Next Article in Journal
Untargeted Metabolomics Used to Describe the Chemical Composition, Antioxidant and Antimicrobial Effects of Extracts from Pleurotus spp. Mycelium Grown in Different Culture Media
Next Article in Special Issue
Multiresidues Multiclass Analytical Methods for Determination of Antibiotics in Animal Origin Food: A Critical Analysis
Previous Article in Journal
Carbapenem-Only Combination Therapy against Multi-Drug Resistant Pseudomonas aeruginosa: Assessment of In Vitro and In Vivo Efficacy and Mode of Action
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 11
10.3390/antibiotics11111469
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products

by
Anca Forgaciu
1,
Alexandra Tabaran
1,*,
Liora Colobatiu
2,
Romolica Mihaiu
3,
Sorin Daniel Dan
1 and
Marian Mihaiu
1
1
Department of Animal Breeding and Food Science, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine, Manastur Street No. 3/5, 400372 Cluj-Napoca, Romania
2
Department of Medical Devices, Faculty of Pharmacy, Iuliu Hatieganu University of Medicine and Pharmacy, Victor Babes Street No. 8, 400012 Cluj-Napoca, Romania
3
Department of Management, Faculty of Economic Sciences and Business Administration, Babes Bolyai University, Mihail Kogalniceanu Street No. 1, 400084 Cluj-Napoca, Romania
*
Author to whom correspondence should be addressed.
Antibiotics 2022, 11(11), 1469; https://doi.org/10.3390/antibiotics11111469
Submission received: 15 September 2022 / Revised: 17 October 2022 / Accepted: 21 October 2022 / Published: 25 October 2022
(This article belongs to the Special Issue Food Safety: Antimicrobial Resistance in the Food Chain)
Review Reports Versions Notes

Abstract

:
Salmonella is considered to be one of the major foodborne pathogens associated with the consumption of contaminated poultry meat products. To the best of our knowledge this is the first extended research performed on a number of Salmonella strains isolated during 2011–2021 from poultry meat products in Romania. The aim of this study was to characterize the prevalence of pathogenic Salmonella serovars, antimicrobial susceptibility, and antimicrobial resistance genes in 112 Salmonella isolates recovered from raw poultry meat products. The results showed that Salmonella enterica serovars Enteritidis and Typhimurium were the common serotypes (56%; 25%). Overall, the majority of the isolates were resistant to at least three tested antimicrobials. High resistance was observed for tetracycline (84%), nalidixic acid (78%), and ampicillin (78%) in pathogenic Salmonella isolated during the period 2016–2021. All the pathogenic Salmonella isolated during 2016–2021 tested positive to at least one resistance gene encoding for tetracycline resistance, with the tetA gene being the most prevalent (62%). In addition, 64% (24/37) of the Salmonella isolates carried at least one of the genes (blaCMY-2, blaSHV1, blaTEM1) that code for β-Lactams resistance. The findings in this study showed a high prevalence of multi-drug resistant (MDR) Salmonella serovars in poultry meat products and a concerning increase of resistance patterns. The continuous occurrence of more resistant strains implies that effective measures should be strictly applied in this particular food chain in order to prevent their spread and guarantee microbial safety.

1. Introduction

Salomonella infection is considered to be among the most widespread foodborne bacterial illness in humans [1,2]. Its clinical manifestations in an infected population can vary from mild to severe. The most common clinical presentation of Salmonella infection is gastroenteritis, which can be caused by more than 150 Salmonella serotypes, known as non-typhoidal Salmonella (NTS) [3].
The main cause of contamination with pathogenic Salmonella is considered to be contaminated foods such as undercooked meat, eggs, dairy products, as well as fresh vegetables [2,4]. Particularly, poultry meat has been incriminated to be among the most susceptible meat product in the case of Salmonella presence, and that is one of the main reasons for which a surveillance system is mandatory in all bird slaughtering units [5]. The Center for Disease Control and Prevention (CDC) estimates that Salmonella causes more foodborne illnesses than any other bacteria [6]. It is a growing incidence due to the increased industrialization of the food supply and globalization of processed and ready to eat food [1,2,7]. In Europe, the growing incidence of Salmonella was seen starting with 2013 when isolates were found in egg laying hens [8]. In 2021, France has reported an increase in Salmonella enteritidis infections and by 2022 the number of cases has spread to other European countries [9]. There were 272 confirmed cases that resulted in 2 deaths and 25 patients hospitalized [9]. In Romania particularly, the incidence of Salmonella has shown a growing trend, the latest outbreak being caused in 2021 by the consumption of contaminated poultry organs (hearts and liver).
Unfortunately, nowadays, it is not only the presence of Salmonella that holds concerns but also its multi-drug resistance profile. This growing trend of resistant bacteria is most likely due to the frequent use of antibiotics in animal growing systems [10]. Another role in an acquired resistance il played by plasmids which frequently act as vehicles for horizontal gene transfer [11]. More so, the coadaptation between bacterial hosts and plasmids frequently results in adaptive changes restricted exclusively to host genome leaving plasmids unchanged [12], and this is why studies that underline the possible effects of such genetic transfers are crucial in limiting the spread. During 2009–2011, a worrying percentage (5) of nontyphoidal Salmonella were resistant to ≥5 types of drugs [13]. In 2015, among 2364 Salmonella isolates tested, 65 of them (2.7%) were resistant to at least 5 antimicrobial agents: ampicillin, chloramphenicol, streptomycin, sulfonamide and tetracycline. Salmonella typhimurium was the serotype that most frequently presented ampicillin, chloramphenicol, streptomycin, sulfonamide and tetracycline resistance with a prevalence of 10.8% (27 of 251) [14].
A number of studies have shown that during the last 20 years, Salmonella strains isolated from various food products have become highly resistant to several classes of antibiotics, which were normally used as first intention treatment in animal bacterial diseases [15]. This fact has become a worldwide public health concern, since the therapeutic options available are becoming scarcer [16]. That is why the proper and accurate surveillance of antimicrobial resistance profiles is essential in providing the data necessary for a correct evaluation of the resistance magnitude levels and efficient treatment protocols.

2. Results

2.1. Prevalence of Pathogens in Salmonella Isolates

The polymerase chain reaction (PCR) for the identification of S. enteritidis and S. Thyphimurium was performed on all Salmonella isolates (n = 112) found between 2011–2021. We found that the majority of the samples, 56% were positive for S. enteritidis (n = 63), 25% belonged to S. Thyphimurium (n = 28) and the rest of the isolates were negative for both strains (n = 21). Regarding the prevalence during the period studied (2011–2021), we found that during the years 2011–2015 the largest number of pathogens were found (n = 54; S. enteritidis—38; S. Thyphimurium—16). In the period 2016–2021, 37 samples were identified as S. enteritidis (n = 24) and S. Thyphimurium (n = 13).

2.2. Antimicrobial Susceptibility

The results of the antimicrobial resistance test for the 91 pathogenic Salmonella isolates during a ten-year period of study have shown a concerning increasing in resistance. The isolates that tested resistant to three or more antimicrobials were classified as multidrug resistant (MDR). Out of the 91 Salmonella isolates, a large number (n = 78) were found to be MDR. Concerning was also the fact that during the period studied, all the isolates found in poultry meat products were resistant to at least two antimicrobials. None of the isolates studied showed sensitivity to all the antimicrobials tested.
The results on the antimicrobial susceptibility of the pathogenic Salmonella isolates during the period 2011–2015 have shown that the most prevalent resistance phenotype was to older antimicrobials such as TET (74%), sulfonamide (54%), S (34%), and AMP (32%) (Table 1). Most of the isolates remained susceptible to cephalosporins and quinolones with 8% and 4%, respectively, showing a resistance phenotype. We also found that S. Thyphimurium isolated during 2011–2015 was more susceptible; only four of the isolates showing resistance to more than three of the antibiotic classes investigated.
The percentage of pathogenic Salmonella isolates resistant to three or more classes of antibiotics showed an increase in the isolates found between 2015–2021 (n = 34) compared to 2011–2014 (n = 28) (Table 2). The lowest percentage of Salmonella strains susceptible to at least three antimicrobials was found in the years 2020–2021 (n = 2). Conversely, MDR increased from 24% between 2011–2015 (n = 13) to 56% between 2016–2021 (n = 21). In addition, significant changes in the resistance patterns (p < 0.001) were found when comparing the pathogenic Salmonella isolates found in 2011–2015 and those from 2016–2021. The most marked increase in resistance was found for tetracyclines, sulfonamides and ampicillin. There was also a significant increase in resistance (Mann–Kendall test) (p < 0.05) in the resistance patterns for cephalosporins during the years 2016–2021. Three strains of Salmonella Enteritidis found in the year 2020 have shown also concurrent resistance to cephalosporin and sulphamethoxazole/trimethoprim. Two of the pathogenic Salmonella isolates found in 2020 in poultry carcasses have shown resistance to all antimicrobials tested. The pathogenic Salmonella strains isolated during the years 2011–2015 have shown a low resistance to cephalosporin and sulphamethoxazole/trimethoprim. The most common resistance phenotype of the pathogenic Salmonella isolates during years 2011–2015 was tetracycline (87%), nalidixic acid (52%) and ampicillin (46%). During the period of 2016–2021 we noticed a larger variety in the resistance patterns. The most common resistance phenotype was similar to that observed in the previous period but with higher percentages in prevalence (tetracycline (84%), nalidixic acid (78%) and ampicillin (78%)). Among all the Salmonella isolates found in our study (n = 91), 18 different resistance patterns were found and most of them were represented by a minimum of 3 strains. More than 24% (n = 22) of the isolates showed resistance to five or more antimicrobials, while only one strain belonged to the period 2011–2015.

2.3. Prevalence of Resistance Genes

The prevalence of resistance genes was strongly correlated to the resistance pattern found by the classical disk diffusion method. In this respect, the most common resistance genes found were those encoding for tetracycline (tetA, tetB, tetC) (n = 79) and sulphonamide (SulI; SulII) (n = 85). All the pathogenic Salmonella isolated during 2016–2021 tested positive for at least one resistance gene encoding for tetracycline resistance, with the tetA gene being the most prevalent (62%; n = 56). We also found that in the isolates from the period 2011–2015, seven of them carried the tet genes (tetA, tetB) but were not phenotypically resistant. Because in all isolates tested positive for one resistance gene encoding for tetracycline, tetB and tetC were also identified in a high proportion (45% and 23%, respectively). A concerning fact was that the highest number of samples that carried simultaneously the sul1 and tet genes (81%; 30/37) were isolated during the period 2016–2021, which shows that there is a growing antimicrobial potential. Furthermore, 64% (24/37) of the Salmonella isolates from the period 2016–2021 carried at least one of the genes (blaCMY-2; blaSHV1, blaTEM1). In the case of genes responsible for chloramphenicol resistance, there was an obvious increase in positivity at the isolates from 2016–2021. If during the years 2011–2015 only 4 of isolates were positive to cat1, during the years 2016–2021, 16 samples were found positive to at least 1 of the genes cat1, cat2, floR. The most prevalent phenotype for chloramphenicol resistance in the positive Salmonella samples was cat1, floR. Only one of the samples investigated was positive for cat2 simultaneously with floR. For gentamicin resistance, we investigated two incriminating genes: aac(3)11a and aph(3)11a. Only four samples were found positive for aac(3)11a, all of them being isolated during 2016–2021. Regarding the phenotypes of resistance, we found that the presence of multiple genes was significantly higher (p < 0.001) between 2016–2021 than in the years 2011–2015.

3. Discussion

In the past 10 years, the increasing resistance to frequently used antimicrobial agents in Salmonella infections has been widely reported [17]. Despite the multitude of improvements in animal food products processing in Romania and also the mandatory implementation of HACCP programs for surveillance of potential biological hazards, Salmonella spp. remains a leading pathogen responsible for foodborne illness. As seen in our study, the isolation of pathogenic strains of Salmonella was possible each year during the period studied (2011–2021) from poultry meat products. According to a study performed in Malaysia, Salmonella was found in a high proportion, with a rate of 35.5% and 50% in broiler carcasses at wet markets and processing plants [18]. Another study performed in Bangladesh, found the overall prevalence of S. typhimurium and S. enteritidis at a rate of 3.67% and 0.57% in chicken cecal contents [19]. The most prevalent serovar identified in the poultry meat samples investigated during the period studied was S. enteritidis (n = 56%). This finding is similar to other studies, which found a higher prevalence of S. Enteritidis compared to S. thyphimurium [20,21,22]. According to a recent global review study on the antibioresistance patterns of Salmonella isolated from raw chicken meat, it was found that the median prevalence was 30%, and the most prevalent serotypes were S. enteritidis and S. typhimurium [17]. Unfortunately, the presence of Salmonella isolates was not the only worrisome aspect, their multiple drug-resistance phenotypes were noticeable in the isolates from later years. We have found high levels of resistance to commonly used antibiotics in poultry production, such as tetracycline (84%), nalidixic acid (78%) and ampicillin (78%). These findings are in accordance with other studies performed in various countries. A previous study in Iran, revealed that the majority of the Salmonella isolates were resistant to nalidixic acid, tetracycline and streptomycin [23]. The resistance rates reported are in agreement with the results reported in the United States [24] and Europe [25,26,27]. The high prevalence of resistance to nalidixic acid was also reported in studies by Khaltabadi Farahani et al. (2018) (94.1/%) [28], En-Nassiri et al. (82%) (2017) [29], and Ziyate et al. (2016) (61%) [30].
Among the 91 pathogenic Salmonella isolates found in this study, the SulI gene was determined at the highest proportion (93.4%), followed by Tet genes (86.8%) and blaTEM (64%). Regarding the genes incriminated for resistance, our findings are in accordance with a recent study in Turkey, but unfortunately the frequencies of their occurrence in Salmonella strains show much higher levels [22]. We also found four Salmonella strains positive to cat1 gene, which is responsible for chloramphenicol resistance, while many studies have shown a high level of sensitivity to this antibiotic class [22]. Overall, the prevalence of resistance genes was correlated with the phenotypical expression of the isolates, only in seven strains the presence of Tet genes did not show an actual resistance to this class. The gene floR, responsible for the resistance to florfenicol, was detected in all the strains resistant to the chloramphenicol antibiotic class. These findings are similar to those found in Salmonella strains isolated from various sources of raw meat [31]. The presence of blaTEM gene was found in 28 isolates (30.7%) and also correlated with the phenotypical expression of resistance. A previous study has shown that blaTEM gene sequence was present in all Salmonella isolates (100%), however it had low correlation (velez). For gentamicin resistance we have investigated two of the most incriminated genes: aac(3)11a and aph(3)11a. Only four samples were found positive to the presence of aac(3)11a, while none of the samples investigated showed the presence of aph(3)11a. Our findings are in contrast to previous findings, which have shown a higher prevalence of these genes and a very strong phenotypical resistance to this antimicrobial class all Salmonella spp. strains [32].
Our study has also revealed different resistance patterns when comparing the time intervals investigated. This statistically different pattern of resistance reported can be explained by the change in the treatment protocol. During the early years of 2000, the traditional first line Salmonella infection treatment was formed by chloramphenicol, ampicillin and trimethoprim-sulfamethoxazole. The high resistance rate to these classes of antibiotics in time has forced therapists to choose other classes which still had efficiency in treatment, such as cephalosporins [33]. It is concerning however that our study has revealed that new Salmonella strains have also begun to show resistance to these classes of antibiotics. Although the numbers are not high, the ongoing use of these antibiotics as possible treatment will eventually result in the spread of more resistant strains.
To the best of the authors’ knowledge, this is the first comprehensive study on the prevalence of the antibiotic resistance profile of pathogenic Salmonella isolates from poultry meat products in Romania. Our results revealed that resistance to tetracycline, nalidixic acid, streptomycin and ampicillin are high, and they must be used only when it is sure that they will be efficient.

4. Materials and Methods

4.1. Sampling

The study was conducted on 112 Salmonella strains isolated from poultry meat and poultry meat products during the years 2011–2021 in Romania. The strains were isolated in the Sanitary Veterinary Laboratory for Food Safety situated in the Transylvanian region of Romania, which normally receives samples for investigation. All the strains were isolated through the classical microbiological protocol recommended by the International Organization for Standardization (ISO) 6579 [34] and the positive strains were afterwards stored in freezing conditions (−80 °C). In order to perform the testing, all the strains stored were re-cultured on xylose lysine deoxycholate (XLD) agar (Oxoid, Basingstoke, UK).

4.2. Susceptibility Testing

All Salmonella isolates were tested for antimicrobial susceptibility after their isolation. The testing was performed in the Sanitary Veterinary Laboratory for Food Safety situated in Cluj County, Romania. The testing was made on eleven antimicrobials that are normally used in human and animal therapy. The method applied was the disk diffusion method and the protocol followed exactly the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [35,36]. The antimicrobial classes tested were ampicillin (AMP, 10 μg), cefotaxime (CTX, 30 μg), ceftazidime (CAZ, 30 μg), chloramphenicol (CHL, 30 μg), ciprofloxacin (CIP, 5 μg), gentamicin (GEN, 10 μg), nalidixic acid (NA, 30 μg), streptomycin (S, 10 μg), sulfamethoxazole (SMX, 300 μg) trimethoprim/sulfamethoxazole (SXT, 1.25/23.75 μg), and tetracycline (TET, 30 μg) (Oxoid, Basingstoke, UK). The interpretation of the results was made according to the CLSI breakpoints.

4.3. DNA Extraction Protocol

The bacterial DNA was extracted following a simple protocol previously described by Mihaiu et al. (2014) [37]. Briefly, we selected from the XLD medium, two or three specific colonies that had the black center specific to pathogenic strains. The colonies were taken with a microbiological loop and suspended into Eppendorff tubes (1.5 mL) (Ratiolab, Dreieich, Germany) that contained 150 μL of CHELEX (10%) reactive (BioRad, Berkeley, CA, USA). The following extraction temperatures were used: 57 °C-30′; 94 °C-5′. The last step included a high-speed centrifugation (14.000 rotations per minute) for one minute.

4.4. PCR Protocol for Confirmation of Pathogenic Strains

All the samples were tested for confirmation of the pathogenic strains Salmonella typhimurium and Salmonella enteritidis. We carried out a PCR multiplex, using a specific protocol previously described by Mihaiu et al. (2014) [37]. For the positive control, Salmonella typhimurium ATCC 14,028 and Salmonella enteritidis ATCC 13,076 strains were used.

4.5. PCR Protocol for Resistance Gene Testing

In order to detect the antimicrobial resistance patterns of the pathogenic strains, the study also focused on identification of the major genes that conferred resistance to the classes of antibiotics studied through disk diffusion method. The genes and specific primers are listed in Table 3. Briefly, the PCR was performed in a 25 µL reaction mix that comprised: 1×PCR green Buffer, 2.5 mM MgCl2, 5 pmol of each primer, dNTPs each at 200 μM, 2.5 U of TaqDNA polymerase (Promega), and 100 ng of genomic DNA. The PCR was performed under the following conditions: 94 °C for 3 min followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, and a final extension step of 73 °C for 5 min. A total of 10 μL from each PCR reaction containing the amplified product was loaded onto agarose gels (2%). The gels were stained with EvaGreen (JenaBioscience, Jena, Germany) and electrophoresed (90 W) for 40 min. Visualization was performed under UV light with a Gel Doc XR+Imager (Bio-Rad, Hercules, CA, USA).

4.6. Statistical Analysis

In order to identify the overall trends in antimicrobial susceptibility of the strains isolated over a long period of time (10 years), the Mann–Kendall test was performed. The magnitude of the possible changes during the 10 years was estimated using a slope parameter (Q) and the Sen non-parametric method, according to a previously described protocol [38]. The ten-year period was analyzed according to two time intervals (2011–2015; 2016–2021) taking into account the number of samples recovered and the detection of possible changes in resistance. In this respect, between 2011–2015, 54 samples were investigated and 37 samples in the second time interval. Significance was assessed at p < 0.05.
Table
Table 3. Primer sequences and their annealing temperatures.
Table 3. Primer sequences and their annealing temperatures.
GeneNucleotide Sequence 5′–3′Product Size (pb)Annealing t (°)AntibioticReference
tetAF:TTGGCATTCTGCATTCACTC
R:GTATAGCTTGCCGGAAGTCG		49455TET[39]
tetBF:GTATAGCTTGCCGGAAGTCG
R:CAGTGCTGTTGTGTCATTAA		57155TET[39]
tetCF:GCTTGGAATACTGAGTGTAA
R:CTTGAGAGCCTTCAACCCAG		41855TET[39]
Sul1F:CAAAGCCCCTTGCTTGTTAC
R:TTTCCTGACCCTGCGCTCTAT		79355SMX, SXT[40]
Sul2F:GTGCGGACGTAGTCAGCGCCA
R:CCTGTTTCGTCCGACACAGA		66755SMX, SXT[40]
cat1F:AACCAGACCGTTCAGCTGGAT
R:CCTGCCACTCATCGCAGTAC		54955CHL[41]
cat2F:AACGGCATGAACCTGAA
R:ATCCCAATGGCATCGTAAAG		54755CHL[40]
floRF:ATGACCACCACACGCCCCG
R:AGACGACTGGCGACTTCTTCG		19855CHL[40]
aac(3)11a,F:CGGCCTGCTGAATCAGTTTC
R:AAAGCCCACGACACCTTCTC		43955GEN[39]
aph(3)11aF:TCTGAAACATGGCAAAGGTAG
R:AGCCGTTTCTGTAATGAAGGA		58255GEN[39]
blaCMY-2F:TGG CCG TTG CCG TTA TCT AC
R:CCC GTT TTA TGC ACC CAT GA		87055β-Lactams[42]
blaSHV-1F:GGC CGC GTA GGC ATG ATA GA
R:CCC GGC GAT TTG CTG ATT TC		71455β-Lactams[42]
blaTEM-1F:CAG CGG TAA GAT CCT TGA GA
R:ACT CCC CGT CGT GTA GAT AA		64355β-Lactams[42]

5. Conclusions

In conclusion, the present study revealed the concerning increase of antimicrobial resistant Salmonella in poultry meat products during a ten-year period of time, with a particular emphasis on the occurrence of antimicrobial resistance genes. During the years 2016–2021, a high incidence of Salmonella exhibiting MDR phenotypes was noticed. The high rate of resistance genes in these isolates, particularly those encoding for sulfonamides and β-lactams resistance suggested that the Salmonella surveillance system needs to be more strictly applied in poultry production. The study shows growing evidence that Salmonella bacteria will become increasingly difficult to treat and that more strict regulations are urgently needed to limit antimicrobial use. We suggest that the studies should be extended to Salmonella isolates along the food chain in order to furtherly explore and quantify the epidemiological situation and to spread the extent in the environment.

Author Contributions

Conceptualization, A.F. and A.T.; methodology, A.T.; software, S.D.D.; validation, M.M. and A.F.; formal analysis, L.C.; investigation, M.M. and A.T.; resources, A.F.; data curation, R.M.; writing—original draft preparation, A.T.; writing—review and editing, S.D.D. and L.C.; visualization, M.M.; supervision, R.M.; project administration, M.M., A.F. and R.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Popa, G.L.; Papa, M.I. Salmonella spp. Infection—A continuous threat worldwide. Germs 2021, 11, 88–96. [Google Scholar] [CrossRef] [PubMed]
  2. European Food Safety Authority, European Centre for Disease Prevention and Control [EFSA]. The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, 40–67. [Google Scholar]
  3. Park, H.K.; Rhie, K.; Yeom, J.S.; Park, J.S.; Park, E.S.; Seo, J.H.; Lim, J.Y.; Park, C.H.; Woo, H.O.; Youn, H.S.; et al. Differences in Clinical and Laboratory Findings between Group D and Non-Group D Non-Typhoidal Salmonella Gastroenteritis in Children. Pediatr Gastroenterol. Hepatol. Nutr. 2015, 18, 85–93. [Google Scholar] [CrossRef] [Green Version]
  4. Ehuwa, O.; Jaiswal, A.K.; Jaiswal, S. Salmonella, Food Safety and Food Handling Practices. Foods 2021, 10, 907. [Google Scholar] [CrossRef]
  5. Rose, N.; Beaudeau, F.; Drouin, P.; Toux, J.Y.; Rose, V.; Colin, P. Risk factors for Salmonella enterica subsp. enterica contamination in French broiler-chicken flocks at the end of the rearing period. Prev. Vet. Med. 1999, 39, 265–277. [Google Scholar] [CrossRef]
  6. Centers for Disease Control and Prevention [CDC]. Available online: https://www.cdc.gov/foodsafety/communication/salmonella-food.html (accessed on 12 August 2022).
  7. Rohr, J.R.; Barrett, C.B.; Civitello, D.J. Emerging human infectious diseases and the links to global food production. Nat. Sustain. 2019, 2, 445–456. [Google Scholar] [CrossRef] [PubMed]
  8. De Cesare, A. Salmonella in Foods: A Reemerging Problem. Adv. Food Nutr. Res. 2018, 86, 137–179. [Google Scholar]
  9. European Centre for Disease Prevention and Control [ECDC]. Rapid Outbreak Assessment: Multi-Country Outbreak of Salmonella Enteritidis Sequence Type (ST)11 Infections Linked to Eggs and Egg Products (Europa.Eu). Available online: https://www.ecdc.europa.eu/en/publications-data/multi-country-outbreak-salmonella-enteritidis-sequence-type-st11-infections (accessed on 11 August 2022).
  10. Feiyang, M.A.; Shixin, X.U.; Zhaoxin, T.; Zekun, L.; Zhang, L. Use of antimicrobials in food animals and impact of transmission of antimicrobial resistance on humans. Biosaf. Health 2021, 3, 32–38. [Google Scholar]
  11. San Millan, A.; Escudero, J.A.; Gifford, D.R.; Mazel, D.; MacLean, R.C. Multicopy plasmids potentiate the evolution of antibiotic resistance in bacteria. Nat. Ecol. Evol. 2016, 7, 10. [Google Scholar] [CrossRef]
  12. Han, M.; Arbeithuber, B.; Marzia, A.C.; DeGiorgio, M.; Nekrutenko, A. A High-Resolution View of Adaptive Event Dynamics in a Plasmid. Genome Biol. Evol. 2019, 11, 3022–3034. [Google Scholar]
  13. Centers for Disease Control and Prevention (CDC). Antibiotic Resistance Threats in the United States. 2013. Available online: https://www.cdc.gov/drugresistance/threat-report-2013/pdf/ar-threats-2013-508.pdf (accessed on 12 September 2022).
  14. Centers for Disease Control and Prevention (CDC). National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS): Human Isolates Surveillance Report for 2015 (Final Report). 2018. Available online: https://www.cdc.gov/narms/pdf/2015-NARMS-Annual-Report-cleared_508.pdf (accessed on 12 September 2022).
  15. Hu, L.; Cao, G.; Brown, E.W.; Allard, M.W.; Ma, L.M.; Khan, A.A.; Zhang, G. Antimicrobial resistance and related gene analysis of Salmonella from egg and chicken sources by whole-genome sequencing. Poult. Sci. 2020, 99, 7076–7083. [Google Scholar] [CrossRef] [PubMed]
  16. Jajere, S.M. A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Vet. World. 2019, 12, 504–521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Castro-Vargas, R.E.; Herrera-Sánchez, M.P.; Rodríguez-Hernández, R.; Rondón-Barragán, I.S. Antibiotic resistance in Salmonella spp. isolated from poultry: A global overview. Vet. World. 2020, 13, 2070–2084. [Google Scholar] [CrossRef] [PubMed]
  18. Rusul, G.; Khair, J.; Radu, S.; Yassin, R. Prevalence of Salmonella in broilers at retail outlets, processing plants and farms in Malaysia. Int. J. Food Microbiol. 1996, 33, 183–194. [Google Scholar] [CrossRef]
  19. Siddiky, N.A.; Sarker, M.S.; Khan, M.; Rahman, S.; Begum, R.; Kabir, M. Virulence and Antimicrobial Resistance Profiles of Salmonella enterica Serovars Isolated from Chicken at Wet Markets in Dhaka, Bangladesh. Microorganisms 2021, 9, 952. [Google Scholar] [CrossRef]
  20. Thung, T.Y.; Radu, S.; Mahyudin, N.A.; Rukayadi, Y.; Zakaria, Z.; Mazlan, N.; Tan, B.H.; Lee, E.; Yeoh, S.L.; Chin, Y.Z.; et al. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia. Front. Microbiol. 2018, 11, 2697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Tarabees, R.; Elsayed, M.S.A.; Shawish, R.; Basiouni, S.; Shehata, A.A. Isolation and characterization of Salmonella Enteritidis and Salmonella Typhimurium from chicken meat in Egypt. J. Infect. Dev. Ctries 2017, 11, 314–319. [Google Scholar] [CrossRef] [Green Version]
  22. Arkali, A.; Cetinkaya, B. Molecular identification and antibiotic resistance profiling of Salmonella species isolated from chickens in eastern Turkey. BMC Vet. Res. 2020, 16, 205. [Google Scholar]
  23. Bahramianfard, H.; Derakhshandeh, A.; Naziri, Z.; Khaltabadi Farahani, R. Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella Enteritidis from poultry and egg samples in Iran. BMC Vet. Res. 2021, 17, 196. [Google Scholar] [CrossRef]
  24. Velasquez, C.G.; Macklin, K.S.; Kumar, S.; Bailey, M.; Ebner, P.E.; Oliver, H.F.; Martin-Gonzalez, F.S.; Singh, M. Prevalence and antimicrobial resistance patterns of Salmonella isolated from poultry farms in southeastern United States. Poultry Sci. 2018, 97, 2144–2152. [Google Scholar] [CrossRef]
  25. Schroeter, A.; Hoog, B.; Helmuth, R. Resistance of Salmonella isolates in Germany. J. Vet. Med. B Infect. Dis. Vet. Public Health 2004, 51, 389–392. [Google Scholar] [CrossRef] [PubMed]
  26. Huehn, S.; La Ragione, R.M.; Anjum, M.; Saunders, M.; Woodward, M.J.; Bunge, C.; Helmuth, R.; Hauser, E.; Guerra, B.; Beutlich, J.; et al. Virulotyping and antimicrobial resistance typing of Salmonella enterica serovars relevant to human health in Europe. Foodborne Pathog. Dis. 2010, 7, 523–535. [Google Scholar] [CrossRef] [PubMed]
  27. Cortés, V.; Sevilla-Navarro, S.; García, C.; Marín, C.; Catalá-Gregori, P. Monitoring antimicrobial resistance trends in Salmonella spp. from poultry in Eastern Spain. Poultry Sci. 2022, 101, 101832. [Google Scholar] [CrossRef] [PubMed]
  28. Khaltabadi Farahani, R.; Ehsani, P.; Ebrahimi-Rad, M.; Khaledi, A. Molecular Detection, Virulence Genes, Biofilm Formation, and Antibiotic Resistance of Salmonella enterica Serotype enteritidis Isolated from Poultry and Clinical Samples. Jundishapur J. Microbiol. 2018, 11, 9–13. [Google Scholar] [CrossRef] [Green Version]
  29. En-nassiri, H.; Es-soucratti, K.; Bouchrif, B. Emergence of multi-resistant Salmonella in Morocco. Rev. De L’entrepreneuriat Et De L’innovation 1 2017, 3, 1–5. [Google Scholar] [CrossRef]
  30. Ziyate, N.; Karraouan, B.; Kadiri, A.; Darkaoui, S.; Soulaymani, A.; Bouchrif, B. Prevalence and antimicrobial resistance of Salmonella isolates in Moroccan laying hens farms. J. Appl. Poult. Res. 2016, 25, 539–546. [Google Scholar] [CrossRef]
  31. Cortes Vélez, D.; Rodríguez, V.; Verjan García, N. Phenotypic and Genotypic Antibiotic Resistance of Salmonella from Chicken Carcasses Marketed at Ibague, Colombia. Rev. Bras. Cienc. Avic. 2017, 19, 347–354. [Google Scholar] [CrossRef] [Green Version]
  32. Pławinska-Czarnak, J.; Wódz, K.; Kizerwetter-Swida, M.; Bogdan, J.; Kwiecinski, P.; Nowak, T.; Strzałkowska, Z.; Anusz, K. Multi-Drug Resistance to Salmonella spp. When Isolated from Raw Meat Products. Antibiotics 2022, 11, 876. [Google Scholar] [CrossRef]
  33. Eng, S.K.; Pusparajah, P.; Mutalib, N.S.A. Salmonella: A review on pathogenesis, epidemiology and antibiotic resistance. Front. Life Sci. 2015, 8, 284–293. [Google Scholar] [CrossRef] [Green Version]
  34. International Organization for Standardization (ISO) 6579-1:2017, Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. Available online: https://www.iso.org/standard/56712.html (accessed on 12 August 2021).
  35. M100-S23; Performance Standards for Antimicrobial Susceptibility Testing. Clinical & Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2013.
  36. M100; Performance Standards for Antimicrobial Susceptibility Testing, 28th ed. CLSI Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018; Volume 38.
  37. Mihaiu, L.; Lapusan, A.; Tanasuica, R.; Sobolu, R.; Mihaiu, R.; Oniga, O.; Mihaiu, M. First study of Salmonella in meat in Romania. J. Infect. Dev. Ctries. 2014, 8, 50–58. [Google Scholar] [CrossRef] [Green Version]
  38. Sen, P.K. Estimates of the regression coefficient based on Kendall’s tau. J. Am. Statistic Assoc. 1968, 63, 1379–1389. [Google Scholar] [CrossRef]
  39. Adesiji, Y.O.; Fagbami, A.H. Epidemiology of bacterial zoonosis in Nigeria. Niger. J. Health Biomed. Sci. 2006, 5, 20–25. [Google Scholar]
  40. Ma, M.; Wang, H.; Yu, Y. Detection of antimicrobial resistance genes of pathogenic Salmonella from swine with DNA microarray. J. Vet. Diagn Invest. 2007, 19, 161–167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Zhao, S.; White, D.G.; Ge, B.; Ayers, S.; Friedman, S.; English, L. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin producing Escherichia coli isolates. Appl. Environ. Microbiol. 2001, 67, 1558–1564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Chen, S.; Zhao, S.; White, D.G.; Schroeder, C.M.; Lu, R.; Yang, H.; McDermott, P.F.; Ayers, S.; Meng, J. Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. App. Environ. Microb. 2004, 70, 1–7. [Google Scholar] [CrossRef]
Table
Table 1. Antimicrobial susceptibility of Salmonella isolates in poultry meat and poultry meat products in the period 2011–2015 54/38;16.
Table 1. Antimicrobial susceptibility of Salmonella isolates in poultry meat and poultry meat products in the period 2011–2015 54/38;16.
Sample No./Year SerotypeProductAntimicrobial Resistance ProfileAntimicrobial
Resistance Genes
1,2,3,4,5,6,7/2011S. enteritidisPoultry meat (carcass)S, TETsulI, tetA
8,9,10,11/2011S. enteritidisPoultry meat (chicken breast)NA, TETtetA, tetB
12,13/2012S. enteritidisPoultry meat (carcass)S, TETsulI, dfr, tetA
14/2012S. thyphimuriumPoultry meat (carcass)AMP, TET, sulI, sulII, tetA,
15,16,17,18/2013S. enteritidisPoultry meat (carcass)SMX, TETsulI, tetB, tetC
19,20,21/2013S. thyphimuriumPoultry meat (carcass)CHL, AMP, TET, NAsulI, sulII, tetA, tetB, cat1
22,23,24,25/2013S. enteritidisPoultry meat (carcass)CAZ, NA, TET, SsulI, sulII, tetA, tetC
26,27,28/2013S. enteritidisPoultry organs (liver)SMX, AMP, TET, NA sulI, sulII, tetA, tetB,
29,30/2014S. enteritidisPoultry meat (carcass)TET, NAsulI, tetB, tetA
31,32,33/2014S. thyphimuriumPoultry meat (carcass)S, AMPsulI, sulII, tetA, tetB
34,35/2014S. enteritidisPoultry organs (liver)AMP, NA, S, CAZdhfr1, sulI, tetA
36,37,38,39/2014S. enteritidisPoultry organs (liver)NA, TETblaTEM-1, aadA1, sulI, sulII, tetA, tetB
40,41,42/2014S. thyphimuriumPoultry meat (breast)AMP, TET aadA1, sulI, sulII, tetB,
43,44/2014S. thyphimuriumPoultry meat (chicken wings)NA, TETaadA1, sulI, sulII
45,46/2014S. enteritidisPoultry organs (hearts and gizzards)NA, AMPblaTEM-1, aadA1, dhfr1, sulI, tetA
47,48/2015S. enteritidisPoultry meat (carcass)AMP, TETaadA1, sulI, sulII, tetB
49/2015S. thyphimuriumPoultry meat (carcass)CHL, AMP, TET, SXT, NAaadA1, sulI, sulII, tetA, tetB, tetC, cat1
50,51,52,53/2015S. enteritidisPoultry meat (carcass)AMP, TETaadA1, sulI, sulII, tetB,
54/2015S. thyphimuriumPoultry organs (liver)NA, TETsulI, sulII, tetA
Table
Table 2. Antimicrobial susceptibility of Salmonella isolates in poultry meat and poultry meat products in the period 2016–2021.
Table 2. Antimicrobial susceptibility of Salmonella isolates in poultry meat and poultry meat products in the period 2016–2021.
Sample No./Year SerotypeProductAntimicrobial
Resistance Profile		Antimicrobial
Resistance Genes
55/2016S. enteritidisPoultry organs (hearts and gizzards)NA, TETsulI, sulII, tetA, tetB, tetC
56/2017S. enteritidisPoultry meat (carcass)AMP, TETaadA1, sulI, tetB, tetA, tetC
57/2017S. thyphimuriumPoultry meat (carcass)NA, AMP, TET, CAZ aadA1, dhfr1, sulI, sulII, tetA, cat2
58,59,60/2018S. enteritidisPoultry meat (carcass)SMX, NA, GEN, AMP, TET, SXTblaCMY-2, blaTEM-1, aadA1, aac(3)11a, sulI, sulII, tetA, tetC
61,62/2018S. enteritidisPoultry meat (chicken breast)S, NA, AMP, TET, CHLaadA1, sulI, sulII, tetB, blaTEM-1, cat1, floR
63,64/2018S. thyphimuriumPoultry meat (carcass)NA, TETsulI, sulII, tetB
65/2018S. thyphimuriumPoultry meat (carcass)S, AMP, TET, SXT, CAZ, GENaadA1, sulI, sulII, tetB, blaTEM-1, cat1. aac(3)11a
66/2018S. thyphimuriumPoultry organs (liver)SUL, TETsulI, tetA, tetB, tetC
67,68/2019S. enteritidisPoultry meat (carcass)SMX, S, AMP, TET, SXT, CHLaadA1, sulI, sulII, tetB, blaTEM-1, cat1
69,70/2019S. enteritidisPoultry meat (carcass)NA, TETblaTEM-1, sulI, tetA
71/2019S. enteritidisPoultry organs (liver)AMP, TET aadA1, sulI, sulII, tetB, blaTEM-1
72,73/2020S. enteritidisPoultry meat (carcass)S, AMP, TET, CIP, SXT, CHLaadA1, sulI, tetA, tetB, tetC, blaTEM-1, dhfr1, cat1
74,75/2020S. thyphimuriumPoultry meat (carcass)NA, TET,sulI, sulII, tetA, tetB, tetC
76,77,78/2020S. enteritidisPoultry organs (liver)AMP, NAdhfr1, sulI
79,80/2020S. enteritidisPoultry organs (liver)SMX, NA, S, AMP, TET, SXTblaCMY-2, blaTEM-1, aadA1, dhfr1, sulI, sulII, tetA,
81,82,83/2020S. thyphimuriumPoultry meat (breast)SMX, S, AMP, TET, SXT, NA, CHLaadA1, sulI, sulII, tetB, blaTEM-1, cat1
84,85/2021S. thyphimuriumPoultry meat (chicken wings)AMP, NAaadA1, dhfr1, sulI, sulII
86,87,88/2021S. enteritidisPoultry meat (carcass)S, AMP, NA, TET, SXT, CHLaadA1, sulI, tetA, tetB, tetC, blaTEM-1, dhfr1, cat1, floR
89,90/2021S. enteritidisPoultry organs (liver)SMX, S, AMP, NA, TET, SXT, CHLaadA1, sulI, sulII, tetB, blaTEM-1, cat1, cat2, floR
91/2021S. enteritidisPoultry meat (carcass)S, AMP, TET, CIP, SXT, NA, CHLaadA1, sulI, tetA, tetB, tetC, blaTEM-1, dhfr1, cat1, floR
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Forgaciu, A.; Tabaran, A.; Colobatiu, L.; Mihaiu, R.; Dan, S.D.; Mihaiu, M. Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products. Antibiotics 2022, 11, 1469. https://doi.org/10.3390/antibiotics11111469

AMA Style

Forgaciu A, Tabaran A, Colobatiu L, Mihaiu R, Dan SD, Mihaiu M. Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products. Antibiotics. 2022; 11(11):1469. https://doi.org/10.3390/antibiotics11111469

Chicago/Turabian Style

Forgaciu, Anca, Alexandra Tabaran, Liora Colobatiu, Romolica Mihaiu, Sorin Daniel Dan, and Marian Mihaiu. 2022. "Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products" Antibiotics 11, no. 11: 1469. https://doi.org/10.3390/antibiotics11111469

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop