Controlling of Bacterial Virulence: Evaluation of Anti-Virulence Activities of Prazosin against Salmonella enterica
Abstract
:1. Introduction
2. Results
2.1. Determination of Minimum Inhibitory Concentration (MIC) of Prazosin on S. typhimurium and E. coli K-12
2.2. Anti-QS and Anti-Biofilm Activities of Prazosin
2.2.1. Prazosin Downregulated the Expression of sdiA Gene
2.2.2. Prazosin’s Anti-Biofilm Activity
2.3. Prazosin Likely Silences the Bacterial Espionage
2.4. Prazosin Interfered with the Intracellular Replication of S. typhimurium
2.4.1. Prazosin Interfered with the S. typhimurium Intracellular Replication in Macrophages
2.4.2. Prazosin Downregulated the Expression of T3SS-Type 2 Encoding Genes
2.5. Prazosin In Vivo Anti-Virulence Activity
3. Discussion
4. Materials and Methods
4.1. Chemicals and Microbiological Media
4.2. Bacterial Strains and Growth Conditions
4.3. Determination of Minimum Inhibitory Concentrations (MICs) and Prazosin Effect on Bacterial Growth
4.4. Quantitative RT-PCR
4.5. Evaluation of Biofilm Formation
4.6. Evaluation of the S. typhimurium Intracellular Replication
4.7. Evaluation In Vivo Anti-Virulence Activity
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gerlach, R.G.; Hensel, M. Salmonella pathogenicity islands in host specificity, host pathogen-interactions and antibiotics resistance of Salmonella enterica. Berl. Munch. Tierarztl. Wochenschr. 2007, 120, 317–332. [Google Scholar] [PubMed]
- Hegazy, W.A.H.; Hensel, M. Salmonella enterica as a vaccine carrier. Future Microbiol. 2012, 7, 111–127. [Google Scholar] [CrossRef] [PubMed]
- Harish, B.; Menezes, G. Antimicrobial resistance in typhoidal salmonellae. Indian J. Med. Microbiol. 2011, 29, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Askoura, M.; Hegazy, W.A.H. Ciprofloxacin interferes with Salmonella Typhimurium intracellular survival and host virulence through repression of Salmonella pathogenicity island-2 (SPI-2) genes expression. Pathog. Dis. 2020, 78, ftaa011. [Google Scholar] [CrossRef]
- Askoura, M.; Almalki, A.J.; Abu Lila, A.S.; Almansour, K.; Alshammari, F.; Khafagy, E.-S.; Ibrahim, T.S.; Hegazy, W.A.H. Alteration of Salmonella enterica Virulence and Host Pathogenesis through Targeting sdiA by Using the CRISPR-Cas9 System. Microorganisms 2021, 9, 2564. [Google Scholar] [CrossRef]
- Michael, B.; Smith, J.N.; Swift, S.; Heffron, F.; Ahmer, B.M.M. SdiA of Salmonella enterica Is a LuxR Homolog That Detects Mixed Microbial Communities. J. Bacteriol. 2001, 183, 5733–5742. [Google Scholar] [CrossRef] [Green Version]
- Janssens, J.C.A.; Metzger, K.; Daniels, R.; Ptacek, D.; Verhoeven, T.; Habel, L.W.; Vanderleyden, J.; De Vos, D.E.; De Keersmaecker, S.C.J. Synthesis of N-Acyl Homoserine Lactone Analogues Reveals Strong Activators of SdiA, the Salmonella enterica Serovar Typhimurium LuxR Homologue. Appl. Environ. Microbiol. 2007, 73, 535–544. [Google Scholar] [CrossRef] [Green Version]
- Smith, J.N.; Ahmer, B.M.M. Detection of Other Microbial Species by Salmonella: Expression of the SdiA Regulon. J. Bacteriol. 2003, 185, 1357–1366. [Google Scholar] [CrossRef] [Green Version]
- Smith, J.N.; Dyszel, J.L.; Soares, J.A.; Ellermeier, C.D.; Altier, C.; Lawhon, S.D.; Adams, L.G.; Konjufca, V.; Curtiss, R., 3rd; Slauch, J.M.; et al. SdiA, an N-Acylhomoserine Lactone Receptor, Becomes Active during the Transit of Salmonella enterica through the Gastrointestinal Tract of Turtles. PLoS ONE 2008, 3, e2826. [Google Scholar] [CrossRef]
- Chen, G.; Swem, L.R.; Swem, D.L.; Stauff, D.L.; O’Loughlin, C.T.; Jeffrey, P.D.; Bassler, B.L.; Hughson, F.M. A Strategy for Antagonizing Quorum Sensing. Mol. Cell 2011, 42, 199–209. [Google Scholar] [CrossRef]
- Jiang, Q.; Chen, J.; Yang, C.; Yin, Y.; Yao, K. Quorum Sensing: A Prospective Therapeutic Target for Bacterial Diseases. BioMed Res. Int. 2019, 2019, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khayyat, A.N.; Abbas, H.A.; Khayat, M.T.; Shaldam, M.A.; Askoura, M.; Asfour, H.Z.; Khafagy, E.-S.; Abu Lila, A.S.; Allam, A.N.; Hegazy, W.A.H. Secnidazole Is a Promising Imidazole Mitigator of Serratia marcescens Virulence. Microorganisms 2021, 9, 2333. [Google Scholar] [CrossRef]
- Deiwick, J.; Nikolaus, T.; Erdogan, S.; Hensel, M. Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol. Microbiol. 1999, 31, 1759–1773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wael, A.H.H.; Hisham, A.A. Evaluation of the role of SsaV Salmonella pathogenicity island-2 dependent type III secretion system components on the virulence behavior of Salmonella enterica serovar Typhimurium. Afr. J. Biotechnol. 2017, 16, 718–726. [Google Scholar] [CrossRef] [Green Version]
- Hegazy, W.A.H.; Xu, X.; Metelitsa, L.; Hensel, M. Evaluation of Salmonella enterica Type III Secretion System Effector Proteins as Carriers for Heterologous Vaccine Antigens. Infect. Immun. 2012, 80, 1193–1202. [Google Scholar] [CrossRef] [Green Version]
- Hölzer, S.U.; Hensel, M. Divergent Roles of Salmonella Pathogenicity Island 2 and Metabolic Traits during Interaction of S. enterica Serovar Typhimurium with Host Cells. PLoS ONE 2012, 7, e33220. [Google Scholar] [CrossRef]
- Kuhle, V.; Hensel, M. Cellular microbiology of intracellular Salmonella enterica: Functions of the type III secretion system encoded by Salmonella pathogenicity island 2. Experientia 2004, 61, 2812–2826. [Google Scholar] [CrossRef]
- Karavolos, M.H.; Winzer, K.; Williams, P.; Khan, C.M.A. Pathogen espionage: Multiple bacterial adrenergic sensors eavesdrop on host communication systems. Mol. Microbiol. 2012, 87, 455–465. [Google Scholar] [CrossRef]
- Hegazy, W.A.H.; Salem, I.M.; Alotaibi, H.F.; Khafagy, E.-S.; Ibrahim, D. Terazosin Interferes with Quorum Sensing and Type Three Secretion System and Diminishes the Bacterial Espionage to Mitigate the Salmonella Typhimurium Pathogenesis. Antibiotics 2022, 11, 465. [Google Scholar] [CrossRef]
- Moreira, C.G.; Sperandio, V. Interplay between the QseC and QseE Bacterial Adrenergic Sensor Kinases in Salmonella enterica Serovar Typhimurium Pathogenesis. Infect. Immun. 2012, 80, 4344–4353. [Google Scholar] [CrossRef]
- Rasko, D.A.; Moreira, C.G.; Li, D.R.; Reading, N.C.; Ritchie, J.M.; Waldor, M.K.; Williams, N.; Taussig, R.; Wei, S.; Roth, M.; et al. Targeting QseC Signaling and Virulence for Antibiotic Development. Science 2008, 321, 1078–1080. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, W.; Dickson, C.; Kwiatkowski, W.; Choe, S. Structure of the cytoplasmic segment of histidine kinase receptor QseC, a key player in bacterial virulence. Protein Pept. Lett. 2010, 17, 1383–1391. [Google Scholar] [CrossRef] [PubMed]
- Methner, U.; Rabsch, W.; Reissbrodt, R.; Williams, P.H. Effect of norepinephrine on colonisation and systemic spread of Salmonella enterica in infected animals: Role of catecholate siderophore precursors and degradation products. Int. J. Med. Microbiol. 2008, 298, 429–439. [Google Scholar] [CrossRef] [PubMed]
- Moreira, C.G.; Russell, R.; Mishra, A.A.; Narayanan, S.; Ritchie, J.M.; Waldor, M.K.; Curtis, M.M.; Winter, S.E.; Weinshenker, D.; Sperandio, V. Bacterial Adrenergic Sensors Regulate Virulence of Enteric Pathogens in the Gut. mBio 2016, 7, e00826-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ang, S.; Horng, Y.-T.; Shu, J.-C.; Soo, P.-C.; Liu, J.-H.; Yi, W.-C.; Lai, H.-C.; Luh, K.-T.; Ho, S.-W.; Swift, S. The role of RsmA in the regulation of swarming motility inSerratia marcescens. J. Biomed. Sci. 2001, 8, 160–169. [Google Scholar] [CrossRef]
- Kim, W.; Surette, M.G. Coordinated Regulation of Two Independent Cell-Cell Signaling Systems and Swarmer Differentiation in Salmonella enterica Serovar Typhimurium. J. Bacteriol. 2006, 188, 431–440. [Google Scholar] [CrossRef] [Green Version]
- Alandiyjany, M.N.; Abdelaziz, A.S.; Abdelfattah-Hassan, A.; Hegazy, W.A.H.; Hassan, A.A.; Elazab, S.T.; Mohamed, E.A.A.; El-Shetry, E.S.; Saleh, A.A.; ElSawy, N.A.; et al. Novel In Vivo Assessment of Antimicrobial Efficacy of Ciprofloxacin Loaded Mesoporous Silica Nanoparticles against Salmonella typhimurium Infection. Pharmaceuticals 2022, 15, 357. [Google Scholar] [CrossRef]
- Crump, J.A.; Sjölund-Karlsson, M.; Gordon, M.; Parry, C.M. Epidemiology, Clinical Presentation, Laboratory Diagnosis, Antimicrobial Resistance, and Antimicrobial Management of Invasive Salmonella Infections. Clin. Microbiol. Rev. 2015, 28, 901–937. [Google Scholar] [CrossRef] [Green Version]
- Correia, S.; Hébraud, M.; Chafsey, I.; Chambon, C.; Viala, D.; Sáenz, Y.; Capelo, J.L.; Poeta, P.; Igrejas, G. Comparative subproteomic analysis of clinically acquired fluoroquinolone resistance and ciprofloxacin stress in Salmonella Typhimurium DT104B. Proteom.—Clin. Appl. 2017, 11, 1600107. [Google Scholar] [CrossRef]
- Aldawsari, M.F.; Khafagy, E.-S.; Al Saqr, A.; Alalaiwe, A.; Abbas, H.A.; Shaldam, M.A.; Hegazy, W.A.H.; Goda, R.M. Tackling Virulence of Pseudomonas aeruginosa by the Natural Furanone Sotolon. Antibiotics 2021, 10, 871. [Google Scholar] [CrossRef]
- Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Darwish, K.M.; Hegazy, W.A.H. Repurposing α-Adrenoreceptor Blockers as Promising Anti-Virulence Agents in Gram-Negative Bacteria. Antibiotics 2022, 11, 178. [Google Scholar] [CrossRef] [PubMed]
- Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Hegazy, W.A.H.; Darwish, K.M. Computational and Biological Evaluation of β-Adrenoreceptor Blockers as Promising Bacterial Anti-Virulence Agents. Pharmaceuticals 2022, 15, 110. [Google Scholar] [CrossRef] [PubMed]
- Hegazy, W.A.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Mosbah, R.; Soliman, W.E. Repurposing of antidiabetics as Serratia marcescens virulence inhibitors. Braz. J. Microbiol. 2021, 52, 627–638. [Google Scholar] [CrossRef]
- Khayat, M.T.; Abbas, H.A.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Darwish, K.M.; Elhady, S.S.; Khafagy, E.-S.; Safo, M.K.; Hegazy, W.A.H. Anti-Quorum Sensing Activities of Gliptins against Pseudomonas aeruginosa and Staphylococcus aureus. Biomedicines 2022, 10, 1169. [Google Scholar] [CrossRef]
- Al Saqr, A.; Aldawsari, M.F.; Khafagy, E.-S.; Shaldam, M.A.; Hegazy, W.A.H.; Abbas, H.A. A Novel Use of Allopurinol as A Quorum-Sensing Inhibitor in Pseudomonas aeruginosa. Antibiotics 2021, 10, 1385. [Google Scholar] [CrossRef] [PubMed]
- Abbas, H.A.; Hegazy, W.A.H. Targeting the virulence factors of Serratia marcescens by ambroxol. Roum. Arch. Microbiol. Immunol. 2017, 76, 27–32. [Google Scholar]
- Almalki, A.J.; Ibrahim, T.S.; Taher, E.S.; Mohamed, M.F.A.; Youns, M.; Hegazy, W.A.H.; Al-Mahmoudy, A.M.M. Synthesis, Antimicrobial, Anti-Virulence and Anticancer Evaluation of New 5(4H)-Oxazolone-Based Sulfonamides. Molecules 2022, 27, 671. [Google Scholar] [CrossRef]
- Khayyat, A.; Hegazy, W.; Shaldam, M.; Mosbah, R.; Almalki, A.; Ibrahim, T.; Khayat, M.; Khafagy, E.-S.; Soliman, W.; Abbas, H. Xylitol Inhibits Growth and Blocks Virulence in Serratia marcescens. Microorganisms 2021, 9, 1083. [Google Scholar] [CrossRef]
- Hegazy, W.A.H.; Rajab, A.A.H.; Abu Lila, A.S.; A Abbas, H. Anti-diabetics and antimicrobials: Harmony of mutual interplay. World J. Diabetes 2021, 12, 1832–1855. [Google Scholar] [CrossRef]
- Aldawsari, M.; Alalaiwe, A.; Khafagy, E.-S.; Al Saqr, A.; Alshahrani, S.; Alsulays, B.; Alshehri, S.; Abu Lila, A.; Rizvi, S.D.; Hegazy, W. Efficacy of SPG-ODN 1826 Nanovehicles in Inducing M1 Phenotype through TLR-9 Activation in Murine Alveolar J774A.1 Cells: Plausible Nano-Immunotherapy for Lung Carcinoma. Int. J. Mol. Sci. 2021, 22, 6833. [Google Scholar] [CrossRef]
- García-Contreras, R. Is Quorum Sensing Interference a Viable Alternative to Treat Pseudomonas aeruginosa Infections? Front. Microbiol. 2016, 7, 1454. [Google Scholar] [CrossRef] [PubMed]
- Kellici, T.F.; Liapakis, G.; Tzakos, A.G.; Mavromoustakos, T. Pharmaceutical Compositions for Antihypertensive Treatments: A Patent Review. Expert Opin. Ther. Pat. 2015, 25, 1305–1317. [Google Scholar] [CrossRef] [PubMed]
- Rutherford, S.T.; Bassler, B.L. Bacterial Quorum Sensing: Its Role in Virulence and Possibilities for Its Control. Cold Spring Harb. Perspect. Med. 2012, 2, a012427. [Google Scholar] [CrossRef] [PubMed]
- Groisman, E.A.; Duprey, A.; Choi, J. How the PhoP/PhoQ System Controls Virulence and Mg2+ Homeostasis: Lessons in Signal Transduction, Pathogenesis, Physiology, and Evolution. Microbiol. Mol. Biol. Rev. 2021, 85, e0017620. [Google Scholar] [CrossRef]
- Carabajal, M.A.; Asquith, C.R.M.; Laitinen, T.; Tizzard, G.J.; Yim, L.; Rial, A.; Chabalgoity, J.A.; Zuercher, W.J.; Véscovi, E.G. Quinazoline-Based Antivirulence Compounds Selectively Target Salmonella PhoP/PhoQ Signal Transduction System. Antimicrob. Agents Chemother. 2019, 64, e01744-19. [Google Scholar] [CrossRef]
- Guarnieri, M.T.; Zhang, L.; Shen, J.; Zhao, R. The Hsp90 Inhibitor Radicicol Interacts with the ATP-Binding Pocket of Bacterial Sensor Kinase PhoQ. J. Mol. Biol. 2008, 379, 82–93. [Google Scholar] [CrossRef]
- Boibessot, T.; Zschiedrich, C.P.; Lebeau, A.; Bénimèlis, D.; Dunyach-Rémy, C.; Lavigne, J.-P.; Szurmant, H.; Benfodda, Z.; Meffre, P. The Rational Design, Synthesis, and Antimicrobial Properties of Thiophene Derivatives That Inhibit Bacterial Histidine Kinases. J. Med. Chem. 2016, 59, 8830–8847. [Google Scholar] [CrossRef] [Green Version]
- Gilmour, R.; Foster, J.E.; Sheng, Q.; McClain, J.R.; Riley, A.; Sun, P.-M.; Ng, W.-L.; Yan, D.; Nicas, T.I.; Henry, K.; et al. New Class of Competitive Inhibitor of Bacterial Histidine Kinases. J. Bacteriol. 2005, 187, 8196–8200. [Google Scholar] [CrossRef] [Green Version]
- Aykac, A.; Şehirli, A.; Gören, M.Z. Evaluation of the Effect of Prazosin Treatment on α-2c Adrenoceptor and Apoptosis Protein Levels in the Predator Scent-Induced Rat Model of Post-Traumatic Stress Disorder. J. Mol. Neurosci. 2020, 70, 1120–1129. [Google Scholar] [CrossRef]
- Xu, X.; Hegazy, W.A.; Guo, L.; Gao, X.; Courtney, A.N.; Kurbanov, S.; Liu, D.; Tian, G.; Manuel, E.R.; Diamond, D.J.; et al. Effective Cancer Vaccine Platform Based on Attenuated Salmonella and a Type III Secretion System. Cancer Res. 2014, 74, 6260–6270. [Google Scholar] [CrossRef] [Green Version]
- Khayyat, A.; Abbas, H.; Mohamed, M.; Asfour, H.; Khayat, M.; Ibrahim, T.; Youns, M.; Khafagy, E.-S.; Abu Lila, A.; Safo, M.; et al. Not Only Antimicrobial: Metronidazole Mitigates the Virulence of Proteus mirabilis Isolated from Macerated Diabetic Foot Ulcer. Appl. Sci. 2021, 11, 6847. [Google Scholar] [CrossRef]
- Mohr, K.I. History of Antibiotics Research. Curr. Top. Microbiol. Immunol. 2016, 398, 237–272. [Google Scholar] [CrossRef] [PubMed]
- Livermore, D.M.; British Society for Antimicrobial Chemotherapy Working Party on The Urgent Need: Regenerating Antibacterial Drug Discovery and Development; Blaser, M.; Carrs, O.; Cassell, G.; Fishman, N.; Guidos, R.; Levy, S.; Powers, J.; Norrby, R.; et al. Discovery research: The scientific challenge of finding new antibiotics. J. Antimicrob. Chemother. 2011, 66, 1941–1944. [Google Scholar] [CrossRef] [Green Version]
- El-Hamid, M.I.A.; Sewid, A.H.; Samir, M.; Hegazy, W.A.H.; Bahnass, M.M.; Mosbah, R.A.; Ghaith, D.M.; Khalifa, E.; Ramadan, H.; Alshareef, W.A.; et al. Clonal Diversity and Epidemiological Characteristics of ST239-MRSA Strains. Front. Cell. Infect. Microbiol. 2022, 12, 782045. [Google Scholar] [CrossRef]
- Brackman, G.; Cos, P.; Maes, L.; Nelis, H.J.; Coenye, T. Quorum Sensing Inhibitors Increase the Susceptibility of Bacterial Biofilms to Antibiotics In Vitro and In Vivo. Antimicrob. Agents Chemother. 2011, 55, 2655–2661. [Google Scholar] [CrossRef] [Green Version]
- Khayat, M.T.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Shaldam, M.A.; Mohammad, K.A.; Khafagy, E.-S.; El-Damasy, D.A.; Hegazy, W.A.H.; Abbas, H.A. Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa. Microorganisms 2022, 10, 1046. [Google Scholar] [CrossRef]
- Kalia, V.C.; Purohit, H.J. Quenching the quorum sensing system: Potential antibacterial drug targets. Crit. Rev. Microbiol. 2011, 37, 121–140. [Google Scholar] [CrossRef] [PubMed]
- Papenfort, K.; Bassler, B.L. Quorum sensing signal–response systems in Gram-negative bacteria. Nat. Rev. Microbiol. 2016, 14, 576–588. [Google Scholar] [CrossRef] [Green Version]
- Agha, K.A.; Abo-Dya, N.E.; Ibrahim, T.S.; Abdel-Aal, E.H.; Hegazy, W.A. Benzotriazole-Mediated Synthesis and Antibacterial Activity of Novel N-Acylcephalexins. Sci. Pharm. 2016, 84, 484–496. [Google Scholar] [CrossRef] [Green Version]
- Cavalu, S.; Elbaramawi, S.S.; Eissa, A.G.; Radwan, M.F.; Ibrahim, S.T.; Khafagy, E.-S.; Lopes, B.S.; Ali, M.A.M.; Hegazy, W.A.H.; Elfaky, M.A. Characterization of the Anti-Biofilm and Anti-Quorum Sensing Activities of the β-Adrenoreceptor Antagonist Atenolol against Gram-Negative Bacterial Pathogens. Int. J. Mol. Sci. 2022, 23, 13088. [Google Scholar] [CrossRef]
- Thabit, A.K.; Eljaaly, K.; Zawawi, A.; Ibrahim, T.S.; Eissa, A.G.; Elbaramawi, S.S.; Hegazy, W.A.H.; Elfaky, M.A. Silencing of Salmonella typhimurium Pathogenesis: Atenolol Acquires Efficient Anti-Virulence Activities. Microorganisms 2022, 10, 1976. [Google Scholar] [CrossRef] [PubMed]
- Thabit, A.K.; Eljaaly, K.; Zawawi, A.; Ibrahim, T.S.; Eissa, A.G.; Elbaramawi, S.S.; Hegazy, W.A.H.; Elfaky, M.A. Muting Bacterial Communication: Evaluation of Prazosin Anti-Quorum Sensing Activities against Gram-Negative Bacteria Pseudomonas aeruginosa, Proteus mirabilis, and Serratia marcescens. Biology 2022, 11, 1349. [Google Scholar] [CrossRef] [PubMed]
- John, J.; Britto, C.D.; Verghese, V.P.; Pollard, A.J. A systematic review of antimicrobial resistance of typhoidal Salmonella in India. Indian J. Med. Res. 2019, 149, 151–163. [Google Scholar] [CrossRef]
- Ahmer, B.M.M. Cell-to-cell signalling in Escherichia coli and Salmonella enterica. Mol. Microbiol. 2004, 52, 933–945. [Google Scholar] [CrossRef]
- Pena, R.T.; Blasco, L.; Ambroa, A.; González-Pedrajo, B.; Fernández-García, L.; López, M.; Bleriot, I.; Bou, G.; García-Contreras, R.; Wood, T.K.; et al. Relationship Between Quorum Sensing and Secretion Systems. Front. Microbiol. 2019, 10, 1100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flierl, M.A.; Rittirsch, D.; Nadeau, B.A.; Sarma, J.V.; Day, D.E.; Lentsch, A.B.; Huber-Lang, M.S.; Ward, P.A. Upregulation of Phagocyte-Derived Catecholamines Augments the Acute Inflammatory Response. PLoS ONE 2009, 4, e4414. [Google Scholar] [CrossRef] [Green Version]
- Daviu, N.; Bruchas, M.R.; Moghaddam, B.; Sandi, C.; Beyeler, A. Neurobiological links between stress and anxiety. Neurobiol. Stress 2019, 11, 100191. [Google Scholar] [CrossRef]
- Sandrini, S.M.; Shergill, R.; Woodward, J.; Muralikuttan, R.; Haigh, R.D.; Lyte, M.; Freestone, P.P. Elucidation of the Mechanism by Which Catecholamine Stress Hormones Liberate Iron from the Innate Immune Defense Proteins Transferrin and Lactoferrin. J. Bacteriol. 2010, 192, 587–594. [Google Scholar] [CrossRef] [Green Version]
- Clark, D.J.; Maaløe, O.D.N.A. DNA replication and the division cycle in Escherichia coli. J. Mol. Biol. 1967, 23, 99–112. [Google Scholar] [CrossRef]
- Reisner, A.; Krogfelt, K.A.; Klein, B.M.; Zechner, E.L.; Molin, S. In Vitro Biofilm Formation of Commensal and Pathogenic Escherichia coli Strains: Impact of Environmental and Genetic Factors. J. Bacteriol. 2006, 188, 3572–3581. [Google Scholar] [CrossRef] [Green Version]
- Askoura, M.; Abbas, H.A.; Al Sadoun, H.; Abdulaal, W.H.; Abu Lila, A.S.; Almansour, K.; Alshammari, F.; Khafagy, E.-S.; Ibrahim, T.S.; Hegazy, W.A.H. Elevated Levels of IL-33, IL-17 and IL-25 Indicate the Progression from Chronicity to Hepatocellular Carcinoma in Hepatitis C Virus Patients. Pathogens 2022, 11, 57. [Google Scholar] [CrossRef] [PubMed]
- Youns, M.; Askoura, M.; A Abbas, H.; Attia, G.H.; Khayyat, A.N.; Goda, R.M.; Almalki, A.J.; Khafagy, E.-S.; Hegazy, W.A. Celastrol Modulates Multiple Signaling Pathways to Inhibit Proliferation of Pancreatic Cancer via DDIT3 and ATF3 Up-Regulation and RRM2 and MCM4 Down-Regulation. OncoTargets Ther. 2021, 14, 3849–3860. [Google Scholar] [CrossRef] [PubMed]
- Halatsi, K.; Oikonomou, I.; Lambiri, M.; Mandilara, G.; Vatopoulos, A.; Kyriacou, A. PCR detection of Salmonellaspp. using primers targeting the quorum sensing gene sdiA. FEMS Microbiol. Lett. 2006, 259, 201–207. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer Sequence: 5′- 3′ | Gene Significance | Reference |
gyrB | F: GTGATCAGCGTCGCCACTR: GCGCGGTGATCAGCGTC | Housekeeping | [4] |
sdiA | F: AAT ATC GCT TCG TAC CACR: GTA GGT AAA CGA GGA GCA G | Adhesion | [73] |
qseC | F: GGTACCAAATTGACGCAACGTCTCAGR: GAATTCGCCCAACTTACTACGGCCTC | Sensor to adrenergic hormones | [20] |
qseE | F: GGTACCAGCGACACGTTGAAGCGCR: GAATTCGCGTGTTTGTCAGATGCAGG | Sensor to adrenergic hormones | [20] |
ssrB | F: CGCAGGTGCTAATGGCTATGR: TTTGCAATGCCGCTAACAGA | SPI2-expression regulation | [4] |
ssaE | F: CCGCAGCAATATCAGCAAAAR: AAGTGCGCTGTTATGGTAACGA | SPI2-intracellular replication | [4] |
ssaJ | F: TGTCGAGCAGTCGCAGTTTATTAR: TGCCTATGCGGATAACCGTTA | SPI2-intracellular replication | [4] |
sseF | F: TCAGGAATCGCTATTTCTATGR: GTCAGGCTAACGGAGGTAA | SPI2-intracellular replication | [4] |
sseJ | F: AATAAATCACATCCCAAGCR: ACTCAGTCCAGGTAAATCC | SPI2-intracellular replication | [4] |
sseI | F: GATACCCCCCCTGAAATGAGTTR: GTGACAAATCGTCCAGATGCA | SPI2-intracellular replication | [4] |
sifA | F: TACCACCACCGCATACCCAR: ACGAGGAACGCCTGAAACG | Salmonella-inducing filaments (SPI2) | [4] |
SifB | F: TGATACTCAGCCTGCCCACR: GCTCAGGGAACAAGCAAC | Salmonella-inducing filaments (SPI2) | [4] |
sscA | F: GGCTCGCTGCGTATGTTGTTR: GCCGGCGAATTCTTTTACCT | SPI2 chaperon intracellular replication | [4] |
qseC | F: GGTACCAAATTGACGCAACGTCTCAGR: GAATTCGCCCAACTTACTACGGCCTC | Sensor to adrenergic hormones | [20] |
qseE | F: GGTACCAGCGACACGTTGAAGCGCR: GAATTCGCGTGTTTGTCAGATGCAGG | Sensor to adrenergic hormones | [20] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elfaky, M.A.; Thabit, A.K.; Eljaaly, K.; Zawawi, A.; Abdelkhalek, A.S.; Almalki, A.J.; Ibrahim, T.S.; Hegazy, W.A.H. Controlling of Bacterial Virulence: Evaluation of Anti-Virulence Activities of Prazosin against Salmonella enterica. Antibiotics 2022, 11, 1585. https://doi.org/10.3390/antibiotics11111585
Elfaky MA, Thabit AK, Eljaaly K, Zawawi A, Abdelkhalek AS, Almalki AJ, Ibrahim TS, Hegazy WAH. Controlling of Bacterial Virulence: Evaluation of Anti-Virulence Activities of Prazosin against Salmonella enterica. Antibiotics. 2022; 11(11):1585. https://doi.org/10.3390/antibiotics11111585
Chicago/Turabian StyleElfaky, Mahmoud A., Abrar K. Thabit, Khalid Eljaaly, Ayat Zawawi, Ahmed S. Abdelkhalek, Ahmad J. Almalki, Tarek S. Ibrahim, and Wael A. H. Hegazy. 2022. "Controlling of Bacterial Virulence: Evaluation of Anti-Virulence Activities of Prazosin against Salmonella enterica" Antibiotics 11, no. 11: 1585. https://doi.org/10.3390/antibiotics11111585
APA StyleElfaky, M. A., Thabit, A. K., Eljaaly, K., Zawawi, A., Abdelkhalek, A. S., Almalki, A. J., Ibrahim, T. S., & Hegazy, W. A. H. (2022). Controlling of Bacterial Virulence: Evaluation of Anti-Virulence Activities of Prazosin against Salmonella enterica. Antibiotics, 11(11), 1585. https://doi.org/10.3390/antibiotics11111585