Next Article in Journal
The Role of Non-Enzymatic Degradation of Meropenem—Insights from the Bottle to the Body
Next Article in Special Issue
Alteration of Intestinal Microbiome of Clostridioides difficile-Infected Hamsters during the Treatment with Specific Cow Antibodies
Previous Article in Journal
Bee Pollen and Bee Bread as a Source of Bacteria Producing Antimicrobials
Previous Article in Special Issue
Mortality Following Clostridioides difficile Infection in Europe: A Retrospective Multicenter Case-Control Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 6
10.3390/antibiotics10060714
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Temporal Variations in Patterns of Clostridioides difficile Strain Diversity and Antibiotic Resistance in Thailand

by
Supapit Wongkuna
1,
Tavan Janvilisri
1,
Matthew Phanchana
2,
Phurt Harnvoravongchai
3,
Amornrat Aroonnual
4,
Sathid Aimjongjun
5,
Natamon Malaisri
3 and
Surang Chankhamhaengdecha
3,*
1
Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
2
Department of Molecular Tropical Medicine and Genetics, Faculty of Tropical Medicine, Mahidol University, Bangkok 10400, Thailand
3
Department of Biology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
4
Department of Tropical Nutrition and Food Science, Faculty of Tropical Medicine, Mahidol University, Bangkok 10400, Thailand
5
Graduate Program in Molecular Medicine, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(6), 714; https://doi.org/10.3390/antibiotics10060714
Submission received: 13 May 2021 / Revised: 5 June 2021 / Accepted: 8 June 2021 / Published: 13 June 2021
(This article belongs to the Special Issue Clostridioides difficile Infection)
Browse Figures
Versions Notes

Abstract

:
Clostridioides difficile has been recognized as a life-threatening pathogen that causes enteric diseases, including antibiotic-associated diarrhea and pseudomembranous colitis. The severity of C. difficile infection (CDI) correlates with toxin production and antibiotic resistance of C. difficile. In Thailand, the data addressing ribotypes, toxigenic, and antimicrobial susceptibility profiles of this pathogen are scarce and some of these data sets are limited. In this study, two groups of C. difficile isolates in Thailand, including 50 isolates collected from 2006 to 2009 (THA group) and 26 isolates collected from 2010 to 2012 (THB group), were compared for toxin genes and ribotyping profiles. The production of toxins A and B were determined on the basis of toxin gene profiles. In addition, minimum inhibitory concentration of eight antibiotics were examined for all 76 C. difficile isolates. The isolates of the THA group were categorized into 27 A−B+CDT− (54%) and 23 A-B-CDT- (46%), while the THB isolates were classified into five toxigenic profiles, including six A+B+CDT+ (23%), two A+B+CDT− (8%), five A−B+CDT+ (19%), seven A−B+CDT− (27%), and six A−B−CDT− (23%). By visually comparing them to the references, only five ribotypes were identified among THA isolates, while 15 ribotypes were identified within THB isolates. Ribotype 017 was the most common in both groups. Interestingly, 18 unknown ribotyping patterns were identified. Among eight tcdA-positive isolates, three isolates showed significantly greater levels of toxin A than the reference strain. The levels of toxin B in 3 of 47 tcdB-positive isolates were significantly higher than that of the reference strain. Based on the antimicrobial susceptibility test, metronidazole showed potent efficiency against most isolates in both groups. However, high MIC values of cefoxitin (MICs 256 μg/mL) and chloramphenicol (MICs ≥ 64 μg/mL) were observed with most of the isolates. The other five antibiotics exhibited diverse MIC values among two groups of isolates. This work provides evidence of temporal changes in both C. difficile strains and patterns of antimicrobial resistance in Thailand.

1. Introduction

Clostridioides difficile (formerly Clostridium difficile), belonging to the family Clostridiaceae and genus Clostridioides, is an obligate anaerobic, Gram-positive, spore-forming, toxin-producing bacillus [1,2]. This organism is well known to cause infectious diarrhea in humans, ranging from mild diarrhea to severe pseudomembranous colitis [3]. C. difficile infection (CDI) has been primarily a healthcare-associated illness, which can occur during antibiotic treatment. Furthermore, the ability of C. difficile to form spores leads to the problem of recurring infection. The persistence of spores in the physical environment facilitates its transmission [4]. The pathogenesis of CDI is attributed to the production of two major toxins: toxins A and B. Toxin A is an enterotoxin encoded by tcdA, and toxin B is a cytotoxin encoded by tcdB. Both toxins belong to the family of large clostridial toxins (LCTs) and are located within a 19.6 kb pathogenicity locus (PaLoc) [5]. In addition to toxins A and B, some strains of C. difficile also produce a binary toxin (CDT) encoded by two genes, cdtA and cdtB, on CdtLoc, a separate pathogenicity island [6]. Although CDTs are not directly required for diseases, they have been known to promote the virulence of C. difficile by impairing host immunity and acting in synergy with toxins A and B, exacerbating toxicity [7].
Over the recent decades, the epidemiology of CDI has dramatically changed. The epidemiology in North America and Europe and some parts of Asia is well-documented. While ribotype 027 causes major outbreaks in North America and Europe, ribotype 017 is the most dominant ribotype in Asia [8,9]. In Thailand, tcdA-negative, tcdB-positive ribotype 017 is the most prevalent C. difficile strain [10,11,12]. However, the occurrence of C. difficile has not been studied in all regions of Thailand. Recently, the diversity and prevalence of C. difficile have increased and influenced the incidence of CDI in many areas. Several ribotypes have emerged and lead to epidemic infections across the world; for example, ribotype 014/20 in Australia [13,14], ribotype 369 in Japan [15], and ribotype 078 in China [16].
Antibiotic use plays a major role in the development of CDI and recurrent diseases by disrupting the normal flora in the gut and allowing the invasion of C. difficile [17,18]. The first-line treatment for CDI is the use of antibiotics, including vancomycin, fidaxomicin, and metronidazole [19,20]. However, drug resistance has become one contributing factor that drives the global prevalence of CDI [21,22,23,24]. Although information on C. difficile has been globally expanded, little knowledge of antibiotic susceptibility of C. difficile in Thailand is available. Previous studies showed that C. difficile isolates in Thailand were susceptible to vancomycin and metronidazole. However, a high resistance level against multiple antibiotics, such as clindamycin, erythromycin, and moxifloxacin has been reported [25,26]. This study was conducted to compare two groups of C. difficile clinical isolates collected in different time periods from a University-affiliated tertiary hospital and the National Institute of Health of Thailand. To describe the diversity of C. difficile clinical isolates during 2006–2009 and 2010–2012, the presence of toxin genes and ribotype, including toxin levels and antimicrobial susceptibility patterns, were characterized using molecular techniques.

2. Results

2.1. Toxin Gene Profiles of C. difficile Isolates

The multiplex PCR was employed to identify the toxin gene profiles of C. difficile isolates. Seventy-six C. difficile isolates were classified into five profiles based on the presence of toxin genes. Only two toxigenic types were observed in the THA group. Twenty-seven THA isolates (54%) were characterized as A−B+CDT− (toxigenic), and 23 THA isolates (46%) were A−B−CDT− (non-toxigenic) (Figure 1A). All 27 isolates in the THA group that were previously positive for tcdA carried the tcdA 3′-end deletion (Supplementary Table S1). Later, they were grouped as tcdA-negative isolates instead. Thus, none of the toxigenic isolates in the THA group were tcdA-positive. In the THB group, six isolates (23%) were classified as A+B+CDT+, five isolates (19%) as A−B+CDT+, two isolates (8%) as A+B+CDT−, seven isolates (27%) as A−B+CDT−, and six isolates (23%) as A−B−CDT− (Figure 1B). Among tcdA-negative isolates in the THB group, in 12 isolates (63%) were found the deletion regions within the 3′-end (Table S1). Based on the molecular analysis, around 54% of the THA isolates and 77% of the THB isolates were toxigenic (Figure 1). The most dominant toxigenic type was A−B+, which was about 54% of THA isolates and 46% of THB isolates.

2.2. Ribotypes of C. difficile Isolates

The band patterns of 16S and 23S rRNA PCR products were compared to the reference C. difficile ribotypes (Figure S1). Based on PCR ribotyping, THA isolates were separated into five ribotypes (Figure 2A). Ribotype 017 was the only standard ribotype found in the THA group, whereas the other four ribotypes showed different patterns from the standards (NN or NT). The dominant ribotype was NN05, followed by ribotype 017 and NN07. Even though the number of isolates in the THB group was lower compared to the THA group, THB isolates were classified into 15 ribotypes (Figure 2B). Ribotype 017 had the highest prevalence in the THB group with seven isolates (27%). Only one isolate (4%) was classified as ribotype 020. Alternatively, the other 14 isolates in the THB group showing distinct ribotyping patterns compared to the references were classified into 13 unknown ribotypes. The distribution of toxin gene profiles and ribotyping profiles is elaborated in Table 1. Diverse ribotypes were observed with each toxin gene profile; for instance, the A+B+CDT+ group was composed of five ribotyping patterns, RT020, NT01, NT03, NT05, and NT06 (Table 1). These results suggest a high diversity of C. difficile isolates in Thailand.

2.3. Toxin Production of C. difficile Isolates

Toxin production of C. difficile is a significant factor causing CDI [27]. In this study, toxin production of toxigenic C. difficile isolates, including A+B+, A+B−, and A−B+, was accessed using indirect ELISA. The toxin levels of individual isolates were compared to the toxin production of C. difficile R20291 (A+B+CDT+), a recent emergence of a highly virulent bacterium. The unique ability of hypervirulent strain R20291 is associated with an increase in toxin production [28]. The amounts of toxins A and B were similar among toxigenic isolates in the THA and THB groups. Notably, four toxin-positive isolates, THB1, THB38, THB156, and THB376, significantly increased toxin A levels (2–9 folds) compared to R020291 (Figure 3A). Toxigenic THA isolates were found to produce similar levels of toxin B to the reference strain. Three isolates, THB2, THB136, and THB156, significantly produced greater levels of toxin B (3–6 folds) compared to the reference strain (Figure 3B). Interestingly, THB156 was the only toxigenic isolate that produced a significantly high level of toxin A and B. On the basis of these results, many THB isolates represented high toxin producers, suggesting increased toxin production of toxigenic C. difficile isolates in Thailand.

2.4. Antimicrobial Resistance Profiles of C. difficile Isolates

Antibiotic resistance has become one of the major challenges of CDI treatment. In this study, the antimicrobial susceptibility of the 76 C. difficile isolates was determined using the minimum inhibitory concentration (MIC) method. A variety of MIC values of eight antibiotics were observed across C. difficile isolates (Figure 4). Antibiotic susceptibility patterns of two groups of isolates are summarized in Table 2. In the THA group, 48 isolates (96%) were susceptible to amoxicillin with an MIC90 of 2 μg/mL, while 46 isolates (92%) were susceptible to ampicillin with an MIC90 of 4 μg/mL. All THA isolates were resistant to chloramphenicol with an MIC90 of ≥ 64 μg/mL. In addition, all THA isolates were resistant to cefoxitin, except one isolate with an MIC90 of 256 μg/mL. Conversely, all isolates in the THA group were susceptible to metronidazole with an MIC90 of 4 μg/mL. Amoxicillin and ampicillin showed potent activity against all THB isolates with an MIC90 of 2 and 4 μg/mL, respectively. Additionally, most THB isolates were resistant to chloramphenicol with an MIC90 of ≥ 64 μg/mL (96.15%), followed by cefoxitin with an MIC90 of 256 μg/mL (92.31%). None of the isolates in the THB group were resistant to metronidazole and only three THB isolates (11.54%) were resistance to vancomycin. In addition, three (11.54%) and two (7.69%) of THB isolates were resistant to levofloxacin and rifampicin, respectively. Minor differences in the MIC range between THA and THB isolates were observed (Table 3). For instance, chloramphenicol showed an MIC range of 32- ≥ 64 μg/mL in THA isolates, and 16- ≥ 64 μg/mL in THB isolates. A slightly greater ratio of resistant isolates was shown in THA isolates compared to THB isolates. Overall, two groups of isolates showed similar patterns of MIC values. Most THA and THB isolates were susceptible to all antibiotics, except cefoxitin and chloramphenicol, which showed the highest MIC ranges and resistance rates (Table 2). In total, 49 (98%) of the THA isolates and 23 (88.46%) of the THB isolates were resistant to more than one antibiotic. Most of them were resistant to chloramphenicol, cefoxitin, and levofloxacin, which belong to different antibiotic classes. These findings demonstrated multidrug-resistant (MDR) strains among Thai C. difficile isolates (Table S2).

3. Discussion

C. difficile infection (CDI) has occurred worldwide over recent decades. The prevalence and epidemiology of C. difficile in many regions are well documented [31,32]. However, information on C. difficile occurrences in Thailand remains limited. This work was conducted to continuously update information on C. difficile clinical isolates in Thailand by comparing two groups of clinical isolates that were collected in different time periods. C. difficile isolates were classified based on molecular features, including toxin genes and the 16S–23S rRNA intergenic spacer regions [33,34]. Normally, three major toxigenic types (A+B+, A+B−, A−B+) cause clinical incidences of CDI. The toxigenic type A+B+ is the most common among toxigenic types [35,36]. However, the presence of tcdA 3′-end deletion has been detected in many clinical isolates, resulting in toxin A-negative C. difficile isolates [37,38]. About half of C. difficile isolates collected during 2006–2009 (THA group) were toxigenic with the highest occurrence of A-B+ isolates (Figure 1A). Although isolates used in this study were obtained from the patients with CDI, consistent with previous studies, non-toxigenic strains were highly detected from clinical samples due to the mix of both the non-toxigenic and toxigenic populations and isolation method [10,39,40]. The population sizes of non-toxigenic and toxigenic C. difficile isolates in Thailand during 2006–2018 were comparable. The most dominant toxigenic isolates were tcdA-negative and tcdB-positive (A−B+) [10]. In contrast, the majority of C. difficile isolates collected during 2010–2012 (THB group) were toxigenic, and toxin gene profiles increased to five types, A−B−CDT−, A−B+CDT−, A+B+CDT−, A−B+CDT+, and A+B+CDT+ (Figure 1B). However, no A−B−CDT+ was detected in this study, corresponding to the previous study showing low prevalence of binary toxin-positive but toxin A- and B-negative C. difficile strains in France [41]. Some C. difficile isolates have the binary toxin gene (CDT), an actin-specific ADP-ribosyl transferase encoded by two genes, cdtA and cdtB on the CDT locus (CdtLoc) [6,42]. The binary toxins are widely observed in hypervirulent C. difficile, such as the ribotypes 027 and 078, which cause higher severity of CDI [43,44]. Therefore, the binary toxin may serve as an additional virulent factor by enhancing the production of toxins A and B. Our findings indicate a higher prevalence of toxigenic isolates in Thailand from 2010 to 2012.
Currently, PCR ribotyping is a general technique for epidemiological distinction of C. difficile isolates. This method amplifies polymorphic sequences between 16S and 23S intergenic spacer regions, which vary among strains [33,45,46]. It is the most common method employed for molecular analysis of C. difficile strains and is considered the gold standard method for C. difficile typing [10,11,33,47]. A similar incidence shown in the analysis of toxin genes was also observed with the ribotyping profiles. The number of ribotypes found during 2010–2012 was up to 16 ribotypes, from five ribotypes identified during 2006–2009 (Figure 2). C. difficile ribotype 017 has been recognized as a major cause of CDI outbreaks in Asia, and ribotype 020 is also a common strain [12,48]. Ribotype 017 was also the most frequently found in Thailand [11]. Consistent with this study, the most common ribotype in both groups was ribotypes 017. Besides, there were unknown ribotypes which showed different amplified patterns compared to the references between the two groups. However, we could not compare the PCR ribotyping patterns of the unknown ribotypes to other unknown ribotypes discovered in the previous studies in Thailand due to the limitation of this method. Other techniques, including pulse-field gel electrophoresis (PFGE), restriction endonuclease analysis (REA), and multilocus variable-number tandem-repeat analysis (MLVA), can be applied to improve typing of C. difficile strains [49,50]. Based on PCR ribotyping, molecular epidemiology of C. difficile isolated in Thailand significantly differs from other regions where ribotypes 027, 014/20, 002, 106, and 001 have dominated in North America and ribotypes 027, 014, 001, and 078 have frequently been isolated in Europe [51,52]. On the basis of toxin genes and ribotype identification, the diversity of C. difficile isolates in Thailand has increased over time.
Toxins A and B are the primary virulence factors contributing to the pathogenesis of CDI. They are considered to cause severe diseases [53]. Several studies have revealed that A−B+ strains can cause the same range of disease as isolates producing both, but a few pathogenic isolates have been found as A+B− [54,55,56]. In the current study, none of the toxigenic isolates were classified as A+B−, supporting the finding that toxin B is important for the pathogenesis of C. difficile without the presence of toxin A. This implied that pathogenic C. difficile isolates in Thailand were mainly influenced by the production of toxin B. Based on the relative quantification of toxins in this study, three of eight tcdA-positive (A+) isolates showed significantly greater production of toxin A compared to a recent hypervirulent C. difficile strain. Most tcdB-positive (B+) isolates produced toxin B at the same level as the reference strain, of which only three tcdB-positive isolates in the THB group significantly increased the level of toxin B (Figure 3). Remarkably, most isolates that produced high levels of toxins A and B were binary toxin-positive (CDT+) isolates. A high toxin production is one of the features of hypervirulent strains associated with severity of disease [57,58,59]. Markedly, an increase in toxin production is influenced by binary toxins [6,60]. Therefore, the higher amount of toxins produced by isolates in this study might be associated with the presence of binary toxin genes.
Antibiotic resistance has become one of the most important virulence factors associated with the development of CDI. The expansion of strain diversity advocates antibiotic resistance in C. difficile [24,61,62]. To determine the direction of the antibiotic susceptibility of Thai C. difficile isolates, two groups of isolates were tested against several classes of antibiotics, which are recommended in infectious diarrhea [63,64]. None of the isolates fully resisted metronidazole, but three isolates showed intermediate resistance. However, 9 of 76 isolates had full resistance to vancomycin. This incidence was also observed in several studies with reduced susceptibility to vancomycin [22,65]. Our observations suggest a high efficiency of metronidazole for treating CDI, that also relates to the previous studies in Thailand [25,26]. Beta-lactam groups of antibiotics are most frequently correlated with CDI [66]. Several studies reported a low level of resistance to this antibiotic group [61,62]. In this study, amoxicillin and ampicillin also showed potent action against C. difficile isolates in Thailand. This supported the fact that antibiotics in the same class provide equal efficacy. Nevertheless, fluoroquinolones (ciprofloxacin, levofloxacin, moxifloxacin, norfloxacin) and cephalosporins (cefazolin, cefepime, ceftazidime, ceftriaxone, cefuroxime, cefotetan, cefoxitin) are common antibiotic groups used for treating bacterial infection in the clinical setting, and they continue to promote CDI [67,68]. The same incidence was detected in this study, in which the majority of C. difficile isolates were resistant to levofloxacin and cefoxitin. Resistance to chloramphenicol is rare in C. difficile. Only a small number of isolates have been reported to be chloramphenicol resistant [24,69]. Contrary to our observations, all isolates fully resisted chloramphenicol, except for one that showed intermediate resistance. In addition, the reduced susceptibility to rifampicin in C. difficile clinical strains has been reported in Asia, Europe, and North America [69,70,71]. Correspondingly, rifampicin-resistant isolates were detected in the current study. On the basis of antibiotic resistance analysis, most C. difficile isolates in this study were resistant to multiple antibiotics, increasing the chance of treatment failure. Although C. difficile isolates between two periods showed distinct diversity, the difference in the patterns of antibiotic resistance was not observed in this study.
In summary, C. difficile isolates from patients diagnosed with diarrhea during 2006–2009 and 2010–2012 were characterized for toxigenic types, ribotypes, toxin production, and antibiotic resistance. The toxigenic profiles found in Thailand rose to five types, including A−B+CDT−, A+B+CDT+, A+B+CDT−, A−B+CDT+, and A−B−CDT−. In particular, ribotype 017 was predominant among clinical isolates in Thailand. Additionally, 18 unknown ribotypes were discovered in Thai isolates. Some C. difficile isolates in Thailand were able to produce similar levels of toxins A and B to the toxins of the hypervirulent C. difficile strain, R20291. There was no difference in susceptibility to vancomycin and metronidazole between two periods, supporting the fact that they are primary antibiotics for CDI therapy. In addition, amoxicillin, ampicillin, and rifampicin also had an effective impact on treating isolates in Thailand. Based on these findings, this study presents temporal changes in C. difficile strain diversity and patterns of antimicrobial resistance in Thailand, which will be useful for surveillance.

4. Materials and Methods

4.1. Sample Collection and Bacterial Culture

In total, 76 C. difficile clinical isolates were obtained from a University-affiliated tertiary hospital and the National Institute of Health of Thailand. The isolation of C. difficile from stool samples of diarrheal patients was performed in previous studies [39,40]. These isolates were separated into 2 groups based on collection periods. The THA group was composed of 50 isolates collected from 2006 to 2009, and the THB group contained 26 isolates collected from 2010 to 2012. Each isolate was cultured on cycloserine–cefoxitin fructose agar (CCFA) for 24 h at 37 °C under anaerobic conditions (Coy Laboratory Products, Glass Lake, MI, USA) supplemented with 0.1% taurocholate to recover and enrich C. difficile cells. A single colony was cultured in fresh brain heart infusion (BHI) broth and incubated in an anaerobic chamber at 37 °C for 24–48 h. The culture was preserved with 10% (v/v) glycerol at −80 °C for further use.

4.2. Toxin Genotyping

Genomic DNA of C. difficile isolates was extracted from BHI culture using an E.Z.N.A.® Stool DNA kit (Omega Bio-tek, Norcross, GA, USA), according to the manufacturer’s instructions. DNA purity and concentration were assessed by NanoDropTM spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Toxigenic profiles of all C. difficile isolates were analyzed by multiplex PCR with 5 specific primer pairs, tcdA, tcdB, cdtA, cdtB, and 16S rDNA (Table 3). The PCR reaction was conducted in a total volume of 20 µL containing 25–200 ng of genomic DNA, 0.8 mM dNTPs, 5 mM MgCl2, 1× PCR buffer, (500 mM KCl, 100 mM tris-HCl, pH 9.1), 1U Taq DNA polymerase (Vivantis, kuala Lumpur, Malaysia), and 0.2 µM primers. Amplification was performed under a thermal cycler with cycling conditions including a predenaturation at 92 °C for 5 min, 30 cycles of denaturation at 92 °C for 20s, an annealing at 58 °C for 65s, and an extension at 68 °C for 90s, and a final extension at 60 °C for 5 min.
In addition, the deletion in repeating regions at the 3′ end of the tcdA gene was investigated using the NK9 and NKV011 primers (Table 3) by Kato et al. 1999 [72]. PCR reaction was performed under the same conditions of the multiplex PCR. The thermocycler conditions included a predenaturation at 94 °C for 6 min, followed by 37 cycles of denaturation at 94 °C for 20 s, an annealing at 55 °C for 30 s, and an extension at 60 °C for 120 s, and a final extension at 60 °C for 10 min. The PCR products were visualized using electrophoresis with 1.2% agarose gel and strained with ethidium bromide.

4.3. PCR Ribotyping

PCR ribotyping was performed based on the 16S–23S rRNA intergenic spacer regions described by Bidet et al. 1999 [73]. The primer sequences were 5′-GTGCGGCTGGATCACCTCCT-3′ (16S primer) and 5′-CCCTGCACCCTTATTACCTTGACC-3′ (23S primer). The PCR reaction was conducted in a total volume of 20 µL composed of 25–200 ng genomic DNA, 0.2 mM dNTPs, 0.2 µM primers, 1.5 mM MgCl2, 10× PCR buffer (500 mM KCl, 100 mM Tris-HCl, pH 9.1), 1U Tag DNA polymerase, and deionized water. The thermocycler profile consisted of an initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 1 min, 57 °C for 1 min, and 72 °C for 1 min, and a final extension at 72 °C for 10 min. Amplification products were separated by electrophoresis in 3% agarose gel for 6 h with 85 V in 1× Tris-borate EDAT (TBE) buffer. The electrophoresis patterns were visualized under UV light after staining with ethidium bromide. The high-resolution image was captured and analyzed with a gel documentation system. The resulting band patterns were visually compared to PCR ribotypes of the reference strains, C. difficile PCR ribotypes 001, 012, 017, 020, 023, 027, 046, 056, 077, 081, 095, 106, and 117.

4.4. Quantification of Toxins A and B

Toxigenic C. difficile isolates (n = 47) and the reference strain, C. difficile R20291, were inoculated on CCFA agar plates. A single colony was cultured in fresh BHI media. A total of 1% of bacterial culture was sub-cultured into fresh BHI media for 48 h at 37 °C. The supernatant was collected from the culture using centrifugation at 5000× g for 10 min and sterilized by passing through a 0.22 µm membrane. Total protein was measured using Bradford’s assay (Clive G et al., 1989). Indirect enzyme-link immunosorbent assay (ELISA) was performed to quantify the level of toxins A and B. Initially, 96-well polystyrene microtiter plates were coated with 100 μL of 5 mg/mL supernatant in 0.5 M carbonate buffer (pH 9.4) and incubated overnight at 4 °C. The plates were washed three times with 200 μL of 1× PBS. Then, 200 μL of blocking solution (1% BSA) was added to wells. The plates were incubated for 1 h at room temperature and washed with PBS-T (0.05% Tween-20, pH 7.4). The 100 μL final 1:500 dilution of mouse anti-toxin A (Abcam, Cambridge, UK) or 1:250 dilution of mouse anti-toxin B (Bio-Rad, Hercules, CA, USA) was added to wells. The plates were incubated for 1 h at 37 °C and washed three times with 100 µL of PBS-T at room temperature. Finally, 50 µL of 1:4 dilution of Equilibrate SignalStain® Boost IHC Detection Reagent (HRP, anti-mouse) (Cell Signaling, Beverly, MA, USA) was added to wells. The plates were then incubated for 1 h at 37 °C and washed three times with 1× PBS. Finally, 100 μL TMB (3,3′,5,5′-tetramethylbenzidine) substrate (Seracare, Milford, MA, USA) was added to wells. After 10 min of incubation at 37 °C, the reaction was stopped by addition of 100 μL of 2 N hydrochloric acid. The absorbance at 450 nm was measured by microplate reader (Tecan, Switzerland). The relative levels of toxin production were compared to the reference strain, C. difficile R20291.

4.5. Minimal Inhibitory Concentration (MIC) Testing

The minimal inhibitory concentration (MIC) testing was performed using 96-well broth dilution in triplicate. Nine antibiotics, including metronidazole (0.0625–16 μg/mL), vancomycin (0.0625–16 μg/mL), amoxicillin (0.125–32 μg/mL), ampicillin (0.125–32 μg/mL), cefoxitin (2–256 μg/mL), chloramphenicol (0.25–32 μg/mL), levofloxacin (0.125–32 μg/mL), and rifampicin (0.125–32 μg/mL) were subjected to MIC testing. A single colony of C. difficile on CCFA was inoculated into fresh BHI medium. After overnight incubation, C. difficile culture was transferred to freshly prepared Wilkins-Chalgren broth until the OD600 reached 0.6 (~108 CFU/mL). Two-fold serial dilutions of antibiotics (0.125–512 μg/mL) were prepared in a 96-well plate at a total volume of 200 μL. A total of 10 μL of bacterial suspension (~106 CFU/mL) was then inoculated into antibiotic plates. The 96-well microplates were incubated at 37 °C under anaerobic conditions for 48 h. The OD600 at the end point was measured using a spectrophotometer. The MIC values were defined as the lowest concentration of antibiotic where no growth of bacteria was observed. The MIC results were categorized according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI), http://www.clsi.org/ accessed on 1 June 2021; the European Committee on Antimicrobial Susceptibility Testing (EUCAST), http://www.eucast.org/ accessed on 1 June 2021; and published data [29,30].

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/antibiotics10060714/s1, Figure S1: PCR ribotyping of (A) standard C. difficile strains and (B) C. difficile isolates in this study, Table S1: Toxigenic profiles and ribotype of 76 C. difficile clinical isolates from Thailand, Table S2: Antimicrobial susceptibility of 76 C. difficile clinical isolates from Thailand against 8 antibiotics.

Author Contributions

Conceptualization, S.C.; data curation, S.W.; formal analysis, S.W. and N.M.; methodology, S.W, N.M., M.P., A.A., P.H., and S.A.; investigation, S.C; validation, T.J.; writing—original draft preparation, S.W.; writing—review and editing, T.J. and S.C.; project administration, S.C. and T.J. All authors have read and agreed to the published version of the manuscript.

Funding

This project is funded by the National Research Council of Thailand (NRCT) and Mahidol University (NRCT5-RSA63015) to S.C., and Research Cluster: Multi-Generation Researchers Grant from Mahidol University to S.C., T.J., and P.H.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors thank Piyada Wangroongsarb, Department of Medical Sciences, National Institute of Health, Ministry of Public Health, for C. difficile THA isolates and Nigel Minton, University of Nottingham, for C. difficile reference ribotype strains.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kelly, C.P.; Pothoulakis, C.; LaMont, J.T. Clostridium difficile colitis. N. Engl. J. Med. 1994, 330, 257–262. [Google Scholar] [CrossRef]
  2. Oren, A.; Rupnik, M. Clostridium difficile and Clostridioides difficile: Two validly published and correct names. Anaerobe 2018, 52, 125–126. [Google Scholar] [CrossRef] [PubMed]
  3. Jawa, R.S.; Mercer, D.W. Clostridium difficile-associated infection: A disease of varying severity. Am. J. Surg. 2012, 204, 836–842. [Google Scholar] [CrossRef] [PubMed]
  4. Zhu, D.; Sorg, J.A.; Sun, X. Clostridioides difficile Biology: Sporulation, Germination, and Corresponding Therapies for C. difficile Infection. Front. Cell. Infect. Microbiol. 2018, 8, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Burnham, C.A.; Carroll, K.C. Diagnosis of Clostridium difficile infection: An ongoing conundrum for clinicians and for clinical laboratories. Clin. Microbiol. Rev. 2013, 26, 604–630. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Gerding, D.N.; Johnson, S.; Rupnik, M.; Aktories, K. Clostridium difficile binary toxin CDT: Mechanism, epidemiology, and potential clinical importance. Gut Microbes 2014, 5, 15–27. [Google Scholar] [CrossRef] [Green Version]
  7. Cowardin, C.A.; Buonomo, E.L.; Saleh, M.M.; Wilson, M.G.; Burgess, S.L.; Kuehne, S.A.; Schwan, C.; Eichhoff, A.M.; Koch-Nolte, F.; Lyras, D.; et al. The binary toxin CDT enhances Clostridium difficile virulence by suppressing protective colonic eosinophilia. Nat. Microbiol. 2016, 1, 16108. [Google Scholar] [CrossRef] [Green Version]
  8. He, M.; Miyajima, F.; Roberts, P.; Ellison, L.; Pickard, D.J.; Martin, M.J.; Connor, T.R.; Harris, S.R.; Fairley, D.; Bamford, K.B.; et al. Emergence and global spread of epidemic healthcare-associated Clostridium difficile. Nat. Genet. 2013, 45, 109–113. [Google Scholar] [CrossRef]
  9. Borren, N.Z.; Ghadermarzi, S.; Hutfless, S.; Ananthakrishnan, A.N. The emergence of Clostridium difficile infection in Asia: A systematic review and meta-analysis of incidence and impact. PLoS ONE 2017, 12, e0176797. [Google Scholar] [CrossRef] [Green Version]
  10. Imwattana, K.; Wangroongsarb, P.; Riley, T.V. High prevalence and diversity of tcdA-negative and tcdB-positive, and non-toxigenic, Clostridium difficile in Thailand. Anaerobe 2019, 57, 4–10. [Google Scholar] [CrossRef]
  11. Putsathit, P.; Maneerattanaporn, M.; Piewngam, P.; Kiratisin, P.; Riley, T.V. Prevalence and molecular epidemiology of Clostridium difficile infection in Thailand. New Microbes New Infect. 2017, 15, 27–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Imwattana, K.; Knight, D.R.; Kullin, B.; Collins, D.A.; Putsathit, P.; Kiratisin, P.; Riley, T.V. Clostridium difficile ribotype 017-characterization, evolution and epidemiology of the dominant strain in Asia. Emerg. Microbes Infect. 2019, 8, 796–807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Umeki, S.; Niki, Y.; Soejima, R. Angiotensin-converting enzyme activity and steroid therapy in sarcoidosis. Arch. Intern. Med. 1987, 147, 2056. [Google Scholar] [CrossRef]
  14. Collins, D.A.; Putsathit, P.; Elliott, B.; Riley, T.V. Laboratory-based surveillance of Clostridium difficile strains circulating in the Australian healthcare setting in 2012. Pathology 2017, 49, 309–313. [Google Scholar] [CrossRef]
  15. Senoh, M.; Kato, H.; Fukuda, T.; Niikawa, A.; Hori, Y.; Hagiya, H.; Ito, Y.; Miki, H.; Abe, Y.; Furuta, K.; et al. Predominance of PCR-ribotypes, 018 (smz) and 369 (trf) of Clostridium difficile in Japan: A potential relationship with other global circulating strains? J. Med. Microbiol. 2015, 64, 1226–1236. [Google Scholar] [CrossRef] [Green Version]
  16. Jin, H.; Ni, K.; Wei, L.; Shen, L.; Xu, H.; Kong, Q.; Ni, X. Identification of Clostridium difficile RT078 From Patients and Environmental Surfaces in Zhejiang Province, China. Infect. Control. Hosp. Epidemiol. 2016, 37, 745–746. [Google Scholar] [CrossRef] [Green Version]
  17. Rupnik, M.; Wilcox, M.H.; Gerding, D.N. Clostridium difficile infection: New developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 2009, 7, 526–536. [Google Scholar] [CrossRef] [PubMed]
  18. Loo, V.G.; Bourgault, A.M.; Poirier, L.; Lamothe, F.; Michaud, S.; Turgeon, N.; Toye, B.; Beaudoin, A.; Frost, E.H.; Gilca, R.; et al. Host and pathogen factors for Clostridium difficile infection and colonization. N. Engl. J. Med. 2011, 365, 1693–1703. [Google Scholar] [CrossRef] [Green Version]
  19. Bagdasarian, N.; Rao, K.; Malani, P.N. Diagnosis and treatment of Clostridium difficile in adults: A systematic review. JAMA 2015, 313, 398–408. [Google Scholar] [CrossRef]
  20. Ofosu, A. Clostridium difficile infection: A review of current and emerging therapies. Ann. Gastroenterol. 2016, 29, 147–154. [Google Scholar] [CrossRef]
  21. Goudarzi, M.; Goudarzi, H.; Alebouyeh, M.; Azimi Rad, M.; Shayegan Mehr, F.S.; Zali, M.R.; Aslani, M.M. Antimicrobial susceptibility of clostridium difficile clinical isolates in iran. Iran. Red Crescent Med. J. 2013, 15, 704–711. [Google Scholar] [CrossRef] [Green Version]
  22. Adler, A.; Miller-Roll, T.; Bradenstein, R.; Block, C.; Mendelson, B.; Parizade, M.; Paitan, Y.; Schwartz, D.; Peled, N.; Carmeli, Y.; et al. A national survey of the molecular epidemiology of Clostridium difficile in Israel: The dissemination of the ribotype 027 strain with reduced susceptibility to vancomycin and metronidazole. Diagn. Microbiol. Infect. Dis. 2015, 83, 21–24. [Google Scholar] [CrossRef] [PubMed]
  23. Jin, D.; Luo, Y.; Huang, C.; Cai, J.; Ye, J.; Zheng, Y.; Wang, L.; Zhao, P.; Liu, A.; Fang, W.; et al. Molecular Epidemiology of Clostridium difficile Infection in Hospitalized Patients in Eastern China. J. Clin. Microbiol. 2017, 55, 801–810. [Google Scholar] [CrossRef] [Green Version]
  24. Peng, Z.; Addisu, A.; Alrabaa, S.; Sun, X. Antibiotic Resistance and Toxin Production of Clostridium difficile Isolates from the Hospitalized Patients in a Large Hospital in Florida. Front. Microbiol. 2017, 8, 2584. [Google Scholar] [CrossRef] [PubMed]
  25. Putsathit, P.; Maneerattanaporn, M.; Piewngam, P.; Knight, D.R.; Kiratisin, P.; Riley, T.V. Antimicrobial susceptibility of Clostridium difficile isolated in Thailand. Antimicrob. Resist. Infect. Control. 2017, 6, 58. [Google Scholar] [CrossRef] [Green Version]
  26. Imwattana, K.; Putsathit, P.; Leepattarakit, T.; Kiratisin, P.; Riley, T.V. Mild or Malign: Clinical Characteristics and Outcomes of Clostridium difficile Infection in Thailand. J. Clin. Microbiol. 2020, 58. [Google Scholar] [CrossRef] [PubMed]
  27. Shen, A. Clostridium difficile toxins: Mediators of inflammation. J. Innate Immun. 2012, 4, 149–158. [Google Scholar] [CrossRef] [Green Version]
  28. Åkerlund, T.; Persson, I.; Unemo, M.; Norén, T.; Svenungsson, B.; Wullt, M.; Burman, L.G. Increased Sporulation Rate of Epidemic Clostridium difficile Type 027/NAP1. J. Clin. Microbiol. 2008, 46, 1530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Chow, V.C.Y.; Kwong, T.N.Y.; So, E.W.M.; Ho, Y.I.I.; Wong, S.H.; Lai, R.W.M.; Chan, R.C.Y. Surveillance of antibiotic resistance among common Clostridium difficile ribotypes in Hong Kong. Sci. Rep. 2017, 7, 17218. [Google Scholar] [CrossRef]
  30. O’Connor, J.R.; Galang, M.A.; Sambol, S.P.; Hecht, D.W.; Vedantam, G.; Gerding, D.N.; Johnson, S. Rifampin and rifaximin resistance in clinical isolates of Clostridium difficile. Antimicrob. Agents Chemother. 2008, 52, 2813–2817. [Google Scholar] [CrossRef] [Green Version]
  31. Robinson, C.D.; Auchtung, J.M.; Collins, J.; Britton, R.A. Epidemic Clostridium difficile strains demonstrate increased competitive fitness compared to nonepidemic isolates. Infect. Immun. 2014, 82, 2815–2825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Freeman, J.; Bauer, M.P.; Baines, S.D.; Corver, J.; Fawley, W.N.; Goorhuis, B.; Kuijper, E.J.; Wilcox, M.H. The changing epidemiology of Clostridium difficile infections. Clin. Microbiol. Rev. 2010, 23, 529–549. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Martinez-Melendez, A.; Morfin-Otero, R.; Villarreal-Trevino, L.; Baines, S.D.; Camacho-Ortiz, A.; Garza-Gonzalez, E. Molecular epidemiology of predominant and emerging Clostridioides difficile ribotypes. J. Microbiol. Methods 2020, 175, 105974. [Google Scholar] [CrossRef] [PubMed]
  34. Schumann, P.; Pukall, R. The discriminatory power of ribotyping as automatable technique for differentiation of bacteria. Syst. Appl. Microbiol. 2013, 36, 369–375. [Google Scholar] [CrossRef]
  35. Wultanska, D.; Pituch, H.; Obuch-Woszczatynski, P.; Meisel-Mikolajczyk, F.; Luczak, M. Profile of toxigenicity of Clostridium difficile strains isolated from paediatric patients with clinical diagnosis of antibiotic associated diarrhea (AAD). Med. Dosw. Mikrobiol. 2005, 57, 377–382. [Google Scholar] [PubMed]
  36. Deniz, U.; Ulger, N.; Aksu, B.; Karavus, M.; Soyletir, G. Investigation of toxin genes of Clostridium difficile strains isolated from hospitalized patients with diarrhoea at Marmara University Hospital. Mikrobiyol. Bul. 2011, 45, 1–10. [Google Scholar]
  37. Aliramezani, A.; Talebi, M.; Baghani, A.; Hajabdolbaghi, M.; Salehi, M.; Abdollahi, A.; Afhami, S.; Marjani, M.; Golbabaei, F.; Boroumand, M.A.; et al. Pathogenicity locus determinants and toxinotyping of Clostridioides difficile isolates recovered from Iranian patients. New Microbes New Infect. 2018, 25, 52–57. [Google Scholar] [CrossRef] [PubMed]
  38. Persson, S.; Torpdahl, M.; Olsen, K.E. New multiplex PCR method for the detection of Clostridium difficile toxin A (tcdA) and toxin B (tcdB) and the binary toxin (cdtA/cdtB) genes applied to a Danish strain collection. Clin. Microbiol. Infect. 2008, 14, 1057–1064. [Google Scholar] [CrossRef] [Green Version]
  39. Chankhamhaengdecha, S.; Hadpanus, P.; Aroonnual, A.; Ngamwongsatit, P.; Chotiprasitsakul, D.; Chongtrakool, P.; Janvilisri, T. Evaluation of multiplex PCR with enhanced spore germination for detection of Clostridium difficile from stool samples of the hospitalized patients. BioMed Res. Int. 2013, 2013, 875437. [Google Scholar] [CrossRef] [Green Version]
  40. Chotiprasitsakul, D.; Janvilisri, T.; Kiertiburanakul, S.; Watcharananun, S.; Chankhamhaengdecha, S.; Hadpanus, P.; Malathum, K. A superior test for diagnosis of Clostridium difficile-associated diarrhea in resource-limited settings. Jpn. J. Infect. Dis. 2012, 65, 326–329. [Google Scholar] [CrossRef] [Green Version]
  41. Eckert, C.; Emirian, A.; Le Monnier, A.; Cathala, L.; De Montclos, H.; Goret, J.; Berger, P.; Petit, A.; De Chevigny, A.; Jean-Pierre, H.; et al. Prevalence and pathogenicity of binary toxin-positive Clostridium difficile strains that do not produce toxins A and B. New Microbes New Infect. 2015, 3, 12–17. [Google Scholar] [CrossRef] [Green Version]
  42. McGovern, A.M.; Androga, G.O.; Knight, D.R.; Watson, M.W.; Elliott, B.; Foster, N.F.; Chang, B.J.; Riley, T.V. Prevalence of binary toxin positive Clostridium difficile in diarrhoeal humans in the absence of epidemic ribotype 027. PLoS ONE 2017, 12, e0187658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Xu, X.; Godoy-Ruiz, R.; Adipietro, K.A.; Peralta, C.; Ben-Hail, D.; Varney, K.M.; Cook, M.E.; Roth, B.M.; Wilder, P.T.; Cleveland, T.; et al. Structure of the cell-binding component of the Clostridium difficile binary toxin reveals a di-heptamer macromolecular assembly. Proc. Natl. Acad. Sci. USA 2020, 117, 1049–1058. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Aktories, K.; Papatheodorou, P.; Schwan, C. Binary Clostridium difficile toxin (CDT)–A virulence factor disturbing the cytoskeleton. Anaerobe 2018, 53, 21–29. [Google Scholar] [CrossRef]
  45. Stubbs, S.L.; Brazier, J.S.; O’Neill, G.L.; Duerden, B.I. PCR targeted to the 16S-23S rRNA gene intergenic spacer region of Clostridium difficile and construction of a library consisting of 116 different PCR ribotypes. J. Clin. Microbiol. 1999, 37, 461–463. [Google Scholar] [CrossRef] [Green Version]
  46. Gurtler, V. Typing of Clostridium difficile strains by PCR-amplification of variable length 16S-23S rDNA spacer regions. J. Gen. Microbiol. 1993, 139, 3089–3097. [Google Scholar] [CrossRef] [Green Version]
  47. Indra, A.; Schmid, D.; Huhulescu, S.; Hell, M.; Gattringer, R.; Hasenberger, P.; Fiedler, A.; Wewalka, G.; Allerberger, F. Characterization of clinical Clostridium difficile isolates by PCR ribotyping and detection of toxin genes in Austria, 2006-2007. J. Med. Microbiol. 2008, 57, 702–708. [Google Scholar] [CrossRef]
  48. Hung, Y.P.; Huang, I.H.; Lin, H.J.; Tsai, B.Y.; Liu, H.C.; Liu, H.C.; Lee, J.C.; Wu, Y.H.; Tsai, P.J.; Ko, W.C. Predominance of Clostridium difficile Ribotypes 017 and 078 among Toxigenic Clinical Isolates in Southern Taiwan. PLoS ONE 2016, 11, e0166159. [Google Scholar] [CrossRef] [Green Version]
  49. Killgore, G.; Thompson, A.; Johnson, S.; Brazier, J.; Kuijper, E.; Pepin, J.; Frost, E.H.; Savelkoul, P.; Nicholson, B.; van den Berg, R.J.; et al. Comparison of seven techniques for typing international epidemic strains of Clostridium difficile: Restriction endonuclease analysis, pulsed-field gel electrophoresis, PCR-ribotyping, multilocus sequence typing, multilocus variable-number tandem-repeat analysis, amplified fragment length polymorphism, and surface layer protein A gene sequence typing. J. Clin. Microbiol. 2008, 46, 431–437. [Google Scholar] [CrossRef] [Green Version]
  50. Tanner, H.E.; Hardy, K.J.; Hawkey, P.M. Coexistence of multiple multilocus variable-number tandem-repeat analysis subtypes of Clostridium difficile PCR ribotype 027 strains within fecal specimens. J. Clin. Microbiol. 2010, 48, 985–987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Gonzales-Luna, A.J.; Carlson, T.J.; Dotson, K.M.; Poblete, K.; Costa, G.; Miranda, J.; Lancaster, C.; Walk, S.T.; Tupy, S.; Begum, K.; et al. PCR ribotypes of Clostridioides difficile across Texas from 2011 to 2018 including emergence of ribotype 255. Emerg. Microbes Infect. 2020, 9, 341–347. [Google Scholar] [CrossRef] [Green Version]
  52. Tenover, F.C.; Akerlund, T.; Gerding, D.N.; Goering, R.V.; Bostrom, T.; Jonsson, A.M.; Wong, E.; Wortman, A.T.; Persing, D.H. Comparison of strain typing results for Clostridium difficile isolates from North America. J. Clin. Microbiol. 2011, 49, 1831–1837. [Google Scholar] [CrossRef] [Green Version]
  53. Elliott, B.; Androga, G.O.; Knight, D.R.; Riley, T.V. Clostridium difficile infection: Evolution, phylogeny and molecular epidemiology. Infect. Genet. Evol. 2017, 49, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Drudy, D.; Fanning, S.; Kyne, L. Toxin A-negative, toxin B-positive Clostridium difficile. Int. J. Infect. Dis. 2007, 11, 5–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Shin, B.M.; Kuak, E.Y.; Yoo, S.J.; Shin, W.C.; Yoo, H.M. Emerging toxin A-B+ variant strain of Clostridium difficile responsible for pseudomembranous colitis at a tertiary care hospital in Korea. Diagn. Microbiol. Infect. Dis. 2008, 60, 333–337. [Google Scholar] [CrossRef] [PubMed]
  56. Ling, Z.; Liu, X.; Jia, X.; Cheng, Y.; Luo, Y.; Yuan, L.; Wang, Y.; Zhao, C.; Guo, S.; Li, L.; et al. Impacts of infection with different toxigenic Clostridium difficile strains on faecal microbiota in children. Sci. Rep. 2014, 4, 7485. [Google Scholar] [CrossRef] [Green Version]
  57. Fatima, R.; Aziz, M. The Hypervirulent Strain of Clostridium Difficile: NAP1/B1/027–A Brief Overview. Cureus 2019, 11, e3977. [Google Scholar] [CrossRef] [Green Version]
  58. Merrigan, M.; Venugopal, A.; Mallozzi, M.; Roxas, B.; Viswanathan, V.K.; Johnson, S.; Gerding, D.N.; Vedantam, G. Human hypervirulent Clostridium difficile strains exhibit increased sporulation as well as robust toxin production. J. Bacteriol. 2010, 192, 4904–4911. [Google Scholar] [CrossRef] [Green Version]
  59. Warny, M.; Pepin, J.; Fang, A.; Killgore, G.; Thompson, A.; Brazier, J.; Frost, E.; McDonald, L.C. Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe. Lancet 2005, 366, 1079–1084. [Google Scholar] [CrossRef]
  60. Lyon, S.A.; Hutton, M.L.; Rood, J.I.; Cheung, J.K.; Lyras, D. CdtR Regulates TcdA and TcdB Production in Clostridium difficile. PLoS Pathog. 2016, 12, e1005758. [Google Scholar] [CrossRef] [Green Version]
  61. Buchler, A.C.; Rampini, S.K.; Stelling, S.; Ledergerber, B.; Peter, S.; Schweiger, A.; Ruef, C.; Zbinden, R.; Speck, R.F. Antibiotic susceptibility of Clostridium difficile is similar worldwide over two decades despite widespread use of broad-spectrum antibiotics: An analysis done at the University Hospital of Zurich. BMC Infect. Dis. 2014, 14, 607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Knight, D.R.; Giglio, S.; Huntington, P.G.; Korman, T.M.; Kotsanas, D.; Moore, C.V.; Paterson, D.L.; Prendergast, L.; Huber, C.A.; Robson, J.; et al. Surveillance for antimicrobial resistance in Australian isolates of Clostridium difficile, 2013–2014. J. Antimicrob. Chemother. 2015, 70, 2992–2999. [Google Scholar] [CrossRef] [Green Version]
  63. Kim, Y.J.; Park, K.H.; Park, D.A.; Park, J.; Bang, B.W.; Lee, S.S.; Lee, E.J.; Lee, H.J.; Hong, S.K.; Kim, Y.R. Guideline for the Antibiotic Use in Acute Gastroenteritis. Infect. Chemother. 2019, 51, 217–243. [Google Scholar] [CrossRef] [PubMed]
  64. Riddle, M.S.; DuPont, H.L.; Connor, B.A. ACG Clinical Guideline: Diagnosis, Treatment, and Prevention of Acute Diarrheal Infections in Adults. Am. J. Gastroenterol. 2016, 111, 602–622. [Google Scholar] [CrossRef]
  65. Spigaglia, P. Recent advances in the understanding of antibiotic resistance in Clostridium difficile infection. Ther. Adv. Infect. Dis. 2016, 3, 23–42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Leffler, D.A.; Lamont, J.T. Clostridium difficile infection. N. Engl. J. Med. 2015, 372, 1539–1548. [Google Scholar] [CrossRef] [Green Version]
  67. Slimings, C.; Riley, T.V. Antibiotics and hospital-acquired Clostridium difficile infection: Update of systematic review and meta-analysis. J. Antimicrob. Chemother. 2014, 69, 881–891. [Google Scholar] [CrossRef] [PubMed]
  68. Johanesen, P.A.; Mackin, K.E.; Hutton, M.L.; Awad, M.M.; Larcombe, S.; Amy, J.M.; Lyras, D. Disruption of the Gut Microbiome: Clostridium difficile Infection and the Threat of Antibiotic Resistance. Genes 2015, 6, 1347–1360. [Google Scholar] [CrossRef]
  69. Freeman, J.; Vernon, J.; Morris, K.; Nicholson, S.; Todhunter, S.; Longshaw, C.; Wilcox, M.H.; Pan-European Longitudinal Surveillance of Antibiotic Resistance among Prevalent Clostridium difficile Ribotypes’ Study, G. Pan-European longitudinal surveillance of antibiotic resistance among prevalent Clostridium difficile ribotypes. Clin. Microbiol. Infect. 2015, 21, 248.e9–248.e16. [Google Scholar] [CrossRef] [Green Version]
  70. Kim, J.; Kang, J.O.; Pai, H.; Choi, T.Y. Association between PCR ribotypes and antimicrobial susceptibility among Clostridium difficile isolates from healthcare-associated infections in South Korea. Int. J. Antimicrob. Agents 2012, 40, 24–29. [Google Scholar] [CrossRef]
  71. Obuch-Woszczatynski, P.; Dubiel, G.; Harmanus, C.; Kuijper, E.; Duda, U.; Wultanska, D.; van Belkum, A.; Pituch, H. Emergence of Clostridium difficile infection in tuberculosis patients due to a highly rifampicin-resistant PCR ribotype 046 clone in Poland. Eur. J. Clin. Microbiol. Infect. Dis. 2013, 32, 1027–1030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Kato, H.; Kato, N.; Katow, S.; Maegawa, T.; Nakamura, S.; Lyerly, D.M. Deletions in the repeating sequences of the toxin A gene of toxin A-negative, toxin B-positive Clostridium difficile strains. FEMS Microbiol. Lett. 1999, 175, 197–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Bidet, P.; Barbut, F.; Lalande, V.; Burghoffer, B.; Petit, J.C. Development of a new PCR-ribotyping method for Clostridium difficile based on ribosomal RNA gene sequencing. FEMS Microbiol. Lett. 1999, 175, 261–266. [Google Scholar] [CrossRef] [PubMed]
Antibiotics 10 00714 g001 550
Figure 1. Toxin gene analysis of C. difficile isolates. The distribution of toxin profiles in C. difficile isolates from (A) THA group, which contained C. difficile isolates collected from 2006 to 2009 (n = 50) and (B) THB group, which contained C. difficile isolates collected from 2010 to 2012 (n = 26). Toxin profiles were characterized based on the presence of toxin genes and the deletion of tcdA 3′-end. A, B, and CDT represent tcdA, tcdB, and cdtAB.
Figure 1. Toxin gene analysis of C. difficile isolates. The distribution of toxin profiles in C. difficile isolates from (A) THA group, which contained C. difficile isolates collected from 2006 to 2009 (n = 50) and (B) THB group, which contained C. difficile isolates collected from 2010 to 2012 (n = 26). Toxin profiles were characterized based on the presence of toxin genes and the deletion of tcdA 3′-end. A, B, and CDT represent tcdA, tcdB, and cdtAB.
Antibiotics 10 00714 g001
Antibiotics 10 00714 g002 550
Figure 2. Ribotypes of C. difficile isolates using PCR ribotyping method. (A) The distribution of ribotypes among C. difficile isolates in the THA group (n = 50). (B) The distribution of ribotypes among C. difficile isolates in the THB group (n = 26). PCR ribotyping was performed on 16S and 23S rRNA genes. Ribotypes were assigned based on the band patterns of gel electrophoresis. RT017 and RT020 represent the standard C. difficile ribotypes. NT and NN represent new ribotype patterns of C. difficile toxigenic and non-toxigenic isolates, respectively.
Figure 2. Ribotypes of C. difficile isolates using PCR ribotyping method. (A) The distribution of ribotypes among C. difficile isolates in the THA group (n = 50). (B) The distribution of ribotypes among C. difficile isolates in the THB group (n = 26). PCR ribotyping was performed on 16S and 23S rRNA genes. Ribotypes were assigned based on the band patterns of gel electrophoresis. RT017 and RT020 represent the standard C. difficile ribotypes. NT and NN represent new ribotype patterns of C. difficile toxigenic and non-toxigenic isolates, respectively.
Antibiotics 10 00714 g002
Antibiotics 10 00714 g003 550
Figure 3. The relative level of toxin A and B production of C. difficile isolates. Toxigenic C. difficile isolates in the THA group; B+ (n = 27) and the THB group; A+ (n = 8) and B+ (n = 20) were subjected to indirect ELISA. (A) The light blue bars represent toxin A, and (B) the dark blue bars represent toxin B. The graph shows average values of 3 independent samples in the experiments. Error bars refer to mean ± SEM, p < 0.05, *, and p < 0.01, **.
Figure 3. The relative level of toxin A and B production of C. difficile isolates. Toxigenic C. difficile isolates in the THA group; B+ (n = 27) and the THB group; A+ (n = 8) and B+ (n = 20) were subjected to indirect ELISA. (A) The light blue bars represent toxin A, and (B) the dark blue bars represent toxin B. The graph shows average values of 3 independent samples in the experiments. Error bars refer to mean ± SEM, p < 0.05, *, and p < 0.01, **.
Antibiotics 10 00714 g003
Antibiotics 10 00714 g004 550
Figure 4. The MIC values of C. difficile isolates in Thailand. Eight antibiotics were used to investigate MIC values of C. difficile isolates in THA group (n = 50) and THB group (n = 26) using broth dilution method. The colors represent different MIC values.
Figure 4. The MIC values of C. difficile isolates in Thailand. Eight antibiotics were used to investigate MIC values of C. difficile isolates in THA group (n = 50) and THB group (n = 26) using broth dilution method. The colors represent different MIC values.
Antibiotics 10 00714 g004
Table
Table 1. Summary of toxin gene profiles and ribotyping profiles of 76 C. difficile isolates in Thailand.
Table 1. Summary of toxin gene profiles and ribotyping profiles of 76 C. difficile isolates in Thailand.
Toxigenic ProfileNo. of IsolatesNo. of Isolates of
THA
(n = 50)		THB
(n = 26)		RT017RT020NN01NN02NN03NN04NN05NN06NN07NT01NT02NT03NT04NT05NT06NT07NT08NT09NT10NT11
A+B+CDT+ 6 1 1 2 11
A+B+CDT- 2 2
A-B+CDT+ 51 1 1 1 1
A-B+CDT-27720 91 1 3
A-B-CDT-236 31116314
Table
Table 2. Antibiotic susceptibility patterns of C. difficile isolates in Thailand.
Table 2. Antibiotic susceptibility patterns of C. difficile isolates in Thailand.
AntibioticsMIC Range (µg/mL)MIC50 (µg/mL)MIC90 (µg/mL)Breakpoints (µg/mL)Susceptible (%)Intermediate (%)Resistant (%)
THA (n = 50)THB (n = 26)THATHBTHATHBS/I/RTHATHBTHATHBTHATHB
Amoxicillin≤0.125-32≤0.125-0.50.5≤0.12520.5≤4/8/≥ 16
≤2/4/≥ 8		961002020
Ampicillin0.25-160.25-42242≤0.5/1/≥ 2921004040
Cefoxitin4-2564-256256256256256≤16/32/≥ 6427.69009892.31
Chloramphenicol32- ≥ 6416- ≥ 64≥64≥64≥64≥64≤8/16/≥ 320003.8510096.15
Levofloxacin2- ≥ 321- ≥ 3288≥32≥32-/-/≥8 a----5611.54
Metronidazole0.25-160.25- ≥ 161142≤8/16/≥ 329696.1543.8500
Rifampicin≤0.125- ≥ 32≤0.125- ≥ 32≤0.125≤0.125≥32≥32≤0.06/0.012-16/≥ 32 b007492.31267.69
Vancomycin1-80.5-42144≤2/-/> 2 c8888.46--1211.54
* Clinical breakpoints determining the susceptibility categories: S; susceptible, I; intermediate, and R; resistance. All breakpoints were recommended by CLSI, except a breakpoint for levofloxacin by published data [29], b breakpoint for rifampicin by published data [30], and c breakpoint for vancomycin by EUCAST.
Table
Table 3. Sequences of primers for amplifying toxin genes of C. difficile and amplicon size.
Table 3. Sequences of primers for amplifying toxin genes of C. difficile and amplicon size.
AnalysisTarget GenePrimer NameSequence (5′-3′)Amplicon Size (bp)
Multiplex PCRtcdAtcdA-FGTATGGATAGGTGGAGAAGTCAGTG632
tcdA-RCGGTCTAGTCCAATAGAGCTAGGTC
tcdBtcdB-FGAAGATTTAGGAAATGAAGAAGGTGA441
tcdB-RAACCACTATATTCAACTGCTTGTCC
cdtAcdtA-FATGCACAAGACTTACAAAGCTATAGTG260
cdtA-RCGAGAATTTGCTTCTATTTGATAATC
cdtBcdtB-FATTGGCAATAATCTATCTCCTGGA179
cdtB-RCTTGTTCTGGTACCAAATAATCCG
16S rRNAUFU-LGCCTAACACATGCAAGTCGA800
802-RTACCAGGGTATCTAATCC
tcdA 3′-end deletiontcdANK9CCACCAGCTGCAGCCATA2535
NKV011TTTTGATCCTATAGAATYTAACTTAGTAAC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wongkuna, S.; Janvilisri, T.; Phanchana, M.; Harnvoravongchai, P.; Aroonnual, A.; Aimjongjun, S.; Malaisri, N.; Chankhamhaengdecha, S. Temporal Variations in Patterns of Clostridioides difficile Strain Diversity and Antibiotic Resistance in Thailand. Antibiotics 2021, 10, 714. https://doi.org/10.3390/antibiotics10060714

AMA Style

Wongkuna S, Janvilisri T, Phanchana M, Harnvoravongchai P, Aroonnual A, Aimjongjun S, Malaisri N, Chankhamhaengdecha S. Temporal Variations in Patterns of Clostridioides difficile Strain Diversity and Antibiotic Resistance in Thailand. Antibiotics. 2021; 10(6):714. https://doi.org/10.3390/antibiotics10060714

Chicago/Turabian Style

Wongkuna, Supapit, Tavan Janvilisri, Matthew Phanchana, Phurt Harnvoravongchai, Amornrat Aroonnual, Sathid Aimjongjun, Natamon Malaisri, and Surang Chankhamhaengdecha. 2021. "Temporal Variations in Patterns of Clostridioides difficile Strain Diversity and Antibiotic Resistance in Thailand" Antibiotics 10, no. 6: 714. https://doi.org/10.3390/antibiotics10060714

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop