table 4) showed that 86.6% of S. aureus exhibited multidrug resistance (MDR). All isolates were found to be resistant to clindamycin. Ninety-seven percent, 86.6%, 73.1%, and 65.7% of S. aureus isolates were resistant to kanamycin, nalidixic acid, cefotaxime and sulphamethoxazol-trimethoprim, respectively. On the other hand, 95.5% and 94% of the recovered strains were sensitive to ciprofloxacin and amikacin, respectively, followed by imipenem (86.6%), cefoxitin and gentamycin (77.7% each).
The MAR index showed a significant difference (p = 0.024) between samples collected from cattle and buffalo (0.519 ± 0.235 and 0.382 ± 0.225, respectively). Also, there was a significant difference (p = 0.035) between samples from livestock and dairy products (0.519 ± 0.260) compared to samples from the environment (0.394 ± 0.211) (Table 5).
The MAR index was calculated by dividing the total number of antimicrobial resistances for each isolate by the total number of antimicrobials tested [21]. The results of the MAR index for different samples are shown in Table 6. The mean MAR index (0.70 ± 0.216) for samples from Karish cheese was the highest, followed by milk samples (0.621 ± 0.161), bedding materials (0.499 ± 0.174), and rectal swabs (0.452 ± 0.319). On the other hand, the MAR index for boot swabs was the lowest (0.321 ± 0.100).
Based on Heatmap and hierarchical clustering, isolates were classified into five clusters (L1, L2, L3, L4 and L5) according to the distribution of AMR phenotypes, mecA and enterotoxin genes (Figure 1). Clusters L1, L4 and L5 contained isolates from samples collected from cattle, buffalo, and dairy products, whereas L2 and L3 were from isolates obtained from cattle and buffalo. Although there was no specific trend for clustering isolates from different sources, some isolates from different sources displayed identical profiles of AMR phenotypes, mecA and enterotoxin genes. For instance, isolates 133 and 36 recovered from cattle and dairy products had the same AMR phenotypes, and both carried mecA and sea genes.

3. Discussion

S. aureus is one of the major causes of mastitis in dairy cattle, resulting in severe health issues and economic losses. Molecular and epidemiological studies of S. aureus from animals, environment, and dairy products in Egypt are scarce. To our knowledge, this is the first study to explore the ecology and the co-circulation of multidrug-resistant S. aureus in livestock, dairy products and the environment.
Our results showed a lower percentage of S. aureus from cattle and buffalo than in a previous study in Egypt, in which S. aureus was detected in 50% to 83% of samples from dairy cattle and buffalo commercial farms and smallholders [24]. In another study, the organism was detected in 72.5% of animals, barn environments, milking equipment, bulk milk tank (BMT), and workers [25]. In a third study, it was detected in 36.3% and 31% of milk samples collected from healthy cattle and buffalo, respectively [26]. Our results were higher than El-Ashker et al., who detected S. aureus in 5.6% of milk samples collected from both small dairy householders and well-organized farms [22]. Moreover, the organism was detected in 21.1% of milk samples collected from 140 household dairy cattle and buffalo with mastitis [27]. Variations in S. aureus occurrence may be due to the differences in the type of samples, the health status of the animals, the level of hygiene and the season of sampling [28]. A high prevalence of S. aureus may be due to the ability of the organism to survive in the udder, and under certain circumstances, it becomes capable of inducing chronic and subclinical infections and acting as a source of infection for other healthy cattle [29].
Our detection rate of S. aureus from feces and udder swabs from cattle was lower than [25], who detected it in 55.6% of samples. This may be due to the fact that samples in the latter study were collected from open yards with cow sheds, earth floor system and a parlor that depended on pipeline milking machines. The degree of udder skin contamination may be attributed to the persistent association between udder skin and intra-mammary infection (IMI) in dairy cows [30], and there was a minor role of teat skin contamination in IMI of S. aureus previously reported [31]. This indicates that there is an association between teat skin colonization and IMI with S. aureus. It was concluded that S. aureus on teat skin might be a risk factor for IMI. Therefore, proper teat skin hygiene and sanitation are recommended before and after the milking process.
In this study, the level of contamination of buffalo milk contamination by S. aureus was higher than in cattle milk; this was similar to a previous study conducted by Abo-Shama et al. [32], in which the organism was detected in buffalo and cattle milk at 46% and 37%, respectively. However, our results were higher than other studies, in which 42%, 36%, and 31% of milk samples from animals with mastitis, cattle with sub-mastitis and buffalo were positive, respectively [23,26]. Our results were also different to studies conducted in Turkey (56%) [33], China (46% and 43%) [34,35] and Ethiopia (15%) [29]. These variations might be attributed to the geographical area, climate conditions, animal species, farm hygiene, the health status of the animals, milking methods and hygiene [36].
Limited data are available on the prevalence of S. aureus in animal environments worldwide [2]. There is a need for further epidemiological and ecological studies to better explain the transmission of the pathogenic S. aureus between livestock, the environment, food chains and humans [37]. In this study, the level of S. aureus detection from environmental samples was in agreement with [28] and [2,38,39], who concluded that farm environments act as a vehicle for S. aureus transmission to the farm equipment, cattle, workers and BMT.
S. aureus was detected in Karish cheese at a lower rate than [40], in which 73.3% of Karish cheese samples processed from raw milk were positive. However, it was higher than [41] in which 5% and 13% of samples from supermarkets and street vendors were contaminated, respectively. The frequent isolation of S. aureus from raw milk intended for cheese production without pasteurization, dairy processing equipment, and environments, as well as food handlers, indicated its introduction to the dairy product supply chain [42]. The critical points of contamination of raw milk with S. aureus are the milking process, manure, milking collection facilities and handling during transportation [43]. Therefore, hygienic standards during the production, transportation, and sale of raw milk and dairy products should be carefully monitored.
Resistance to methicillin is attributed to the existence of the mecA and/or mecC gene(s) on the S. aureus chromosomes. Methicillin is stable in the presence of β-lactamase enzymes and is effective in the treatment of S. aureus infections, but not MRSA [44]. The percentage of mecA was lower than in several studies conducted in Egypt [11,22,23,26,45]. This may be due to the differences in the health status of animals. The detection of MRSA was higher than [2]. In our study, few isolates were resistant to cefoxitin and tested negative for mecA. This was in agreement with [46] and may be attributed to the existence of the mecC gene.
The results of enterotoxigenic S. aureus strains were similar to [26]. The percentages of detection of enterotoxin genes, sea, sec, sed, and seb were in agreement with [26], who detected the sea, and sec genes in 27%, and 7% of samples, respectively, while the seb and sed genes were not detected. The gene coding for enterotoxin A, sea, was the most frequently found, as in studies by [11,47]. This toxin is thermostable, not inactivated by pasteurization, and maintains some biological activity after 28 min at 121 °C [48]. The majority of S. aureus infections and outbreaks, attributed to the consumption of contaminated milk or milk powder, were associated with sea, sed, sec and seb toxins [48,49]. High percentages of sea, sec, sed and seb enterotoxin genes were detected in raw and pasteurized milk [47]. Also, a higher detection rate of S. aureus enterotoxins from animals, food and humans was reported by [50]. The sources of enterotoxin and mecA genes in the tested S. aureus strains were animal, environment, milk and Karish cheese. These pose a potential risk of transmission of antimicrobial resistance to human consumers.
The percentage of MDR S. aureus in this study was similar to a previous study in Egypt [23], where 83.3% of S. aureus isolates were MDR, with a high resistance against ampicillin (95.2%), penicillin (83.3%) and lower resistance against gentamicin (23.8%), amikacin (16.7%) and ciprofloxacin (14.3%) [23]. MDR of our S. aureus strains was high compared to other research studies worldwide. Other studies from Egypt reported a lower MDR percentage than the present study, in which 52.4% [27] and 38.2% [11] of S. aureus strains were MDR S. aureus strains. The phenotypic MDR phenomenon is mainly attributed to the frequent use of antimicrobials as well as the encoding of some antibiotic-resistant genes. The result of antibiogram agreed with [51], who found that S. aureus isolated from milk were sensitive to ciprofloxacin. In contrast, all S. aureus isolates were susceptible to sulphamethazole—trimethoprim, erythromycin, gentamicin, ciprofloxacin, followed by penicillin (88.89%) and tetracycline (61.11%) [29]. S. aureus strains from milk samples were found to be resistant to penicillin, tetracycline and cefoxitin, with a prevalence rate of 64.3%, 59.5%, and 35.7%, respectively.
The presence of high percentages of MAR S. aureus from dairy cattle has been reported worldwide, 100% MAR from Egypt [11], 98.3%, 50%, and 62% from Ethiopia, Italy, and South Africa, respectively [52]. The difference in the MAR index may be attributable to the difference in the prevalence of antimicrobial-resistant genes that are responsible for MDR [53]. The current farming practices make farm animals vulnerable to the development and acquisition of new resistance mechanisms that can propagate into the community and cause a significant risk to the human population [54].
In conclusion, S. aureus is an important veterinary and public health issue, particularly for the small-scale dairy herds in Egypt. Further investigations into the prevalence, circulation and AMR of S. aureus and other pathogens with public health importance are required. Strict regulations for antimicrobial use in livestock production are highly recommended.

4. Materials and Methods

4.1. Study Design and Samples Collection

For this study, four dairy farms (2 cattle and 2 buffalo) and 10 markets were purposively selected from the Mansoura district, Dakahlia Governorate, the Eastern Nile Delta region of Egypt. These farms have a history of a sharp decrease in milk production, and the milking process is manual with an absence of veterinary supervision. The frequently used antimicrobials were penicillin, amoxycillin, tetracycline tylosin, and enrofloxacin. The markets are small local markets in rural and peri-urban areas where farmers sell dairy products and other goods.
In total, 350 samples were collected aseptically from the four farms and their environment, and 30 Karish cheese (made from raw buffalo milk) were collected from 10 markets, three each. Samples from animals included rectal swabs, milk, and udder swabs, 50 each. Samples from farm environments included water, feed, bedding materials, and boot swabs from personnel, 50 each (Table 7). Samples were collected and transported in an icebox to the Animal, Poultry and Environmental Hygiene Laboratory, Faculty of Veterinary Medicine, Mansoura University, Egypt within 2 h of collection. The collection and processing of samples were according to [25,28].

4.2. Microbiological and Molecular Characterization of S. aureus

  • Isolation and identification of S. aureus
All samples were pre-enriched in tryptone soy broth (TSB, Oxoid, Basingstoke, UK) overnight, then cultured on Baired Parker Agar (Oxoid, UK) supplemented with Egg Yolk Tellurite (50 mL/L) (Oxoid, UK). Cultured plates were incubated at 37 °C for 18–24 h, followed by subculture on mannitol salt agar for confirmation. Morphological and biochemical identifications were conducted according to [25] and the thermostable nuclease test “D-Nase activity” [39].
  • Molecular characterization
DNA was extracted from the purified strains using a GeneJET Genomic DNA Purification Kit (Fermantas and USA) according to the manufacturer’s instructions. Conventional PCR was performed to determine the nuc gene specific for S. aureus species, the mecA gene for MRSA, sea, seb, sec and sed for enterotoxin detection. The primer sequences used for all tested genes and their amplicon sizes were illustrated (Table 8).
  • Amplification of nuc, enterotoxin and mecA genes
A multiplex PCR for the identification of nuc and mecA genes was performed as for the method described by [57]. Multiplex PCR for enterotoxin genes was done according to the method performed by [47].

4.3. Phenotypic antimicrobial Resistance of Isolated S. aureus (Antibiogram)

AMR was performed by the agar disk diffusion method on Mueller–Hinton agar (Difco, Franklin Lakes, NJ, USA), as recommended by the Clinical and Laboratory Standards Institute, CLSI, 2020 [58]. Frequently applied antimicrobials for S. aureus infection in humans and animals were selected to be tested against the isolated strains of S. aureus. About 14 antimicrobial discs (Oxoid, UK) related to different classes of antimicrobials were used (Table 4). The bacterial culture was uniformly spread on the surface of the agar. Then the antimicrobials discs were placed over the surface of the inoculated plate. Moreover, the plate was then incubated at 35 °C for 24 h and checked for the growth of the bacterium around the antibiotic discs. Examined strains were assessed as susceptible, intermediate, or resistant in accordance with breakpoints supplied by the CLSI (2020) guidelines for S. aureus ATCC 25,923. To ensure data compatibility, the experiment was repeated with positive and negative controls, respectively. The positive control (quality control organism) was S. aureus ATCC 25,923. For the negative control, 30 μL of sterile distilled water was pipetted onto a blank disc (typically 6 mm in diameter). The MAR index was calculated by dividing the total number of antimicrobial resistances for each isolate by the total number of antimicrobials tested. A MAR index value greater than 0.2 means the isolates originated from a high-risk source of contamination where antimicrobials are massively applied [21,59]. Strains exhibiting resistance to at least one antimicrobial drug in three or more antimicrobial classes were considered to be MDR strains [21].

4.4. Statistical Analyses

Data were analyzed using the Statistical Package for Social Sciences (IBM SPSS Statistics for Windows, Version 26.0. Armonk, NY, USA: IBM Corp). The normality of data was first tested with a one-sample Kolmogorov-Smirnov test. The smaller the p value obtained, the more significant the results. The Fisher exact test was used when the expected cell count was less than 5. In the present study, the occurrence of S. aureus, either enterotoxigenic or MRSA, in two different species of animals (cattle and buffalo), their environmental contamination, milk and milk products were compared by using chi-square and Fisher exact tests for comparison of two or more groups of categorical variables. Regarding the MAR index differentiation between cattle, buffalo, their environment and milk products, the mean and SD (standard deviation) were used to identify which of these categories (animal species, environmental, milk products) had a high risk of MAR. The mean and p value of the MAR index for samples from different sources were calculated for comparing samples from rectal, udder, boot swabs, milk, Karish cheese, water and feed. In order to cluster the isolates from different sources according to their AMR phenotypes, the presence of mecA and enterotoxin genes, a heatmap with hierarchical clustering was generated using the R packages “Heatmap” and “RColorBrewer” as previously described [11]. The presence of a gene or a resistance phenotype scored 1, whereas the absence of a gene or a susceptible phenotype scored 0. The binary data (0/1) were then imported into R software (version 3.6.1; https://www.r-project.org, accessed on 17 September 2021).

5. Conclusions

Results from this study revealed a high level of contamination in the animal environment, milk and dairy products with MDR S. aureus strains that impose a public health hazard. These findings may be attributable to a lack of hygiene and veterinary supervision and, consequently, improper use of antimicrobials in the small-scale dairy sector in Egypt. Strict regulations and guidelines for antimicrobial use in such systems are urgently required to reduce the risk of infection of livestock and humans with S. aureus-resistant strains. Further examination of these isolates using whole-genome sequencing will be helpful to provide insights into the genomic relatedness of isolates from different sources.

Author Contributions

Conceptualization, B.B.; methodology, B.B., M.E. (Mahmoud Elafify) and A.M.M.F.; software, B.B. and H.R.; validation, B.B. and M.E. (Mahmoud Eltholth); formal analysis, B.B., H.R. and M.E.; investigation, B.B., A.A.M., A.M.A., H.R., M.Z.S.-A., M.E. (Mahmoud Elafify) and S.M.M.; resources, B.B., A.A.M., A.M.A., H.R., M.E. (Mahmoud Elafify), M.Z.S.-A. and S.M.M.; data curation, B.B., S.M.M., A.A.M., A.M.A., H.R., M.Z.S.-A. and A.M.M.F.; writing—original draft preparation, B.B.; writing—review and editing; visualization; supervision, B.B. and M.E. (Mahmoud Eltholth). All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Mansoura University, and approved by the Ethics Committee of Faculty of Veterinary Medicine, Mansoura, Egypt (protocol code, R/66, 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Monecke, S.; Kuhnert, P.; Hotzel, H.; Slickers, P.; Ehricht, R. Microarray based study on virulence-associated genes and resistance determinants of Staphylococcus aureus isolates from cattle. Vet. Microbiol. 2007, 125, 128–140. [Google Scholar] [CrossRef] [PubMed]
  2. Haran, K.P.; Godden, S.M.; Boxrud, D.; Jawahir, S.; Bender, J.B.; Sreevatsan, S. Prevalence and characterization of Staphylococcus aureus, including methicillin-resistant Staphylococcus aureus isolated from bulk tank milk from Minnesota dairy farms. J. Clin. Microbiol. 2012, 50, 688–695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [Green Version]
  4. Smith, T.C. Livestock-Associated Staphylococcus aureus: The United States Experience. PLoS Pathog. 2015, 11, e1004564. [Google Scholar] [CrossRef] [PubMed]
  5. Saglam, A.G.; Sahin, M.; Çelik, E.; Çelebi, O.; Akça, D.; Otlu, S. The role of staphylococci in subclinical mastitis of cows and lytic phage isolation against to Staphylococcus aureus. Vet. World 2017, 10, 1481–1485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Rainard, P.; Foucras, G.; Fitzgerald, J.R.; Watts, J.L.; Koop, G.; Middleton, J.R. Knowledge gaps and research priorities in Staphylococcus aureus mastitis control. Transbound. Emerg. Dis. 2018, 65, 149–165. [Google Scholar] [CrossRef] [Green Version]
  7. Seegers, H.; Fourichon, C.; Beaudeau, F. Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet. Res. 2003, 34, 475–491. [Google Scholar] [CrossRef] [Green Version]
  8. Peacock, S.J.; Paterson, G.K. Mechanisms of methicillin resistance in Staphylococcus aureus. Ann. Rev. Biochem. 2015, 84, 577–601. [Google Scholar] [CrossRef]
  9. Algammal, A.; Hetta, H.; Elkelish, A.; Alkhalifah, D.; Hozzein, W.; Batiha, G.; El Nahhas, N.; Mabrok, M.A. Methicillin-resistant staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect. Drug Resist. 2020, 13, 3255–3265. [Google Scholar] [CrossRef]
  10. Gajdács, M. The continuing threat of methicillin-resistant Staphylococcus Aureus. Antibiotics 2019, 8, 52. [Google Scholar] [CrossRef]
  11. Sadat, A.; Shata, R.; Farag, A.; Ramadan, H.; Alkhedaide, A.; Soliman, M.; Elbadawy, M.; Abugomaa, A.; Awad, A. Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk. Toxins 2022, 14, 97. [Google Scholar] [CrossRef] [PubMed]
  12. Schelin, J.; Wallin-Carlquist, N.; Cohn, M.T.; Lindqvist, R.; Barker, G.C.; Rådström, P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence 2011, 2, 580–592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Akineden, O.; Annemüller, C.; Hassan, A.A.; Lämmler, C.; Wolter, W.; Zschöck, M. Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis. Clin. Diagn. Lab. Immunol. 2001, 8, 959–964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Balasubramanian, D.; Harper, L.; Shopsin, B.; Torres, V.J. Staphylococcus aureus pathogenesis in diverse host environments. Pathog. Dis 2017, 75, ftx005. [Google Scholar] [CrossRef] [Green Version]
  15. Mun, S.H.; Kong, R.; Seo, Y.; Zhou, T.; Kan, O.; Shin, D.; Kwon, D.Y. Subinhibitory concentrations of punicalagin reduces expression of virulence-related exoproteins by Staphylococcus aureus. FEMS Microbiol. Lett. 2016, 363, fnw253. [Google Scholar] [CrossRef] [Green Version]
  16. Pidwill, G.R.; Gibson, J.F.; Cole, J.; Renshaw, S.A.; Foster, S.J. The Role of Macrophages in Staphylococcus aureus Infection. Front. Immunol. 2021, 11, 3506. [Google Scholar] [CrossRef]
  17. Fusco, V.; Chieffi, D.; Fannelli, F.; Logrieco, A.; Cho, G.; Kabisch, J.; Böhnlein, C.; Franz, C.M. Microbial quality and safety of milk and milk products in the 21st century. Compr. Rev. Food Sci. Food Saf. 2020, 19, 2013–2049. [Google Scholar] [CrossRef]
  18. El-Jakee, J.K.; Atta, N.; Bakry, M.A.; Elgabry, E.A.; Kandil, M.; El-Said, W.A. Antimicrobial resistance in clinical isolates of Staphylococcus aureus from bovine and human sources in Egypt. Glob. Vet. 2011, 7, 581–586. [Google Scholar]
  19. Dahshan, H.; Abd-Elall, A.M.M.; Megahed, A.M.; Abd-El-Kader, M.A.; Nabawy, E.E. Veterinary antibiotic resistance, residues, and ecological risks in environmental samples obtained from poultry farms, Egypt. Environ. Monit. Assess 2015, 187, 2. [Google Scholar] [CrossRef]
  20. Abdallah, H.M.; Al Naiemi, N.; Elsohaby, I.; Mahmoud, A.F.; Salem, G.A.; Vandenbroucke-Grauls, C.M. Prevalence of extended-spectrum β-lactamase-producing Enterobacterales in retail sheep meat from Zagazig city, Egypt. BMC Vet. Res. 2022, 18, 191. [Google Scholar] [CrossRef]
  21. Badawy, B.; Gwida, M.; Sadat, A.; El-Toukhy, M.; Sayed-Ahmed, M.; Alam, N.; Ahmad, S.; Ali, M.; Elafify, M. Prevalence and Antimicrobial Resistance of Virulent Listeria monocytogenes and Cronobacter sakazakii in Dairy Cattle, the Environment, and Dried Milk with the In Vitro Application of Natural Alternative Control. Antibiotics 2022, 11, 1087. [Google Scholar] [CrossRef] [PubMed]
  22. El-Ashker, M.; Gwida, M.; Tomaso, H.; Monecke, S.; Ehricht, R.; El-Gohary, F.; Hotzel, H. Staphylococci in cattle and buffaloes with mastitis in Dakahlia Governorate, Egypt. Dairy Sci. 2015, 98, 7450–7459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Awad, A.; Ramadan, H.; Nasr, S.; Ateya, A.; Atwa, S. Genetic characterization, antimicrobial resistance patterns and virulence determinants of staphylococcus aureus isolated form bovine mastitis. Pak. J. Biol. Sci. 2017, 20, 298–305. [Google Scholar] [CrossRef] [Green Version]
  24. Gwida, M.; Saad, T.; Elgohary, A.; Mohamed, A. Characterization of methicillin-susceptible and methicillin-resistant Staphylococcus aureus from healthy cattle and buffaloes in a linked community. MVMJ 2021, 22, 76–81. [Google Scholar] [CrossRef]
  25. Elmonir, W.; Essa, H.; El-Tras, W.F. Ecology of Staphylococcus aureus and its antibiotic resistance genes in dairy farms: Contributing factors and public health implications. Slov. Vet. Zb. 2019, 55, 747–754. [Google Scholar]
  26. Algammal, A.M.; Enany, M.E.; El-Tarabili, R.M.; Ghobashy, M.O.I.; Helmy, Y.A. Prevalence, antimicrobial resistance profiles, virulence and enterotoxin-determinant genes of MRSA isolated from subclinical bovine mastitis samples in Egypt. Pathogens 2020, 9, 362. [Google Scholar] [CrossRef] [PubMed]
  27. El-Ashker, M.; Gwida, M.; Monecke, S.; El-Gohary, F.; Ehricht, R.; Elsayed, M.; Akinduti, P.; El-Fateh, M.; Maurischat, S. Antimicrobial resistance pattern and virulence profile of S. aureus isolated from household cattle and buffalo with mastitis in Egypt. Vet. Microbiol. 2019, 240, 108535. [Google Scholar] [CrossRef]
  28. Roberson, J.R.; Fox, L.; Hancock, D.D.; Gay, J.M.; Besser, T.E. Ecology of Staphylococcus aureus Isolated from Various Sites on Dairy Farms. J. Dairy Sci. 1994, 77, 3354–3364. [Google Scholar] [CrossRef]
  29. Grima, L.Y.W.; Leliso, S.A.; Bulto, A.O.; Ashenafi, D. Isolation, Identification, and Antimicrobial Susceptibility Profiles of Staphylococcus aureus from Clinical Mastitis in Sebeta Town Dairy Farms. Vet. Med. Int. 2021, 2021, 1772658. [Google Scholar] [CrossRef]
  30. Piccinini, R.; Cesaris, L.; Dapra, V.; Borromeo, V.; Picozz, C.; Secchi, C.; Zecconi, A. The role of teat skin contamination in the epidemiology of staphylococcus aureus intramammary infections. J. Dairy Res. 2009, 76, 36–41. [Google Scholar] [CrossRef]
  31. Zadoks, R.N.; Leeuwen, W.B.; Kreft, D.; Fox, L.K.; Barkema, H.W.; Schukken, Y.H.; Schukken, Y.H.; Van Belkum, A. Comparison of Staphylococcus aureus isolates from bovine and human skin, milking equipment, and bovine milk by phage typing, pulsed-field gel electrophoresis, and binary typing. J. Clin. Microbiol. 2002, 40, 3894–3902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Abo-Shama, U.H. Prevalence and antimicrobial susceptibility of Staphylococcus aureus isolated from cattle, buffalo, sheep and goats. Assiut. Vet. Med. J. 2014, 60, 63–72. [Google Scholar]
  33. Gundogan, N.; Avci, E. Occurrence and antibiotic resistance of Escherichia coli, Staphylococcus aureus and Bacillus cereus in raw milk and dairy products in Turkey. Int. J. Dairy Technol. 2014, 67, 562–569. [Google Scholar] [CrossRef]
  34. Wang, W.; Lin, X.; Jiang, T.; Peng, Z.; Xu, J.; Yi, L.; Li, F.; Fanning, S.; Baloch, Z. Prevalence and characterization of Staphylococcus aureus cultured from raw milk taken from dairy cows with mastitis in Beijing, China. Front. Microbiol. 2018, 9, 1123. [Google Scholar] [CrossRef]
  35. Kou, K.; Cai, H.; Huang, S.; Ni, Y.; Luo, B.; Qian, H.; Ji, H.; Wang, X. Prevalence and Characteristics of Staphylococcus aureus Isolated from Retail Raw Milk in Northern Xinjiang, China. Front. Microbiol. 2021, 12, 705947. [Google Scholar] [CrossRef]
  36. Aqib, A.I.; Ijaz, M.; Durrani, A.; Anjum, A.; Hussain, R.; Sana, S.; Farooqi, S.H.; Hussain, K.; Ahmad, S.S. Prevalence and antibiogram of Staphylococcus aureus, a camel mastitogen from Pakistan. Pak. J. Zool. 2017, 49, 861–867. [Google Scholar] [CrossRef] [Green Version]
  37. Mourabit, N.; Arakrak, A.; Bakkali, M.; Zian, Z.; Bakkach, J.; Laglaoui, A. Nasal carriage of Staphylococcus aureus in farm animals and breeders in north of Morocco. BMC Infect. Dis. 2020, 20, 602. [Google Scholar] [CrossRef]
  38. Jørgensen, H.J.; Mork, T.; Høgåsen, H.R.; Rørvik, L.M. Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. J. Appl. Microbiol. 2005, 99, 158–166. [Google Scholar] [CrossRef]
  39. Lachica, R.V.; Genigeorgis, G.; Hoeprich, P.D. Metachromatic agar-diffusion methods for detecting staphylococcal nuclease activity. Appl. Microbiol. 1971, 21, 585–587. [Google Scholar] [CrossRef]
  40. Mohamed, S.; Al-Ashmawy, M.; Elbarbary, A.; Elbaba, H.A. Assessment of microbiological quality in some cheese varieties in Egypt. BVMJ 2019, 36, 164–174. [Google Scholar] [CrossRef]
  41. Salem, H.; El-Attar, L.E.; Omran, E. Microbiological Assessment of some Parameters of Kariesh Cheese Sold by Supermarkets and Street Vendors in Alexandria, Egypt. J. High Inst. Public Health 2016, 46, 77–85. [Google Scholar] [CrossRef]
  42. D’Amico, D.J.; Donnelly, C.W. Characterization of staphylococcus aureus strains isolated from raw milk utilized in small-scale artisan cheese production. J. Food Prot. 2011, 74, 1353–1358. [Google Scholar] [CrossRef] [PubMed]
  43. Addis, M.; Pal, M.; Kyule, M.N. Isolation and identification of Staphylococcus species from raw bovine milk in Debre Zeit, Ethiopia. Vet. Res. 2011, 4, 45–49. [Google Scholar]
  44. Eid, H.M.; Algammal, A.M.; Elfeil, W.K.; Youssef, F.M.; Harb, S.M.; Abd-Allah, E.M. Prevalence, molecular typing, and antimicrobial resistance of bacterial pathogens isolated from ducks. Vet. World 2019, 12, 677–683. [Google Scholar] [CrossRef] [PubMed]
  45. Enany, M.; Younes, S.; Al Gammal, A.E.; Salem, M.; El Dieb, H. Prevalence of coagulase (coa) gene and mec A gene of S. aureus isolated from bovine clinical mastitis. SCVMJ 2013, 18, 149–157. [Google Scholar] [CrossRef] [Green Version]
  46. García-Álvarez, L.; Holden, M.; Lindsay, H.; Webb, C.; Brown, D.; Curran, M.; Walpole, E.; Brooks, K.; Pickard, D.J.; Teale, C.; et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: A descriptive study. Lancet Infect. Dis. 2011, 11, 595–603. [Google Scholar] [CrossRef] [Green Version]
  47. Rall, V.L.M.; Vieira, F.P.; Rall, R.; Vieities, R.L.; Fernandes, A.; Candeias, J.M.G.; Cardoso, K.F.G.; Araújo, J.P. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Vet. Microbiol. 2008, 132, 408–413. [Google Scholar] [CrossRef]
  48. Asao, T.; Kumeda, Y.; Kawai, T.; Shibata, T.; Oda, H.; Haruki, K.; Nakazawa, H.; Kozaki, S. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: Estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol. Infect 2003, 130, 33–40. [Google Scholar] [CrossRef]
  49. Ikeda, T.; Tamate, N.; Yamaguchi, K.; Makino, S.I. Quantitative analysis of Staphylococcus aureus in skimmed milk powder by real-time PCR. J. Vet. Med. Sci 2005, 67, 1037–1041. [Google Scholar] [CrossRef] [Green Version]
  50. Adame-Gómez, R.; Castro-Alarcón, N.; Vences-Velázquez, A.; Toribio-Jiménez, J.; Pérez-Valdespino, A.; Leyva-Vázquez, M. Genetic Diversity and Virulence Factors of S. aureus Isolated from Food, Humans, and Animals. Int. J. Microbiol. 2020, 2020, 1048097. [Google Scholar] [CrossRef]
  51. Tanzin, T.; Nazir, K.H.; Zahan, M.N.; Parvej, M.S.; Zesmin, K.; Rahman, M.T. Antibiotic resistance profile of bacteria isolated from raw milk samples of cattle and buffaloes. JAVAR 2016, 3, 62–67. [Google Scholar] [CrossRef]
  52. Mphahlele, M.P.; Oguttu, J.W.; Petzer, I.M.; Qekwana, D.N. Prevalence and antimicrobial drug resistance of Staphylococcus aureus isolated from cow milk samples. Vet. World 2020, 13, 2736–2742. [Google Scholar] [CrossRef] [PubMed]
  53. Kimera, Z.I.; Mshana, S.E.; Rweyemamu, M.M.; Mboera, L.E.; Matee, M.I. Antimicrobial use and resistance in food-producing animals and the environment: An African perspective. Antimicrob. Resist. Infect. Control 2020, 9, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Haag, A.F.; Fitzgerald, J.R.; Penadés, J.R. Staphylococcus aureus in Animals. Microbiol. Spectr. 2019, 7, 11. [Google Scholar] [CrossRef] [PubMed]
  55. Brakstad, O.G.; Aasbakk, K.; Maeland, J.A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992, 30, 1654–1660. [Google Scholar] [CrossRef] [Green Version]
  56. Jukes, L.; Mikhail, J.; Bome-Mannathoko, N.; Hadfield, S.J.; Harris, L.G.; El-Bouri, K. Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR. J. Med. Microbiol. 2010, 59, 1456–1461. [Google Scholar] [CrossRef]
  57. Cho, J.I.; Jung, H.J.; Kim, Y.J.; Park, S.H.; Ha, S.D.; Kim, K.S. Detection of methicillin resistance in Staphylococcus aureus isolates using two-step triplex PCR and conventional methods. J. Microbiol. Biotechnol. 2007, 17, 673–676. [Google Scholar]
  58. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing (CLSI, 2020); Thirty Informational Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
  59. Saber, T.; Samir, M.; El-Mekawy, R.; Ariny, E.; El-sayed, S.; Enan, G.; Abdelatif, S.H.; Askora, A.; Merwad, A.M.; Tartor, Y.H. Methicillin- and Vancomycin-Resistant Staphylococcus aureus From Humans and Ready-To-Eat Meat: Characterization of Antimicrobial Resistance and Biofilm Formation Ability. Front Microbiol. 2022, 12, 735494. [Google Scholar] [CrossRef]
Antibiotics 11 01651 g001 550
Figure 1. A heatmap showing the distribution of the antimicrobial resistance phenotypes, mecA and enterotoxin genes among the examined Staphylococcus aureus isolates from cattle, buffalo, and dairy products. Dark red squares indicate phenotypic resistance, the presence of mecA and enterotoxin genes; grey squares indicate phenotypic susceptibility and absent genes. Five clusters (L1–L5) are indicated in the figure.
Figure 1. A heatmap showing the distribution of the antimicrobial resistance phenotypes, mecA and enterotoxin genes among the examined Staphylococcus aureus isolates from cattle, buffalo, and dairy products. Dark red squares indicate phenotypic resistance, the presence of mecA and enterotoxin genes; grey squares indicate phenotypic susceptibility and absent genes. Five clusters (L1–L5) are indicated in the figure.
Antibiotics 11 01651 g001
Table
Table 1. Occurrence of S. aureus in samples collected from cattle, buffalo, milk and their environments.
Table 1. Occurrence of S. aureus in samples collected from cattle, buffalo, milk and their environments.
Type of SampleCattleBuffalop Value
nPositive n (%)No. ExaminedPositive n (%)
Rectal swabs205 (25.0)304 (13.3)0.292
Udder swabs205 (25.0)305 (16.7)0.470
Milk203 (15.0)307 (23.3)0.470
subtotal6013 (21.7)9016 (17.8)0.554
Bedding material204 (20.0)304 (13.3)0.528
Boot swabs203 (15.0)305 (16.7)0.874
Feed202 (10.0)3010 (33.3)0.058
Water203 (15.0)302 (6.7)0.335
subtotal8012 (15.0)12021 (17.5)0.640
Total14025 (17.9)21037 (17.6)0.954
Table
Table 2. Distribution of S. aureus among different samples isolated from cattle and buffalo farms through detection of the nuc gene.
Table 2. Distribution of S. aureus among different samples isolated from cattle and buffalo farms through detection of the nuc gene.
Type of SamplesCattleBuffalo
Farm IFarm IIp ValueFarm IIIFarm IVp Value
nPositive n (%)nPositive n (%)nPositive n (%)nPositive n (%)
Rectal swabs102 (20.0)103 (30.0)0.606152 (13.3)152 (13.3)1.0
Udder swabs103 (30.0)102 (20.0)0.606152 (13.3)153 (20.0)0.624
Milk101 (10.0)102 (20.0)0.531150(0.0)157 (40.0)0.003 *
Subtotal306 (20.0)307 (23.3)0.754454 (8.9)4512 (26.8)0.027 *
Bedding102 (20.0)102 (20.0)1.0151 (6.7)153 (20.0)0.598
Boot swabs102 (20.0)101 (10.0)0.531151 (6.7)154 (26.7)0.330
Feed100 (0.0)102 (20.0)0.136150 (0.0)1510 (66.7)≤0.001 *
Water100 (0.0)103 (30.0)0.06150 (0.0)152 (13.3)0.483
Subtotal404 (10.0)408 (20.0)0.21602 (3.3)6019 (31.7)≤0.001 *
Total7010 (14.3)7015 (21.4)0.2691056 (5.7)10531 (29.5)≤0.001 *
* Indicate significant differences (p < 0.05).
Table
Table 3. Occurrence and distribution of enterotoxin and mecA gene among different sources.
Table 3. Occurrence and distribution of enterotoxin and mecA gene among different sources.
Gene FunctionTarget GenesPositive Samples n/Tested n (%)
CattleBuffaloKarish CheeseTotal
Virulence genessea10/25 (40.0)6/37 (16.2)2/5 (40.0)18/67 (26.9)
seb0/25 (0.0)0/37 (0.0)0/5 (0.0)0/67 (0.0)
sec2/25 (8.0)0/37 (0.0)1/5 (20.0)3/67 (4.5)
sed0/25 (0.0)1/37 (2.7)1/5 (20.0)2/67 (3.0)
Total12/25 (48.0)7/37 (18.9)4/5 (80.0)23/67 (34.3)
Resistance genemecA4/25 (16.0)6/37 (16.2)3/5 (60.0)13/67 (19.4)
Table
Table 4. Antimicrobial resistance profile of S. aureus isolates (n = 67) from animals, environment and Karish cheese.
Table 4. Antimicrobial resistance profile of S. aureus isolates (n = 67) from animals, environment and Karish cheese.
Antimicrobial AgentsConcentration (µg)Resistant n (%)
Clindamycin (CL)1067 (100.0)
Kanamycin (K)3065 (97.0)
Nalidixic acid (NA)3058 (86.6)
Cefotaxime (CF) 3049 (73.1)
Sulphamethazole—trimethoprim (SXT)2544 (65.7)
Cefazolin (CZ) 3036 (53.7)
Tetracycline (T)3031 (46.3)
Erythromycin (E)1525 (37.3)
Ampicillin (AM) 1016 (23.9)
Gentamicin (G)1015 (22.3)
Imipenem (IPM) 109 (13.4)
Amikacin (AK)304 (6.0)
Ciprofloxacin (CP)53 (4.5)
Cefoxitin (FOX)3015 (22.3)
Table
Table 5. Comparison of MAR index between different sample sources (livestock, dairy products and environment).
Table 5. Comparison of MAR index between different sample sources (livestock, dairy products and environment).
Cattle (n = 25)Buffalo (n = 37)p Value
Mean ± SDRangeMean ± SDRange
0.519 ± 0.2350.14–1.00.382 ± 0.2250.07–0.930.024 *
Livestock (n = 29) and dairy products (n = 5) (n = 34)Environment (n = 33)p Value
0.519 ± 0.2600.14–1.00.394 ± 0.2110.07–0.790.035 *
* Indicate significant differences (p < 0.05).
Table
Table 6. Mean ± SD, median, and range of MAR index for samples from different sources.
Table 6. Mean ± SD, median, and range of MAR index for samples from different sources.
SampleMAR Indexp Value
Mean ± SDMedianRange
Rectal swabs0.452 ± 0.3190.3570.14–1.00.027 *
Udder swabs0.386 ± 0.241 ef0.2860.14–0.79
Milk0.621 ± 0.161 adf0.6070.36–0.93
Karish0.700 ± 0.216 bce0.7860.36–0.93
Bedding material0.499 ± 0.1740.5350.29–0.71
Boot swabs0.321 ± 0.100 ab0.3570.14–0.43
Feed0.363 ± 0.216 cd0.3210.07–0.79
Water0.414 ± 0.3470.2860.07–0.79
Similar superscripted letters denote significant differences between different samples. * Indicate significant differences (p < 0.05).
Table
Table 7. Distribution of samples collected from different animal species, environments, milk, and Karish cheese.
Table 7. Distribution of samples collected from different animal species, environments, milk, and Karish cheese.
Herd IDAnimal
Species 		Number of Animals/HerdsSamples Type and Number
Rectal SwabsUdder SwabsMilkBedding MaterialsBoot SwabsFeedWaterTotal
ICattle371010101010101070
IICattle281010101010101070
Subtotal 6520202020202020140
IIIBuffaloes3815151515151515105
IVBuffaloes3915151515151515105
Subtotal 7730303030303030210
Total 14250505050505050350
Karish cheese30 samples of Karish cheese were collected from 10 different markets
(three/market)		380
Table
Table 8. Primer sequences of nuc, mecA, and enterotoxin gene for S. aureus detection used for PCR identification systems.
Table 8. Primer sequences of nuc, mecA, and enterotoxin gene for S. aureus detection used for PCR identification systems.
Target GeneOligonucleotide Sequence (5′→3′)Product Size (bp)References
nuc (F)GCGATTGATGGTGATACGGTT270[55]
nuc (R)AGCCAAGCCTTGACGAACTAAAGC
mecA (F)TAGAAATGACTGAAC GTCCG533[56]
mecA (R)TTGCGATCA ATGTTACCGTAG
sea (F)TTGGAAACGGTTAAAACGAA120[47]
sea (R)GAACCTTCCCATCAAAAACA
seb (F)TCGCATCAAACTGACAAACG478
seb (R)GCGGTACTCTATAAGTGCC
sec (F)GACATAAAAGCTAGGAATTT257
sec (R)AAATCGGATTAACATTATCC
sed (F)CTAGTTTGGTAATATCTCCT317
sed (R)TAATGCTATATCTTATAGGG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Badawy, B.; Elafify, M.; Farag, A.M.M.; Moustafa, S.M.; Sayed-Ahmed, M.Z.; Moawad, A.A.; Algammal, A.M.; Ramadan, H.; Eltholth, M. Ecological Distribution of Virulent Multidrug-Resistant Staphylococcus aureus in Livestock, Environment, and Dairy Products. Antibiotics 2022, 11, 1651. https://doi.org/10.3390/antibiotics11111651

AMA Style

Badawy B, Elafify M, Farag AMM, Moustafa SM, Sayed-Ahmed MZ, Moawad AA, Algammal AM, Ramadan H, Eltholth M. Ecological Distribution of Virulent Multidrug-Resistant Staphylococcus aureus in Livestock, Environment, and Dairy Products. Antibiotics. 2022; 11(11):1651. https://doi.org/10.3390/antibiotics11111651

Chicago/Turabian Style

Badawy, Basma, Mahmoud Elafify, Alshimaa M. M. Farag, Samar M. Moustafa, Mohamed Z. Sayed-Ahmed, Amira A. Moawad, Abdelazeem M. Algammal, Hazem Ramadan, and Mahmoud Eltholth. 2022. "Ecological Distribution of Virulent Multidrug-Resistant Staphylococcus aureus in Livestock, Environment, and Dairy Products" Antibiotics 11, no. 11: 1651. https://doi.org/10.3390/antibiotics11111651

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop