Antimicrobial Resistance Profile of Common Foodborne Pathogens Recovered from Livestock and Poultry in Bangladesh
Abstract
1. Introduction
2. Results
2.1. Prevalence of AMR Pathogens in Animal-Derived Food Products
2.2. Phenotypic Resistance Pattern
2.3. Genotypic Resistance Pattern of the Isolates Recovered from Both Livestock and Poultry Food Products & By-Products
3. Discussion
4. Materials and Methods
4.1. Study Area
4.2. Sampling Design
4.3. Conventional Culture Method
4.4. Molecular Detection
4.5. Determination of Phenotypic Resistance Pattern
4.6. Determination of Genotypic Resistance Pattern
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Assefa, A.; Bihon, A. A systematic review and meta-analysis of prevalence of Escherichia coli in foods of animal origin in Ethiopia. Heliyon 2018, 4, e00716. [Google Scholar] [CrossRef] [PubMed]
- Haile, A.F.; Kebede, D.; Wubshet, A.K. Prevalence and antibiogram of Escherichia coli O157 isolated from bovine in Jimma, Ethiopia: Abattoirbased survey. Ethiop. Vet. J. 2017, 21, 109. [Google Scholar] [CrossRef][Green Version]
- Tassew, H.; Abdissa, A.; Beyene, G.; Gebre-Selassie, S. Microbial flora and food borne pathogens on minced meat and their susceptibility to antimicrobial agents. Ethiop. J. Health Sci. 2010, 20, 137–143. [Google Scholar] [CrossRef]
- Addis, M.; Sisay, D. A review on major food borne bacterial illnesses. J. Trop. Dis. 2015, 3, 1–7. [Google Scholar] [CrossRef]
- Wu, S.; Duan, N.; Gu, H.; Hao, L.; Ye, H.; Gong, W.; Wang, Z. A review of the methods for detection of staphylococcus aureus enterotoxins. Toxins 2016, 8, 176. [Google Scholar] [CrossRef]
- Abebe, E.; Gugsa, G.; Ahmed, M. Review on major food-borne zoonotic bacterial pathogens. J. Trop. Med. 2020, 2020, 4674235. [Google Scholar] [CrossRef]
- Zelalem, A.; Sisay, M.; Vipham, J.L.; Abegaz, K.; Kebede, A.; Terefe, Y. The prevalence and antimicrobial resistance profiles of bacterial isolates from meat and meat products in Ethiopia: A systematic review and meta-analysis. Int. J. Food Contam. 2019, 6, 1. [Google Scholar] [CrossRef]
- Carrique-Mas, J.J.; Bryant, J. A review of foodborne bacterial and parasitic zoonoses in Vietnam. EcoHealth 2013, 10, 465–489. [Google Scholar] [CrossRef]
- Abunna, F.; Abriham, T.; Gizaw, F.; Beyene, T.; Feyisa, A.; Ayana, D.; Mamo, B.; Duguma, R. Staphylococcus: Isolation, identification and antimicrobial resistance in dairy cattle farms, municipal abattoir and personnel in and around Asella, Ethiopia. J. Veter- Sci. Technol. 2016, 7, 1000383. [Google Scholar] [CrossRef]
- Alam Siddiky, N.; Khan, S.R.; Sarker, S.; Bhuiyan, M.K.J.; Mahmud, A.; Rahman, T.; Ahmed, M.M.; Samad, M.A. Knowledge, attitude and practice of chicken vendors on food safety and foodborne pathogens at wet markets in Dhaka, Bangladesh. Food Control 2022, 131, 108456. [Google Scholar] [CrossRef]
- Mustafa, A.S.; Inanc, A.L. Antibiotic resistance of Escherichia coli O157:H7 isolated from chicken meats. J. Agric. Nat. 2018, 21, 7–12. [Google Scholar] [CrossRef]
- Tasbihullah, T.; Rahman, S.U.; Ali, T.; Saddique, U.; Ahmad, S.; Shafiq, M.; Ayaz, S.; Khan, H.; Ahmad, I.; Asadullah, A.; et al. High occurrence rate of multidrug-resistant ESBL-producing E. coli recovered from table eggs in district Peshawar, Pakistan. Pak. J. Zool. 2020, 52, 1231–1238. [Google Scholar] [CrossRef]
- Hemalata, V.; Virupakshaiah, D. Isolation and identification of food borne pathogens from spoiled food samples. Int. J. Curr. Microbiol. Appl. Sci. 2016, 5, 1017–1025. [Google Scholar] [CrossRef]
- Faris, G. Identification of campylobacter species and their antibiotic resistance patterns from raw bovine meat in Addis Ababa, Ethiopia. IJMIR 2015, 4, 1–5. [Google Scholar]
- Sustainable Development Goals (SDGs) AMR indicator. Global Antimicrobial Resistance and Use Surveillance System (GLASS) Report. 2021. Available online: https://www.who.int/publications/i/item/9789240027336 (accessed on 1 October 2022).
- Alhashash, F.; Weston, V.; Diggle, M.; McNally, A. Multidrug-resistant Escherichia coli bacteremia. Emerg. Infect. Dis. 2013, 19, 1699–1701. [Google Scholar] [CrossRef] [PubMed]
- Cornejo-Juárez, P.; Vilar-Compte, D.; Pérez-Jiménez, C.; Ñamendys-Silva, S.; Sandoval-Hernández, S.; Volkow-Fernández, P. The impact of hospital-acquired infections with multidrug-resistant bacteria in an oncology intensive care unit. Int. J. Infect. Dis. 2015, 31, 31–34. [Google Scholar] [CrossRef]
- Reinthaler, F.; Posch, J.; Feierl, G.; Wüst, G.; Haas, D.; Ruckenbauer, G.; Mascher, F.; Marth, E. Antibiotic resistance of E. coli in sewage and sludge. Water Res. 2003, 37, 1685–1690. [Google Scholar] [CrossRef]
- Kwon, J.H.; Powderly, W.G. The post-antibiotic era is here. Science 2021, 373, 471. [Google Scholar] [CrossRef]
- Mayrhofer, S.; Paulsen, P.; Smulders, F.J.; Hilbert, F. Antimicrobial resistance profile of five major food-borne pathogens isolated from beef, pork and poultry. Int. J. Food Microbiol. 2004, 97, 23–29. [Google Scholar] [CrossRef]
- Shafiq, M.; Huang, J.; Rahman, S.U.; Shah, J.M.; Chen, L.; Gao, Y.; Wang, M.; Wang, L. High incidence of multidrug-resistant Escherichia coli coharboring mcr-1 and blaCTX-M-15 recovered from pigs. Infect. Drug Resist. 2019, 12, 2135–2149. [Google Scholar] [CrossRef]
- Uyttendaele, M.; De Troy, P.; Debevere, J. Incidence of salmonella, campylobacter Jejuni, Campylobacter coli, and listeria monocytogenes in poultry carcasses and different types of poultry products for sale on the Belgian retail market. J. Food Prot. 1999, 62, 735–740. [Google Scholar] [CrossRef] [PubMed]
- Shafiq, M.; Huang, J.; Shah, J.M.; Ali, I.; Rahman, S.U.; Wang, L. Characterization and resistant determinants linked to mobile elements of ESBL-producing and mcr-1-positive Escherichia coli recovered from the chicken origin. Microb. Pathog. 2021, 150, 104722. [Google Scholar] [CrossRef] [PubMed]
- Ferdous, M.R.A.; Ahmed, R.; Khan, S.H.; Mukta, M.A.; Anika, T.T.; Hossain, T.; Islam, Z.; Rafiq, K. Effect of discriminate and indiscriminate use of oxytetracycline on residual status in broiler soft tissues. Vet. World 2020, 13, 61–67. [Google Scholar] [CrossRef] [PubMed]
- Oniciuc, E.-A.; Likotrafiti, E.; Alvarez-Molina, A.; Prieto, M.; López, M.; Alvarez-Ordóñez, A. Food processing as a risk factor for antimicrobial resistance spread along the food chain. Curr. Opin. Food Sci. 2019, 30, 21–26. [Google Scholar] [CrossRef]
- Uddin, J.; Hossain, K.; Hossain, S.; Saha, K.; Jubyda, F.T.; Haque, R.; Billah, B.; Talukder, A.A.; Parvez, A.K.; Dey, S.K. Bacteriological assessments of foodborne pathogens in poultry meat at different super shops in Dhaka, Bangladesh. Ital. J. Food Saf. 2019, 8, 6720. [Google Scholar] [CrossRef]
- Alam, B.; Uddin, N.; Mridha, D.; Akhter, A.H.M.T.; Islam, S.K.S.; Haque, A.K.M.Z.; Kabir, S.M.L. Occurrence of Campylobacter spp. in selected small scale commercial broiler farms of Bangladesh related to good farm practices. Microorganisms 2020, 8, 1778. [Google Scholar] [CrossRef]
- Hoque, M.N.; Mohiuddin, R.B.; Khan MM, H.; Hannan, A.; Alam, M.J. Outbreak of salmonella in poultry of Bangladesh and possible remedy. J. Adv. Biotechnol. Exp. Ther. 2019, 2, 87. [Google Scholar] [CrossRef]
- Granowitz, E.V.; Brown, R.B. Antibiotic adverse reactions and drug interactions. Crit. Care Clin. 2008, 24, 421–442. [Google Scholar] [CrossRef]
- Adzitey, F. Incidence and antimicrobial susceptibility of Escherichia coli isolated from beef (meat muscle, liver and kidney) samples in Wa Abattoir, Ghana. Cogent Food Agric. 2020, 6, 1718269. [Google Scholar] [CrossRef]
- Hossain, T.; Rafiq, K.; Islam, Z.; Chowdhury, S.; Islam, P.; Haque, Z.; Samad, M.A.; Sani, A.A.; Ferdous, M.R.A.; Islam, R.; et al. A survey on knowledge, attitude, and practices of large-animal farmers towards antimicrobial use, resistance, and residues in Mymensingh division of Bangladesh. Antibiotics 2022, 11, 442. [Google Scholar] [CrossRef]
- Javadi, A.; Khatibi, S.A. Effect of commercial probiotic (Protexin®) on growth, survival and microbial quality of shrimp (Litopenaeus vannamei). Nutr. Food Sci. 2017, 47, 204–216. [Google Scholar] [CrossRef]
- Abolghait, S.K.; Fathi, A.G.; Youssef, F.M.; Algammal, A.M. Methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and giblets often produces staphylococcal enterotoxin B (SEB) in non-refrigerated raw chicken livers. Int. J. Food Microbiol. 2020, 328, 108669. [Google Scholar] [CrossRef] [PubMed]
- Algammal, A.M.; Mabrok, M.; Sivaramasamy, E.; Youssef, F.M.; Atwa, M.H.; El-Kholy, A.W.; Hetta, H.F.; Hozzein, W.N. Emerging MDR-Pseudomonas aeruginosa in fish commonly harbor oprL and toxA virulence genes and blaTEM, blaCTX-M, and tetA antibiotic-resistance genes. Sci. Rep. 2020, 10, 15961. [Google Scholar] [CrossRef] [PubMed]
- Enany, M.E.; Algammal, A.M.; Nasef, S.; Abo-Eillil, S.A.M.; Bin-Jumah, M.; Taha, A.E.; Allam, A.A. The occurrence of the multidrug resistance (MDR) and the prevalence of virulence genes and QACs resistance genes in E. coli isolated from environmental and avian sources. AMB Express 2019, 9, 192. [Google Scholar] [CrossRef]
- Saraiva, M.D.M.S.; Lim, K.; Monte, D.F.M.D.; Givisiez, P.E.N.; Alves, L.B.R.; Neto, O.C.D.F.; Kariuki, S.; Júnior, A.B.; de Oliveira, C.J.B.; Gebreyes, W.A. Antimicrobial resistance in the globalized food chain: A One Health perspective applied to the poultry industry. Braz. J. Microbiol. 2021, 53, 465–486. [Google Scholar] [CrossRef]
- Broglia, A.; Kapel, C. Changing dietary habits in a changing world: Emerging drivers for the transmission of foodborne parasitic zoonoses. Vet. Parasitol. 2011, 182, 2–13. [Google Scholar] [CrossRef]
- Chang, Q.; Wang, W.; Regev-Yochay, G.; Lipsitch, M.; Hanage, W.P. Antibiotics in agriculture and the risk to human health: How worried should we be? Evol. Appl. 2015, 8, 240–247. [Google Scholar] [CrossRef]
- Al Amin, A.; Hoque, M.N.; Siddiki, A.Z.; Saha, S.; Kamal, M. Antimicrobial resistance situation in animal health of Bangladesh. Vet. World 2020, 13, 2713–2727. [Google Scholar] [CrossRef]
- Bag, A.S.; Khan, S.R.; Sami, D.H.; Begum, F.; Islam, S.; Rahman, M.; Rahman, T.; Hassan, J. Virulence determinants and antimicrobial resistance of E. coli isolated from bovine clinical mastitis in some selected dairy farms of Bangladesh. Saudi J. Biol. Sci. 2021, 28, 6317–6323. [Google Scholar] [CrossRef]
- Bupasha, Z.B.; Begum, R.; Karmakar, S.; Akter, R.; Ahad, A. Multidrug-resistant salmonella spp. isolated from apparently healthy pigeons in a live bird market in Chattogram, Bangladesh. World’s Vet. J. 2020, 10, 508–513. [Google Scholar] [CrossRef]
- Das Gupta, M.; Islam, M.; Sen, A.; Sarker, S.; Das, A. Prevalence and antibiotic susceptibility pattern of Escherichia coli in cattle on Bathan and intensive rearing system. Microbes Health 2017, 6, 34062. [Google Scholar] [CrossRef][Green Version]
- Ievy, S.; Islam, M.S.; Sobur, M.A.; Talukder, M.; Rahman, M.B.; Khan, M.F.R.; Rahman, M.T. Rahman molecular detection of avian pathogenic Escherichia coli (APEC) for the first time in layer farms in Bangladesh and their antibiotic resistance patterns. Microorganisms 2020, 8, 1021. [Google Scholar] [CrossRef] [PubMed]
- Parvin, M.S.; Talukder, S.; Ali, Y.; Chowdhury, E.H.; Rahman, T.; Islam, T. Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens 2020, 9, 420. [Google Scholar] [CrossRef]
- Rahman, M.; Husna, A.; Elshabrawy, H.A.; Alam, J.; Runa, N.Y.; Badruzzaman, A.T.M.; Banu, N.A.; Al Mamun, M.; Paul, B.; Das, S.; et al. Isolation and molecular characterization of multidrug-resistant Escherichia coli from chicken meat. Sci. Rep. 2020, 10, 21999. [Google Scholar] [CrossRef]
- Disassa, N.; Sibhat, B.; Mengistu, S.; Muktar, Y.; Belina, D. Prevalence and antimicrobial susceptibility pattern of E. coli O157:H7 isolated from traditionally marketed raw cow milk in and around Asosa Town, Western Ethiopia. Vet. Med. Int. 2017, 2017, 7581531. [Google Scholar] [CrossRef]
- Messele, Y.E.; Abdi, R.D.; Tegegne, D.T.; Bora, S.K.; Babura, M.D.; Emeru, B.A.; Werid, G.M. Analysis of milk-derived isolates of E. coli indicating drug resistance in central Ethiopia. Trop. Anim. Health Prod. 2018, 51, 661–667. [Google Scholar] [CrossRef]
- Elmonir, W.; Abo-Remela, E.; Sobeih, A. Public health risks of Escherichia coli and Staphylococcus aureus in raw bovine milk sold in informal markets in Egypt. J. Infect. Dev. Ctries. 2018, 12, 533–541. [Google Scholar] [CrossRef] [PubMed]
- Siddiky, N.; Sarker, S.; Khan, S.R.; Begum, R.; Kabir, E.; Karim, R.; Rahman, T.; Mahmud, A.; Samad, M. Virulence and antimicrobial resistance profiles of Salmonella enterica serovars isolated from chicken at wet markets in Dhaka, Bangladesh. Microorganisms 2021, 9, 952. [Google Scholar] [CrossRef]
- Kemal, J.; Sibhat, B.; Menkir, S.; Terefe, Y.; Muktar, Y. African journal of microbiology research antimicrobial resistance patterns of salmonella in Ethiopia: A review. Afr. J. Microbiol. Res. 2015, 9, 2249–2256. [Google Scholar] [CrossRef]
- Addis, Z.; Kebede, N.; Sisay, Z.; Alemayehu, H.; Wubetie, A.; Kassa, T. Prevalence and antimicrobial resistance of Salmonella isolated from lactating cows and in contact humans in dairy farms of Addis Ababa: A cross sectional study. BMC Infect. Dis. 2011, 11, 1–17. [Google Scholar] [CrossRef]
- Dhanalakshmi, M.; Balakrishnan, S.; Sangeetha, A. Prevalence of Salmonella in chicken meat and its slaughtering place from local markets in Orathanadu, Thanjavur district, Tamil Nadu. J. Entomol. Zool. Stud. JEZS 2018, 6, 2468–2471. [Google Scholar]
- Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M.; International collaboration on enteric disease “burden of illness” studies. The global burden of nontyphoidal salmonella gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889. [Google Scholar] [CrossRef] [PubMed]
- Hoque, R.; Ahmed, S.M.; Naher, N.; Islam, M.A.; Rousham, E.K.; Islam, B.Z.; Hassan, S. Tackling antimicrobial resistance in Bangladesh: A scoping review of policy and practice in human, animal and environment sectors. PLoS ONE 2020, 15, e0227947. [Google Scholar] [CrossRef] [PubMed]
- Jahan, M.; Rahman, M.; Parvej, M.S.; Chowdhury, S.M.Z.H.; Haque, M.E.; Talukder, M.A.K.; Ahmed, S. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. J. Adv. Vet. Anim. Res. 2014, 2, 49–55. [Google Scholar] [CrossRef]
- Lozano, C.; Gharsa, H.; Ben Slama, K.; Zarazaga, M.; Torres, C. Staphylococcus aureus in animals and food: Methicillin resistance, prevalence and population structure. A review in the African continent. Microorganisms 2016, 4, 12. [Google Scholar] [CrossRef]
- Tessema, D.; Tsegaye, S. Study on the prevalence and distribution of staphylococcus aureus in raw cow milk originated from Alage Atvet college dairy farm, Ethiopia. J. Nutr. Food Sci. 2017, 7, 2–5. [Google Scholar] [CrossRef]
- Wang, B.; Muir, T.W. Regulation of virulence in Staphylococcus aureus: Molecular mechanisms and remaining puzzles. Cell Chem. Biol. 2016, 23, 214–224. [Google Scholar] [CrossRef]
- Haftay, A.; Geberemedhin, H.; Belay, A.; Goytom, E.; Kidane, W. Antimicrobial resistance profile of Staphylococcus aureus isolated from raw cow milk and fresh fruit juice in Mekelle, Tigray, Ethiopia. J. Vet. Med. Anim. Health 2018, 10, 106–113. [Google Scholar] [CrossRef]
- Tsepo, R.; Ngoma, L.; Mwanza, M.; Ndou, R. Prevalence and antibiotic resistance of staphylococcus aureus isolated from beef carcasses at abattoirs in north west province. J. Hum. Ecol. 2016, 56, 188–195. [Google Scholar] [CrossRef]
- Adame-Gómez, R.; Toribio-Jimenez, J.; Vences-Velazquez, A.; Rodríguez-Bataz, E.; Dionisio, M.C.S.; Ramirez-Peralta, A. Methicillin-resistant Staphylococcus aureus (MRSA) in artisanal cheeses in México. Int. J. Microbiol. 2018, 2018, 8760357. [Google Scholar] [CrossRef]
- Hamzah, A.M.C.; Yeo, C.C.; Puah, S.M.; Chua, K.H.; Rahman, N.I.A.; Abdullah, F.H.; Othman, N.; Chew, C.H. Tigecycline and inducible clindamycin resistance in clinical isolates of methicillin-resistant Staphylococcus aureus from Terengganu, Malaysia. J. Med. Microbiol. 2019, 68, 1299–1305. [Google Scholar] [CrossRef] [PubMed]
- Karimi Dehkordi, M.; Ghasemi Shamsabadi, M.; Banimehdi, P. The occurrence of Staphylococcus aureus, enterotoxigenic and methicillin-resistant strains in Iranian food resources: A systematic review and meta-analysis. Ann. Ig. 2019, 31, 263–278. [Google Scholar] [CrossRef] [PubMed]
- Wieczorek, K.; Wołkowicz, T.; Osek, J. Antimicrobial resistance and virulence-associated traits of campylobacter Jejuni isolated from poultry food chain and humans with diarrhea. Front. Microbiol. 2018, 9, 1508. [Google Scholar] [CrossRef]
- Kassa, T.; Gebre-Selassie, S.; Asrat, D. Antimicrobial susceptibility patterns of thermotolerant Campylobacter strains isolated from food animals in Ethiopia. Vet. Microbiol. 2007, 119, 82–87. [Google Scholar] [CrossRef] [PubMed]
- Mughal, M.H. Campylobacteriosis: A global threat. Biomed. J. Sci. Technol. Res. 2018, 11, 8804–8808. [Google Scholar] [CrossRef]
- Skirrow, M.B.; Blaser, M.J. Clinical and epidemiological considerations. In Campylobacter jejuni: Current Status and Future Trends; Nachamkin, I., Blaser, M.J., Tompkins, L.S., Eds.; American Society For Microbiology: Washington, DC, USA, 1992; pp. 3–8. [Google Scholar]
- Hagos, Y.; Berhe, M.; Gugsa, G. Campylobacteriosis: Emphasis on its status as foodborne zoonosis in Ethiopia. J. Trop. Dis. 2019, 7, 1000317. [Google Scholar]
- Nigatu, S.; Mequanent, A.; Tesfaye, R.; Garedew, L. Prevalence and drug sensitivity pattern of campylobacter jejuni isolated from cattle and poultry in and around Gondar town, Ethiopia. Glob. Vet. 2015, 14, 43–47. [Google Scholar] [CrossRef]
- Dierikx, C.M.; Van Der Goot, J.A.; Smith, H.E.; Kant, A.; Mevius, D.J. Presence of ESBL/AmpC-producing Escherichia coli in the broiler production pyramid: A descriptive study. PLoS ONE 2013, 8, e79005. [Google Scholar] [CrossRef]
- Hammerum, A.M.; Larsen, J.; Andersen, V.D.; Lester, C.H.; Skytte, T.S.S.; Hansen, F.; Olsen, S.S.; Mordhorst, H.; Skov, R.L.; Aarestrup, F.; et al. Characterization of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli obtained from Danish pigs, pig farmers and their families from farms with high or no consumption of third- or fourth-generation cephalosporins. J. Antimicrob. Chemother. 2014, 69, 2650–2657. [Google Scholar] [CrossRef]
- Moodley, A.; Guardabassi, L. Transmission of IncN Plasmids Carrying bla CTX-M-1 between commensal Escherichia coli in pigs and farm workers. Antimicrob. Agents Chemother. 2009, 53, 1709–1711. [Google Scholar] [CrossRef]
- Stuart, J.C.; Munckhof, T.V.D.; Voets, G.; Scharringa, J.; Fluit, A.; Hall, M.L.-V. Comparison of ESBL contamination in organic and conventional retail chicken meat. Int. J. Food Microbiol. 2012, 154, 212–214. [Google Scholar] [CrossRef] [PubMed]
- Kola, A.; Kohler, C.; Pfeifer, Y.; Schwab, F.; Kuhn, K.; Schulz, K.; Balau, V.; Breitbach, K.; Bast, A.; Witte, W.; et al. High prevalence of extended-spectrum-lactamase-producing Enterobacteriaceae in organic and conventional retail chicken meat, Germany. J. Antimicrob. Chemother. 2012, 67, 2631–2634. [Google Scholar] [CrossRef] [PubMed]
- Overdevest, I.; Willemsen, I.; Rijnsburger, M.; Eustace, A.; Xu, L.; Hawkey, P.; Heck, M.; Savelkoul, P.; Vandenbroucke-Grauls, C.; van der Zwaluw, K.; et al. Extended-spectrum B-lactamase genes of Escherichia coli in chicken meat and humans, the Netherlands. Emerg. Infect. Dis. 2011, 17, 1216–1222. [Google Scholar] [CrossRef] [PubMed]
- Reist, M.; Geser, N.; Hächler, H.; Schärrer, S.; Stephan, R. ESBL-producing Enterobacteriaceae: Occurrence, risk factors for fecal carriage and strain traits in the Swiss slaughter cattle population younger than 2 years sampled at abattoir level. PLoS ONE 2013, 8, e71725. [Google Scholar] [CrossRef] [PubMed]
- Schmid, A.; Hörmansdorfer, S.; Messelhäusser, U.; Käsbohrer, A.; Sauter-Louis, C.; Mansfeld, R. Prevalence of extended-spectrum β-lactamase-producing Escherichia coli on Bavarian dairy and beef cattle farms. Appl. Environ. Microbiol. 2013, 79, 3027–3032. [Google Scholar] [CrossRef]
- Guillaume, G.; Verbrugge, D.; Chasseur-Libotte, M.-L.; Moens, W.; Collard, J.-M. PCR typing of tetracycline resistance determinants (Tet A–E) in Salmonella enterica serotype Hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol. Ecol. 2000, 32, 77–85. [Google Scholar] [CrossRef][Green Version]
- Oppegaard, H.; Steinum, T.M.; Wasteson, Y. Horizontal transfer of a multi-drug resistance plasmid between coliform bacteria of human and bovine origin in a farm environment. Appl. Environ. Microbiol. 2001, 67, 3732–3734. [Google Scholar] [CrossRef]
- Bai, Y.; Xu, R.; Wang, Q.-P.; Zhang, Y.-R.; Yang, Z.-H. Sludge anaerobic digestion with high concentrations of tetracyclines and sulfonamides: Dynamics of microbial communities and change of antibiotic resistance genes. Bioresour. Technol. 2019, 276, 51–59. [Google Scholar] [CrossRef]
- Hue, O.; Allain, V.; Laisney, M.-J.; Le Bouquin, S.; Lalande, F.; Petetin, I.; Rouxel, S.; Quesne, S.; Gloaguen, P.-Y.; Picherot, M.; et al. Campylobacter contamination of broiler caeca and carcasses at the slaughterhouse and correlation with Salmonella contamination. Food Microbiol. 2011, 28, 862–868. [Google Scholar] [CrossRef]
- Sarker, M.S.; Mannan, M.S.; Ali, M.Y.; Bayzid, M.; Ahad, A.; Bupasha, Z.B. Antibiotic resistance of Escherichia coli isolated from broilers sold at live bird markets in Chattogram, Bangladesh. J. Adv. Vet. Anim. Res. 2019, 6, 272–277. [Google Scholar] [CrossRef]
- Shome, B.R.; Bhuvana, M.; Das Mitra, S.; Krithiga, N.; Shome, R.; Velu, D.; Banerjee, A.; Barbuddhe, S.B.; Prabhudas, K.; Rahman, H. Molecular characterization of Streptococcus agalactiae and Streptococcus uberis isolates from bovine milk. Trop. Anim. Health Prod. 2012, 44, 1981–1992. [Google Scholar] [CrossRef] [PubMed]
- Shome, B.; Das Mitra, S.; Bhuvana, M.; Krithiga, N.; Velu, D.; Shome, R.; Isloor, S.; Barbuddhe, S.; Rahman, H. Multiplex PCR assay for species identification of bovine mastitis pathogens. J. Appl. Microbiol. 2011, 111, 1349–1356. [Google Scholar] [CrossRef] [PubMed]
- Tawyabur, M.; Islam, M.S.; Sobur, M.A.; Hossain, M.J.; Mahmud, M.M.; Paul, S.; Hossain, M.T.; Ashour, H.M.; Rahman, M.T. Isolation and characterization of multidrug-resistant Escherichia coli and Salmonella spp. from healthy and diseased turkeys. Antibiotics 2020, 9, 770. [Google Scholar] [CrossRef] [PubMed]
- Hutchinson, D.N.; Bolton, F.J. Improved blood free selective medium for the isolation of campylobacter jejuni from faecal specimens. J. Clin. Pathol. 1984, 37, 956–957. [Google Scholar] [CrossRef][Green Version]
- Rahn, K.; De Grandis, S.; Clarke, R.; McEwen, S.; Galán, J.; Ginocchio, C.; Curtiss, R.; Gyles, C. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell Probes 1992, 6, 271–279. [Google Scholar] [CrossRef]
- Ferasyi, T.R.; Abrar, M.; Subianto, M.; Afrianandra, C.; Hambal, M.; Razali, R.; Ismail, I.; Nurliana, N.; Rastina, R.; Sari, W.E.; et al. Isolation, Identification, and Critical Points of Risk of Escherichia coli O157:H7 Contamination at Aceh Cattle Breeding Centre. E3S Web Conf. 2020, 151, 01021. [Google Scholar] [CrossRef]
- Wang, Z.; Zuo, J.; Gong, J.; Hu, J.; Jiang, W.; Mi, R.; Huang, Y.; Chen, Z.; Phouthapane, V.; Qi, K.; et al. Development of a multiplex PCR assay for the simultaneous and rapid detection of six pathogenic bacteria in poultry. AMB Express 2019, 9, 185. [Google Scholar] [CrossRef]
- Sabzmeydani, A.; Rahimi, E.; Shakerian, A. Incidence and antimicrobial resistance of campylobacter species isolated from poultry eggshell samples. Egypt. J. Vet. Sci. 2020, 51, 329–335. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; CLSI Supplement M100s; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- DIN EN ISO 20776-1; Labormedizinische Untersuchungen und In-Vitro-Diagnostika-Systeme—Empfindlichkeitsprüfung von Infektionserregern und Evaluation von Geräten zur antimikrobiellen Empfindlichkeitsprüfung—Teil 1: Referenzmethode zur Testung der In-Vitro-Aktivität von antimikrobiellen Substanzen Gegen Schnell Wachsende Aerobe Bakterien, Die Infektionskrankheiten Verursachen (ISO 20776-1). Deutsche Fassung EN ISO 20776-1, DIN Deutsches Institut für Normung e.V.; Beuth Verlag: Berlin, Germany; Wien, Austria; Zürich, Switzerland, 2006.
- Rodloff, A.; Bauer, T.; Ewig, S.; Kujath, P.; Müller, E. Susceptible, intermediate, and resistant—The intensity of antibiotic action. Dtsch. Ärzteblatt Int. 2008, 105, 657–662. [Google Scholar] [CrossRef]
- Momtaz, H.; Rahimi, E.; Moshkelani, S. Molecular detection of antimicrobial resistance genes in E. coli isolated from slaughtered commercial chickens in Iran. Vet. Med. 2012, 57, 193–197. [Google Scholar] [CrossRef]
- Kim, B.; Kim, J.; Seo, M.-R.; Wie, S.-H.; Cho, Y.K.; Lim, S.-K.; Lee, J.S.; Kwon, K.T.; Lee, H.; Cheong, H.J.; et al. Clinical characteristics of community-acquired acute pyelonephritis caused by ESBL-producing pathogens in South Korea. Infection 2013, 41, 603–612. [Google Scholar] [CrossRef] [PubMed]
- Pournajaf, A.; Ardebili, A.; Goudarzi, L.; Khodabandeh, M.; Narimani, T.; Abbaszadeh, H. PCR-based identification of methicillin–resistant Staphylococcus aureus strains and their antibiotic resistance profiles. Asian Pac. J. Trop. Biomed. 2014, 4, S293–S297. [Google Scholar] [CrossRef] [PubMed]




| Organisms | Positive Samples (Total Samples) | Prevalence (%) | Confidence Interval (95% Cl) |
|---|---|---|---|
| E. coli | 554 (1440) | 38.47 | 35.99–41.01 |
| Salmonella | 119 (1440) | 8.26 | 6.95–9.80 |
| Staphylococcus | 211 (1440) | 14.65 | 12.92–16.57 |
| Streptococcus | 69 (1440) | 4.79 | 3.80–6.02 |
| Organisms | Positive Samples (Total Samples) | Prevalence (%) | Confidence Interval (95% Cl) |
|---|---|---|---|
| E. coli | 454 (880) | 51.59 | 48.29–54.88 |
| Salmonella | 155 (880) | 17.61 | 15.24–20.27 |
| Staphylococcus | 193 (880) | 21.93 | 19.32–24.78 |
| Campylobacter | 39 (880) | 4.43 | 3.26–6 |
| AMR Pathogens | Primers | Sequence (5′–3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| Salmonella | F | TCATCGCACCGTCAAAGGAACC | 284 | [87] |
| R | GTGAAATTATCGCCACGTTCGGGCAA | |||
| E. coli | F | CCCCCTGGACGAAGACTGAC | 401 | [88] |
| R | ACCGCTGGCAACAAAGGATA | |||
| Staphylococcus | F | CCTGAAACAAAGCATCCTAAAAA | 155 | [89] |
| R | TAAATATACGCTAAGCCACGTCCAT | |||
| Campylobacter | F | ATCTAATGGCTTAACCATTAAAC | 857 | [90] |
| R | GGACGGTAACTAGTTTAGTATT | |||
| Streptococcus | F | AGCGGGGGATAACTATTGGA | 569 | [84] |
| R | TACGCATTTCACCGCTACAC |
| Class | Target Gene | Primers | Sequence (5′–3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|---|
| Gentamicin | aac(3)-IV | F | CTTCAGGATGGCAAGTTGGT | 286 | [95] |
| R | TCATCTCGTTCTCCGCTCAT | ||||
| Tetracycline | tetA | F | GGTTCACTCGAACGACGTCA | 577 | [95] |
| R | CTGTCCGACAAGTTGCATGA | ||||
| tetB | F | CCTCAGCTTCTCAACGCGTG | 634 | ||
| R | GCACCTTGCTGATGACTCTT | ||||
| Beta lactams | blaTEM | F | ATAAAATTCTTGAAGAC | 1073 | [96] |
| R | TTACCAATGCTTAATCA | ||||
| Beta lactams | blaSHV | F | TCGCCTGTGTATTATCTCCC | 768 | [95] |
| R | CGCAGATAAATCACCACAATG | ||||
| Beta lactams | blaCMY | F | TGGCCAGAACTGACAGGCAAA | 462 | [95] |
| R | TTTCTCCTGAACGTGGCTGGC | ||||
| Erythromycin | ereA | F | GCCGGTGCTCATGAACTTGAG | 419 | [95] |
| R | CGACTCTATTCGATCAGAGGC | ||||
| Sulfonamide | sul1 | F | TTCGGCATTCTGAATCTCAC | 822 | [95] |
| R | ATGATCTAACCCTCGGTCTC | ||||
| Streptomycin | aadA1 | F | TATCCAGCTAAGCGCGAACT | 447 | [95] |
| R | ATTTGCCGACTACCTTGGTC | ||||
| Methicillin-resistant | mecA | F | AAAATCGATGGTAAAGGTTGGC | 533 | [97] |
| R | AGTTCTGGAGTACCGGATTTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rafiq, K.; Islam, M.R.; Siddiky, N.A.; Samad, M.A.; Chowdhury, S.; Hossain, K.M.M.; Rume, F.I.; Hossain, M.K.; Mahbub-E-Elahi, A.; Ali, M.Z.; et al. Antimicrobial Resistance Profile of Common Foodborne Pathogens Recovered from Livestock and Poultry in Bangladesh. Antibiotics 2022, 11, 1551. https://doi.org/10.3390/antibiotics11111551
Rafiq K, Islam MR, Siddiky NA, Samad MA, Chowdhury S, Hossain KMM, Rume FI, Hossain MK, Mahbub-E-Elahi A, Ali MZ, et al. Antimicrobial Resistance Profile of Common Foodborne Pathogens Recovered from Livestock and Poultry in Bangladesh. Antibiotics. 2022; 11(11):1551. https://doi.org/10.3390/antibiotics11111551
Chicago/Turabian StyleRafiq, Kazi, Md Rafiqul Islam, Nure Alam Siddiky, Mohammed Abdus Samad, Sharmin Chowdhury, K. M. Mozaffor Hossain, Farzana Islam Rume, Md Khaled Hossain, ATM Mahbub-E-Elahi, Md Zulfekar Ali, and et al. 2022. "Antimicrobial Resistance Profile of Common Foodborne Pathogens Recovered from Livestock and Poultry in Bangladesh" Antibiotics 11, no. 11: 1551. https://doi.org/10.3390/antibiotics11111551
APA StyleRafiq, K., Islam, M. R., Siddiky, N. A., Samad, M. A., Chowdhury, S., Hossain, K. M. M., Rume, F. I., Hossain, M. K., Mahbub-E-Elahi, A., Ali, M. Z., Rahman, M., Amin, M. R., Masuduzzaman, M., Ahmed, S., Ara Rumi, N., & Hossain, M. T. (2022). Antimicrobial Resistance Profile of Common Foodborne Pathogens Recovered from Livestock and Poultry in Bangladesh. Antibiotics, 11(11), 1551. https://doi.org/10.3390/antibiotics11111551

