Multidrug-Resistant, Including Extended-Spectrum Beta Lactamase-Producing and Quinolone-Resistant, Escherichia coli Isolated from Poultry and Domestic Pigs in Dar es Salaam, Tanzania
Abstract
1. Introduction
2. Results
2.1. Detection of Enterobacteriaceae Isolates, Prevalence of Resistance, and Comparative Analysis of Antibiotic-Resistant Profiles from Poultry and Domestic Pig Samples
2.2. Multidrug Resistance of E. coli Isolates in Cloacal and Rectal Swabs from Poultry and Domestic Pigs
2.3. ESBL-Producing E. coli Isolated from the Cloacal and Rectal Swabs from Poultry and Domestic Pigs
2.4. Quinolone-Resistant E. coli in Cloacal and Rectal Swabs from Poultry and Domestic Pigs
2.5. Genotypic Identification of ESBL Resistant Genes (CTX-M, TEM, SHV) and Quinolone-Resistant Genes (qnrA, qnrB, qnrS, qnrC, qnrD, aac(6′)-lb-cr, and qepA)
3. Discussion
4. Methodology
4.1. Selection of Study Farms and Animals
4.2. Sample Collection
4.3. Isolation of Bacteria
4.4. Antibiotic Susceptibility Testing
4.5. Screening for ESBL
4.6. Polymerase Chain Reaction (PCR)
4.6.1. DNA Extraction
4.6.2. Molecular Detection of CTX-M Genes
4.6.3. Detection of TEM and SHV Genes
4.6.4. Detection of Quinolone-Resistant Genes (qnrA, qnrB, and qnrS)
4.6.5. Detection of aac(6′)-lb-cr Gene
4.6.6. Detection of PMQR Genes (qepA, qnrC, and qnrD)
4.7. Ethical Considerations
4.8. Data Management
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Prestinaci, F.; Pezzotti, P.; Pantosti, A. Antimicrobial resistance: A global multifaceted phenomenon. Pathog. Glob. Health 2015, 109, 309–318. [Google Scholar] [CrossRef] [PubMed]
- de Kraker, M.E.A.; Stewardson, A.J.; Harbarth, S. Will 10 Million People Die a Year due to Antimicrobial Resistance by 2050? PLoS Med. 2016, 13, e1002184. [Google Scholar] [CrossRef]
- O’Neill, J. Tackling Drug-Resistant Infections Globally: Final Report and Recommendations; AMR Review: London, UK, 2016; p. 84. Available online: https://amr-review.org (accessed on 9 January 2018).
- Casertano, M.; Menna, M.; Imperatore, C. The ascidian-derived metabolites with antimicrobial properties. Antibiotics 2020, 9, 510. [Google Scholar] [CrossRef]
- Bandyopadhyay, S.; Samanta, I. Antimicrobial Resistance in Agri-Food Chain and Companion Animals as a Re-emerging Menace in Post-COVID Epoch: Low-and Middle-Income Countries Perspective and Mitigation Strategies. Front. Vet. Sci. 2020, 7, 620. [Google Scholar] [CrossRef]
- Van Boeckel, T.P.; Gandra, S.; Ashok, A.; Caudron, Q.; Grenfell, B.T.; Levin, S.A.; Laxminarayan, R. Global antibiotic consumption 2000 to 2010: An analysis of national pharmaceutical sales data. Lancet. Infect. Dis. 2014, 14, 742–750. [Google Scholar] [CrossRef]
- Gelband, H. The State of the World’s Antibiotics 2015; Center for Disease Dynamics, Economics & Policy: Washington, DC, USA, 2015. [Google Scholar]
- Tiseo, K.; Huber, L.; Gilbert, M.; Robinson, T.P.; Van Boeckel, T.P. Global trends in antimicrobial use in food animals from 2017 to 2030. Antibiotics 2020, 9, 918. [Google Scholar] [CrossRef]
- Van Boeckel, T.P.; Glennon, E.E.; Chen, D.; Gilbert, M.; Robinson, T.P.; Grenfell, B.T.; Bonhoeffer, S.; Laxminarayanm, R. Reducing antimicrobial use in food animals. Science 2017, 357, 1350–1352. [Google Scholar] [CrossRef] [PubMed]
- Tanwar, J.; Das, S.; Fatima, Z.; Hameed, S. Multidrug resistance: An emerging crisis. Interdiscip. Perspect. Infect. Dis. 2014, 2014, 541340. [Google Scholar] [CrossRef]
- Basak, S.; Singh, P.; Rajurkar, M. Multidrug Resistant and Extensively Drug Resistant Bacteria: A Study. J. Pathog. 2016, 2016, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Bernabé, K.J.; Langendorf, C.; Ford, N.; Ronat, J.B.; Murphy, R.A. Antimicrobial resistance in West Africa: A systematic review and meta-analysis. Int. J. Antimicrob. Agents. 2017, 50, 629–639. [Google Scholar] [CrossRef]
- Blomberg, B.; Manji, K.P.; Urass, W.K.; Tamim, B.S.; Mwakagile, D.S.; Jureen, R.; Msangi, V.; Tellevik, M.G.; Holberg-Petersen, M.; Harthug, S.; et al. Antimicrobial resistance predicts death in Tanzanian children with bloodstream infections: A prospective cohort study. BMC Infect. Dis. 2007, 7, 43. [Google Scholar] [CrossRef]
- Kayange, N.; Kamugisha, E.; Mwizamholya, D.L.; Jeremiah, S.; Mshana, S.E. Predictors of positive blood culture and deaths among neonates with suspected neonatal sepsis in a tertiary hospital, Mwanza- Tanzania. BMC Pediatr. 2010, 10, 39. [Google Scholar] [CrossRef]
- Manyahi, J.; Kibwana, U.; Mgimba, E.; Majigo, M. Multi-drug resistant bacteria predict mortality in bloodstream infection in a tertiary setting in Tanzania. PLoS ONE 2020, 15, e0220424. [Google Scholar] [CrossRef]
- Horumpende, P.G.; Said, S.H.; Mazuguni, F.S.; Antony, M.L.; Kumburu, H.H.; Sonda, T.B.; Mwanziva, C.E.; Mshana, S.E.; Mmbaga, B.T.; Kajeguka, D.C.; et al. Prevalence, determinants and knowledge of antibacterial self-medication: A cross sectional study in North-eastern Tanzania. PLoS ONE 2018, 13, e0206623. [Google Scholar] [CrossRef]
- Ngocho, J.S.; Horumpende, P.G.; de Jonge, M.I.; Mmbaga, B.T. Inappropriate treatment of community-acquired pneumonia among children under five years of age in Tanzania. Int. J. Infect. Dis. 2020, 93, 56–61. [Google Scholar] [CrossRef]
- Horumpende, P.G.; Sonda, T.B.; van Zwetselaar, M.; Antony, M.L.; Tenu, F.F.; Mwanziva, C.E.; Shao, E.R.; Mshana, S.E.; Mmbaga, B.T.; Chilongola, J.O. Prescription and non-prescription antibiotic dispensing practices in part I and part II pharmacies in Moshi Municipality, Kilimanjaro Region in Tanzania: A simulated clients approach. PLoS ONE 2018, 13, e0207465. [Google Scholar] [CrossRef]
- Kimera, Z.I.; Mshana, S.E.; Rweyemamu, M.M.; Mboera, L.E.G.; Matee, M.I.N. Antimicrobial use and resistance in food-producing animals and the environment: An African perspective. Antimicrob. Resist. Infect. Control. 2020, 9, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Bengtsson, B.; Greko, C. Antibiotic resistance-consequences for animal health, welfare, and food production. Ups. J. Med. Sci. 2014, 119, 96–102. [Google Scholar] [CrossRef]
- Michael, S.; Mbwambo, N.; Mruttu, H.; Dotto, M.; Ndomba, C.; da Silva, M.; Makusaro, F.; Nandonde, S.; Crispin, J.; Shapiro, B.; et al. Tanzania Livestock Master Plan. 2018. Available online: https://cgspace.cgiar.org/bitstream/handle/10568/92405/livestockMasterPlan.Tanzania.pdf?sequence=1 (accessed on 23 October 2019).
- Wilson, R.T.; Swai, E.S. Pig Production in Tanzania: A Critical Review. Tropicultura 2014, 32, 46–53. [Google Scholar]
- Rugumisa, B.T.; Call, D.R.; Mwanyika, G.O.; Mrutu, R.I.; Luanda, C.M.; Lyimo, B.M.; Subbiah, M.; Buza, J.J. Prevalence of Antibiotic-Resistant Fecal Escherichia coli Isolates from Penned Broiler and Scavenging Local Chickens in Arusha, Tanzania. J. Food Prot. 2016, 79, 1424–1429. [Google Scholar] [CrossRef] [PubMed]
- Kimera, Z.I.; Frumence, G.; Mboera, L.E.G.; Rweyemamu, M.M.; Mshana, S.E.; Matee, M.I.N. Assessment of drivers of antimicrobial use and resistance in pig and poultry farming in the Msimbazi River Basin in Tanzania. Antibiotics 2020, 9, 838. [Google Scholar] [CrossRef]
- Nonga, H.E.; Mariki, M.; Karimuribo, E.D. Antimicrobial Usage and Residue in Morogoro. Pak. J. Nutr. 2009, 8, 203–207. [Google Scholar] [CrossRef]
- Caudell, M.A.; Quinlan, M.B.; Subbiah, M.; Call, D.R.; Roulette, C.J.; Roulette, J.W.; Roth, A.; Matthews, L.; Quinlan, R.J. Antimicrobial use and veterinary care among agro-pastoralists in Northern Tanzania. PLoS ONE 2017, 12, e0170328. [Google Scholar] [CrossRef]
- Afema, J.A.; Byarugaba, D.K.; Shah, D.H.; Atukwase, E.; Nambi, M.; Sischo, W.M. Potential sources and transmission of Salmonella and antimicrobial resistance in Kampala, Uganda. PLoS ONE 2016, 11, e0152130. [Google Scholar] [CrossRef] [PubMed]
- Hamisi, Z.; Tuntufye, H.; Shahada, F. Antimicrobial resistance phenotypes of Escherichia coli isolated from tropical free range chickens. Int. J. Sci. Res. 2014, 3, 34–37. [Google Scholar]
- Mwambete, K.D.; Stephen, W.S. Antimicrobial resistance profiles of bacteria isolated from chicken droppings in Dar es Salaam. Int. J. Pharm. Pharm. Sci. 2015, 7, 268–271. [Google Scholar]
- Shah, S.Q.A.; Colquhoun, D.J.; Nikuli, H.L.; Sørum, H. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania. Environ. Sci. Technol. 2012, 46, 8672–8679. [Google Scholar] [CrossRef] [PubMed]
- Katakweba, A.; Espinosa-gongora, C. Spa typing and antimicrobial resistance of Staphylococcus aureus from healthy humans, pigs and dogs in Tanzania. J. Infect. Dev. Ctries. 2016, 10, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Muloi, D.; Ward, M.J.; Pedersen, A.B.; Fèvre, E.M.; Woolhouse, M.E.J.; Van Bunnik, B.A.D. Are Food Animals Responsible for Transfer of Antimicrobial-Resistant Escherichia coli or Their Resistance Determinants to Human Populations? A Systematic Review. Foodborne Pathog Dis. 2018, 15, 467–474. [Google Scholar] [CrossRef]
- Robinson, T.P.; Bu, D.P.; Carrique-Mas, J.; Fèvre, E.M.; Gilbert, M.; Grace, D.; Hay, S.E.; Jiwakanonh, J.; Kakkari, M.; Kariuki, S.; et al. Antibiotic resistance is the quintessential One Health issue. Trans. R. Soc. Trop. Med. Hyg. 2016, 110, 377–380. [Google Scholar] [CrossRef]
- Seni, J.; Falgenhauer, L.; Simeo, N.; Mirambo, M.M.; Imirzalioglu, C.; Matee, M.; Rweyemamu, M.; Chakraborty, T.; Mshana, S.E. Multiple ESBL-producing Escherichia coli sequence types carrying quinolone and aminoglycoside resistance genes circulating in companion and domestic farm animals in Mwanza, Tanzania, harbor commonly occurring plasmids. Front. Microbiol. 2016, 7, 142. [Google Scholar] [CrossRef]
- Kayombo, M.C.; Mayo, A.W. Assessment of Microbial Quality of Vegetables Irrigated with Polluted Waters in Dar es Salaam City, Tanzania. Environ. Ecol. Res. 2018, 6, 229–239. [Google Scholar] [CrossRef]
- Mrutu, A.; Nkotagu, H.; Luilo, G. Spatial distribution of heavy metals in Msimbazi River mangrove sediments in Dar es Salaam coastal zone, Tanzania. Int. J. Environ. Sci. 2013, 3, 1641–1655. [Google Scholar]
- Mwegoha, W.J.S.; Leonard, L.S.; Kihampa, C. Heavy metal pollutions and urban agriculture in Msimbazi River valley: Health risk and public awareness. Int. J. Plants Anim. Environ. Stud. 2012, 2, 107–118. [Google Scholar]
- Vitas, A.I.; Naik, D.; Pérez-Etayo, L.; González, D. Increased exposure to extended-spectrum β-lactamase-producing multidrug-resistant Enterobacteriaceae through the consumption of chicken and sushi products. Int. J. Food Microbiol. 2018, 269, 80–86. [Google Scholar] [CrossRef]
- Sindato, C.; Mboera, L.E.G.; Katale, B.Z.; Frumence, G.; Kimera, S.; Clark, T.G.; Legido-Quigley, H.; Mshana, S.E.; Rweyemamu, M.; Matee, M.I. Knowledge, attitudes and practices regarding antimicrobial use and resistance among communities of Ilala, Kilosa and Kibaha districts of Tanzania. Antimicrob. Resist. Infect. Control. 2020, 9, 1–17. [Google Scholar] [CrossRef]
- Dellgren, L.; Claesson, C.; Högdahl, M.; Forsberg, J.; Hanberger, H.; Nilsson, L.E.; Hällgren, A. Phenotypic screening for quinolone resistance in Escherichia coli. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 1765–1771. [Google Scholar] [CrossRef] [PubMed]
- Khumalo, J.; Saidi, B.; Mbanga, J. Evolution of antimicrobial resistance of Salmonella enteritidis (1972–2005). Onderstepoort J. Vet. Res. 2014, 81, 6–11. [Google Scholar] [CrossRef] [PubMed]
- Adenipekun, E.O.; Jackson, C.R.; Oluwadun, A.; Iwalokun, B.A.; Frye, J.G.; Barrett, J.B.; Hiott, L.M.; Woodley, T.A. Prevalence and Antimicrobial Resistance in Escherichia coli from Food Animals in Lagos, Nigeria. Microb. Drug Resist. 2015, 21, 358–365. [Google Scholar] [CrossRef]
- Donkor, E.S.; Newman, M.J.; Yeboah-Manu, D. Epidemiological aspects of non-human antibiotic usage and resistance: Implications for the control of antibiotic resistance in Ghana. Trop. Med. Int. Health 2012, 17, 462–468. [Google Scholar] [CrossRef] [PubMed]
- Yassin, A.K.; Gong, J.; Kelly, P.; Lu, G.; Guardabassi, L.; Wei, L.; Han, X.; Qiu, H.; Price, S.; Cheng, D.; et al. Antimicrobial resistance in clinical Escherichia coli isolates from poultry and livestock, China. PLoS ONE 2017, 12, e0185326. [Google Scholar] [CrossRef]
- Ribeiro, T.G.; Novais, Â.; Peixe, L.; Machado, E. Atypical epidemiology of CTX-M-15 among Enterobacteriaceae from a high diversity of non-clinical niches in Angola. J. Antimicrob. Chemother. 2016, 71, 1169–1173. [Google Scholar] [CrossRef] [PubMed]
- Lupindu, A.M.; Dalsgaard, A.; Msoffe, P.L.M.; Ngowi, H.A.; Mtambo, M.M.; Olsen, J.E. Transmission of antibiotic-resistant Escherichia coli between cattle, humans and the environment in peri-urban livestock keeping communities in Morogoro, Tanzania. Prev. Vet. Med. 2015, 118, 477–482. [Google Scholar] [CrossRef]
- Rasmussen, M.M.; Opintan, J.A.; Frimodt-Møller, N.; Styrishave, B. Beta-lactamase producing Escherichia coli isolates in imported and locally produced chicken meat from Ghana. PLoS ONE 2015, 10, e0139706. [Google Scholar] [CrossRef] [PubMed]
- Ojo, O.E.; Fabusoro, E.; Majasan, A.A.; Dipeolu, M.A. Antimicrobials in animal production: Usage and practices among livestock farmers in Oyo and Kaduna States of Nigeria. Trop. Anim. Health Prod. 2016, 48, 189–197. [Google Scholar] [CrossRef]
- Chishimba, K.; Hang’ombe, B.M.; Muzandu, K.; Mshana, S.E.; Matee, M.I.; Nakajima, C.; Suzuki, Y. Detection of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Market-Ready Chickens in Zambia. Int. J. Microbiol. 2016, 2016, 5275724. [Google Scholar] [CrossRef]
- Alonso, C.A.; Zarazaga, M.; Sallem, R.B.; Jouini, A.; Slama, K.B.; Torres, C. Antibiotic resistance in Escherichia coli in husbandry animals: The African perspective. Lett. Appl. Microbiol. 2017, 64, 318–334. [Google Scholar] [CrossRef]
- Rasool, F.N.; Saavedra, M.A.; Pamba, S.; Perold, V.; Mmochi, A.J.; Maalim, M.; Simonsen, L.; Buur, L.; Pedersen, R.H.; Syberg, K.; et al. Isolation and characterization of human pathogenic multidrug resistant bacteria associated with plastic litter collected in Zanzibar. J. Hazard. Mater. 2021, 405, 124591. [Google Scholar] [CrossRef]
- Katakweba, A.A.; Muhairwa, A.P.; Lupindu, A.M.; Damborg, P.; Rosenkrantz, J.T.; Minga, U.M.; Mtambo, M.M.; Olsen, J.E. First Report on a Randomized Investigation of Antimicrobial Resistance in Fecal Indicator Bacteria from Livestock, Poultry, and Humans in Tanzania. Microb. Drug Resist. 2018, 24, 260–268. [Google Scholar] [CrossRef]
- Bernadether, T.R.; Douglas, R.C.; Gaspary, O.M.; Murugan, S.; Joram, B. Comparison of the prevalence of antibiotic-resistant Escherichia coli isolates from commercial-layer and free-range chickens in Arusha district, Tanzania. Afr. J. Microbiol. Res. 2016, 10, 1422–1429. [Google Scholar] [CrossRef]
- Hlashwayo, D.F.; Sigaúque, B.; Bila, C.G. Epidemiology and antimicrobial resistance of Campylobacter spp. in animals in Sub-Saharan Africa: A systematic review. Heliyon 2020, 6, e03537. [Google Scholar] [CrossRef] [PubMed]
- Boamah, V.E.; Agyare, C.; Odoi, H.; Dalsgaard, A. Antibiotic Practices and Factors Influencing the Use of Antibiotics in Selected Poultry Farms in Ghana. J. Antimicrob. Agents 2016, 2, 2. [Google Scholar]
- Kamini, M.G.; Keutchatang, F.T.; Mafo, H.Y.; Kansci, G.; Nama, G.M. Antimicrobial usage in the chicken farming in yaoundé, Cameroon: A cross-sectional study. Int. J. Food Contam. 2016, 3, 1. [Google Scholar]
- Eltayb, A.; Barakat, S.; Marrone, G.; Shaddad, S.; Sta, C. Antibiotic Use and Resistance in Animal Farming: A Quantitative and Qualitative Study on Knowledge and Practices among Farmers in Khartoum, Sudan. Zoonoses Public Health 2012, 59, 330–338. [Google Scholar] [CrossRef] [PubMed]
- Mainda, G.; Bessell, P.B.; Muma, J.B.; McAteer, S.P.; Chase-Topping, M.E.; Gibbons, J.; Stevens, M.P.; Gally, D.L.; Bronsvoort, B.M.C. Prevalence and patterns of antimicrobial resistance among Escherichia coli isolated from Zambian dairy cattle across different production systems. Sci. Rep. 2015, 5, 12439. [Google Scholar] [CrossRef]
- Van, T.T.H.; Yidana, Z.; Smooker, P.M.; Coloe, P.J. Antibiotic use in food animals worldwide, with a focus on Africa: Pluses and minuses. J. Glob. Antimicrob. Resist. 2020, 20, 170–177. [Google Scholar] [CrossRef]
- Manyi-Loh, C.; Mamphweli, S.; Meyer, E.; Okoh, A. Antibiotic use in agriculture and its consequential resistance in environmental sources: Potential public health implications. Molecules 2018, 23, 795. [Google Scholar] [CrossRef]
- Sahoo, K.C.; Tamhankar, A.J.; Sahoo, S.; Sahu, P.S.; Klintz, S.R.; Lundborg, C.S. Geographical variation in antibiotic-resistant Escherichia coli isolates from stool, cow-dung and drinking water. Int. J. Environ. Res. Public Health 2012, 9, 746–759. [Google Scholar] [CrossRef]
- Ayukekbong, J.A.; Ntemgwa, M.; Atabe, A.N. The threat of antimicrobial resistance in developing countries: Causes and control strategies. Antimicrob. Resist. Infect. Control 2017, 6, 1–8. [Google Scholar] [CrossRef]
- Tufa, T.B.; Gurmu, F.; Beyi, A.F.; Hogeveen, H.; Beyene, T.J.; Ayana, D.; Woldemariyam, F.T.; Hailemariam, E.; Gutema, F.D.; Stegeman, J.A. Veterinary medicinal product usage among food animal producers and its health implications in Central Ethiopia. BMC Vet. Res. 2018, 14, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Montso, K.P.; Dlamini, S.B.; Kumar, A.; Ateba, C.N. Antimicrobial Resistance Factors of Extended-Spectrum Beta-Lactamases Producing Escherichia coli and Klebsiella pneumoniae Isolated from Cattle Farms and Raw Beef in North-West Province, South Africa. Biomed. Res. Int. 2019, 2019, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Founou, L.L.; Founou, R.C.; Ntshobeni, N.; Govinden, U.; Bester, L.A.; Chenia, H.Y.; Djoko, C.F.; Essack, S.Y. Emergence and spread of extended spectrum Beta-lactamase producing enterobacteriaceae (ESBL-PE) in pigs and exposed workers: A multicentre comparative study between Cameroon and South Africa. Pathogens 2019, 8, 10. [Google Scholar] [CrossRef]
- Badri, A.M.; Ibrahim, I.T.; Mohamed, S.G.; Garbi, M.I.; Kabbashi, A.S.; Arbab, M.H. Prevalence of Extended Spectrum Beta Lactamase (ESBL) Producing Escherichia coli and Klebsiella pneumoniae Isolated from Raw Milk Samples in Al Jazirah State, Sudan. Mol. Biol. 2017, 7, 1–4. [Google Scholar] [CrossRef]
- Aworh, M.K.; Kwaga, J.; Okolocha, E.; Mba, N.; Thakur, S. Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria. PLoS ONE 2019, 14, e0225379. [Google Scholar] [CrossRef]
- Falgenhauer, L.; Imirzalioglu, C.; Oppong, K.; Akenten, C.W.; Hogan, B.; Krumkamp, R.; Poppert, S.; Levermann, V.; Schwengers, O.; Sarpong, N.; et al. Detection and characterization of ESBL-producing Escherichia coli from humans and poultry in Ghana. Front. Microbiol. 2019, 9, 3358. [Google Scholar] [CrossRef]
- Fortini, D.; Fashae, K.; Garcia-Fernandez, A.; Villa, L.; Carattoli, A. Plasmid-mediated quinolone resistance and Beta-lactamases in Escherichia coli from healthy animals from Nigeria. J. Antimicrob. Chemother. 2011, 66, 1269–1272. [Google Scholar] [CrossRef] [PubMed]
- Teklu, D.S.; Negeri, A.A.; Legese, M.H.; Bedada, T.L.; Woldemariam, H.K.; Tullu, K.D. Extended-spectrum beta-lactamase production and multi-drug resistance among Enterobacteriaceae isolated in Addis Ababa, Ethiopia. Antimicrob. Resist. Infect. Control 2019, 8, 1–12. [Google Scholar] [CrossRef]
- Sadiq, M.; Syed-Hussain, S.; Ramanoon, S.; Saharee, A.; Ahmad, N.; Zin, N.M.; Khalid, S.; Naseeha, D.; Syahirah, A.; Mansor, R. Knowledge, attitude and perception regarding antimicrobial resistance and usage among ruminant farmers in Selangor, Malaysia. Prev. Vet. Med. 2018, 156, 76–83. [Google Scholar] [CrossRef]
- Bergšpica, I.; Kaprou, G.; Alexa, E.A.; Prieto, M.; Alvarez-Ordóñez, A. Extended spectrum β-lactamase (ESBL) producing Escherichia coli in pigs and pork meat in the European Union. Antibiotics 2020, 9, 678. [Google Scholar] [CrossRef]
- Founou, L.L.; Founou, R.C.; Essack, S.Y. Antibiotic Resistance in the Food Chain: A Developing Country-Perspective. Front. Microbiol. 2016, 7, 1881. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Liu, H.; Wang, L.; Peng, Q.; Li, Y.; Zhou, H.; Li, Q. Molecular characterization of extended-spectrum Beta-lactamase-producing multidrug resistant Escherichia coli from swine in Northwest China. Front. Microbiol. 2018, 9, 1756. [Google Scholar] [CrossRef] [PubMed]
- Zurfluh, K.; Abgottspon, H.; Hächler, H.; Nuësch-Inderbinen, M.; Stephan, R. Quinolone resistance mechanisms among Extended- Spectrum Beta-Lactamase (ESBL) producing Escherichia coli isolated from rivers and lakes in Switzerland. PLoS ONE 2014, 9, e95864. [Google Scholar] [CrossRef]
- Alouache, S.; Estepa, V.; Messai, Y.; Ruiz, E.; Torres, C.; Bakour, R. Characterization of ESBLs and Associated Quinolone Resistance in Escherichia coli and Klebsiella pneumoniae Isolates from an Urban Wastewater Treatment Plant in Algeria. Microb. Drug Resist. 2013, 20, 30–38. [Google Scholar] [CrossRef]
- Salah, F.D.; Soubeiga, S.T.; Ouattara, A.K.; Sadji, A.Y.; Metuor-Dabire, A.; Obiri-Yeboah, D.; Banla-Kere, A.; Karou, S.; Simpore, J. Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo. Antimicrob. Resist. Infect. Control 2019, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Song, H.J.; Moon, D.C.; Mechesso, A.F.; Kang, H.Y.; Kim, M.H.; Choi, J.H.; Kim, S.; Yoon, S.; Lim, S. Resistance profiling and molecular characterization of extended-spectrum/plasmid-mediated Ampc β-lactamase-producing Escherichia coli isolated from healthy broiler chickens in South Korea. Microorganisms 2020, 8, 1434. [Google Scholar] [CrossRef]
- Livermore, D.M. Clinical significance of beta-lactamase induction and stable derepression in gram-negative rods. Eur. J. Clin. Microbiol. 1987, 6, 439–445. [Google Scholar] [CrossRef]
- Liu, P.Y.F.; Gur, D.; Hall, L.M.C.; Livermore, D.M. Survey of the prevalence of β-lactamases amongst 1000 gram-negative bacilli isolated consecutively at the royal london hospital. J. Antimicrob. Chemother. 1992, 30, 429–447. [Google Scholar] [CrossRef]
- Gregova, G.; Kmet, V. Antibiotic resistance and virulence of Escherichia coli strains isolated from animal rendering plant. Sci. Rep. 2020, 10, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.A.; Vlieghe, E.; Mendelson, M.; Wertheim, H.; Ndegwa, L.; Villegas, M.V.; Gould, I.; Hara, G.L. Antibiotic stewardship in low- and middle-income countries: The same but different? Clin. Microbiol. Infect. 2017, 23, 812–818. [Google Scholar] [CrossRef] [PubMed]
- Olowe, O.A.; Adewumi, O.; Odewale, G.; Ojurongbe, O.; Adefioye, O.J. Phenotypic and Molecular Characterisation of Extended-Spectrum Beta-Lactamase Producing Escherichia coli Obtained from Animal Fecal Samples in Ado Ekiti, Nigeria. J. Envrion. Public Health 2015, 2015, 497980. [Google Scholar]
- Clinical and Laboratory Standards Institute—CLSI. Performance Standards for Antimicrobial Susceptibility Testing; CLSI: Wayne, PA, USA, 2019; pp. 1–320. Available online: http://www.emeraldinsight.com/doi/10.1108/08876049410065598 (accessed on 18 May 2020).
- Moffat, J.; Chalmers, G.; Reid-Smith, R.; Mulvey, M.R.; Agunos, A.; Calvert, J.; Cormier, A.; Ricker, N.; Weese, J.S.; Boerlin, P. Resistance to extended-spectrum cephalosporins in Escherichia coli and other Enterobacterales from Canadian turkeys. PLoS ONE 2020, 15, e0236442. [Google Scholar] [CrossRef]
- Hamza, E.; Dorgham, S.M.; Hamza, D.A. Carbapenemase-producing Klebsiella pneumoniae in broiler poultry farming in Egypt. Integr. Med. Res. 2016, 7, 8–10. [Google Scholar] [CrossRef]
- WHO. Integrated Surveilance of Antimicrobial Resistance; Guidance from WHO Advisory Group; WHO: Geneva, Switzerland, 2013; pp. 1–100. Available online: http://apps.who.int/iris/bitstream/10665/91778/1/9789241506311_eng.pdf?ua=1 (accessed on 3 September 2018).
- Magiorakos, A.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An internatiojnal expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Moremi, N.; Manda, E.V.; Falgenhauer, L.; Ghosh, H.; Imirzalioglu, C.; Matee, M.; Chakraborty, T.; Mshana, S.E. Predominance of CTX-M-15 among ESBL producers from environment and fish gut from the shores of Lake Victoria in Mwanza, Tanzania. Front. Microbiol. 2016, 7, 1862. [Google Scholar] [CrossRef] [PubMed]
- Valat, C.; Forest, K.; Billet, M.; Polizzi, C.; Saras, E.; Madec, J.Y.; Haenni, M. Absence of co-localization between pathovar-associated virulence factors and extended-spectrum β-lactamase (blaCTX-M) genes on a single plasmid. Vet. Microbiol. 2016, 192, 163–166. [Google Scholar] [CrossRef]
- Reich, F.; Atanassova, V. Extended-Spectrum Enterobacteria in Healthy Broiler. Emerg Infect. Dis. 2013, 19, 1253–1259. [Google Scholar] [CrossRef]
- Moawad, A.A.; Hotzel, H.; Awad, O.; Tomaso, H.; Neubauer, H.; Hafez, H.M.; El-Adawy, H. Occurrence of Salmonella enterica and Escherichia coli in raw chicken and beef meat in northern Egypt and dissemination of their antibiotic resistance markers. Gut Pathog. 2017, 9, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Park, C.H.; Robicsek, A.; Jacoby, G.A.; Sahm, D.; Hooper, D.C. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 2006, 50, 3953–3955. [Google Scholar] [CrossRef] [PubMed]
- Thong, K.L.; Lim, K.T.; Yasin, R.; Yeo, C.C.; Puthucheary, S. Characterization of multidrug resistant ESBL-Producing Escherichia coli isolates from hospitals in Malaysia. J. Biomed. Biotechnol. 2009, 2009, 1–10. [Google Scholar]


| Organism | Isolates Recovered from Poultry (n = 310) | Isolates Recovered from Domestic Pigs (n = 252) | ||
|---|---|---|---|---|
| Number | Percentage | Number | Percentage | |
| Escherichia coli | 236 | 60.5 | 225 | 73.1 |
| Klebsiella pneumoniae | 9 | 2.3 | 6 | 1.9 |
| Klebsiella oxytoca | 5 | 1.3 | 2 | 0.6 |
| Pantoea spp. | 32 | 8.2 | 2 | 0.6 |
| Leclercia adercarboxylate | 5 | 1.3 | 1 | 0.3 |
| Citrobacter spp. | 5 | 1.3 | 1 | 0.3 |
| Kluyvera spp. | 4 | 1.0 | 4 | 1.3 |
| Erwinia spp. | 8 | 2.1 | - | - |
| Serratia odorifera | 3 | 0.8 | 5 | 1.6 |
| Salmonella enterica | 2 | 0.5 | 1 | 0.3 |
| Antibiotic | % of Resistance in Poultry (n = 236) | % of Resistance in Domestic Pigs (n = 225) | Chi-Square | p-Value |
|---|---|---|---|---|
| CIP (n = 199) | 28.5 | 28.6 | 0.360 | 0.835 |
| CHL (n =190) | 27.2 | 27.3 | 0.360 | 0.835 |
| NAL (n = 303) | 47.3 | 38.0 | 10.090 | 0.006 |
| GEN (n = 188) | 27.7 | 26.0 | 0.845 | 0.655 |
| AMP (n = 295) | 39.0 | 46.4 | 3.997 | 0.136 |
| TET (n = 358) | 51.3 | 51.3 | 0.447 | 0.800 |
| DOX (n 270) | 38.5 | 39.0 | 0.346 | 0.841 |
| SXT (n = 278) | 35.9 | 47.7 | 10.566 | 0.005 |
| CTX (n = 233) | 36.4 | 29.5 | 8.265 | 0.016 |
| MEM (n = 24) | 3.3 | 3.6 | 0.168 | 0.919 |
| No. of E. coli per Ward | % of Resistance to the Tested Antibiotic | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CIP | CHL | NAL | GEN | AMP | TET | DOX | SXT | CTX | MEM | |
| Ukonga (30) | 56.7 | 43.3 | 73.3 | 22.4 | 70.0 | 61.2 | 59.7 | 49.3 | 63.3 | 3.0 |
| Kipawa (67) | 32.8 | 29.9 | 64.2 | 30.0 | 52.2 | 80.0 | 66.7 | 56.7 | 43.3 | 10.0 |
| Gongolamboto (22) | 50.0 | 36.4 | 72.7 | 31.8 | 36.4 | 81.8 | 63.6 | 54.5 | 68.2 | 0.0 |
| Buguruni (15) | 33.3 | 20.0 | 46.7 | 40.0 | 40 | 60.0 | 20.0 | 26.7 | 33.3 | 6.7 |
| Kinyerezi (53) | 39.6 | 39.6 | 56.6 | 50.9 | 50.9 | 64.2 | 43.4 | 41.5 | 39.6 | 5.7 |
| Segerea (47) | 34.0 | 31.9 | 63.8 | 34.0 | 53.2 | 72.3 | 46.8 | 55.3 | 61.7 | 4.3 |
| Overall resistance | 39.3 | 34.2 | 63.2 | 34.2 | 52.1 | 68.4 | 52.1 | 48.7 | 50.4 | 4.7 |
| p-value | 0.237 | 0.569 | 0.419 | 0.046 | 0.223 | 0.254 | 0.018 | 0.315 | 0.026 | 0.599 |
| No. of E. coli per Ward | % of Resistance to the Tested Antibiotic | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CIP | CHL | NAL | GEN | AMP | TET | DOX | SXT | CTX | MEM | |
| Ukonga (42) | 23.8 | 21.4 | 33.3 | 19.0 | 27.8 | 50.0 | 27.8 | 33.3 | 42.9 | 5.6 |
| Kipawa (18) | 11.1 | 5.6 | 33.3 | 11.1 | 54.8 | 64.3 | 54.2 | 61.9 | 55.6 | 7.1 |
| Kinyerezi (35) | 34.3 | 25.7 | 37.1 | 25.7 | 54.3 | 51.4 | 37.1 | 62.9 | 20.0 | 0.0 |
| Segerea (58) | 24.1 | 22.4 | 43.1 | 22.4 | 48.3 | 53.4 | 41.4 | 41.4 | 27.6 | 1.7 |
| Kisarawe (51) | 60.8 | 62.7 | 64.7 | 47.1 | 76.5 | 80.4 | 60.8 | 80.4 | 47.1 | 11.8 |
| Pugu station (18) | 38.9 | 38.9 | 44.4 | 44.4 | 72.2 | 66.7 | 50.0 | 50.0 | 38.9 | 0.0 |
| Overall resistance | 34.2 | 32.0 | 44.6 | 28.8 | 57.2 | 62.2 | 46.8 | 57.7 | 36.7 | 5.0 |
| p-value | 0.000 | 0.000 | 0.031 | 0.006 | 0.003 | 0.033 | 0.101 | 0.000 | 0.034 | 0.022 |
| No. of Antibiotics Classes | Resistance Pattern | No. of Isolates | Prevalence (%) |
|---|---|---|---|
| 3 | TET/SUL/CEP | 4 | 0.87 |
| QNL/PEN/SUL | 6 | 1.30 | |
| AMN/PEN/TET | 3 | 0.65 | |
| QNL/AMN/TET | 8 | 1.73 | |
| QNL/PEN/TET | 3 | 0.65 | |
| PEN/SUL/CEP | 2 | 0.43 | |
| QNL/PEN/TET | 5 | 1.08 | |
| PEN/TET/SUL | 14 | 3.04 | |
| QNL/TET/SUL | 6 | 1.30 | |
| PHE/TET/SUL | 3 | 0.65 | |
| QNL/TET/CEP | 3 | 0.65 | |
| 4 | QNL/AMN/TET/CEP | 5 | 1.08 |
| QNL/PEN/SUL/CEP | 4 | 0.87 | |
| QNL/AMN/TET/SUL | 3 | 0.65 | |
| QNL/PEN/TET/SUL | 15 | 3.25 | |
| PHE/QNL/PEN/TET | 3 | 0.65 | |
| PHE/PEN/TET/SUL | 4 | 0.87 | |
| PEN/TET/SUL/CEP | 2 | 0.43 | |
| QNL/TET/SUL/CEP | 4 | 0.87 | |
| 5 | QNL/AMN/TET/SUL/CEP | 3 | 0.65 |
| QNL/PEN/TET/SUL/CEP | 5 | 1.08 | |
| QNL/AMN/PEN/TET/SUL | 4 | 0.87 | |
| QNL/PHE/TET/SUL/CEP | 3 | 0.65 | |
| QNL/PHE/PEN/TET/SUL | 16 | 3.47 | |
| 6 | QNL/AMN/PEN/TET/SUL/CEP | 2 | 0.43 |
| QNL/PHE/AMN/PEN/TET/CEP | 2 | 0.43 | |
| QNL/PHE/PEN/TET/SUL/CEP | 3 | 0.65 | |
| QNL/PHE/AMN/PEN/TET/SUL | 20 | 4.34 | |
| 7 | QNL/PHE/PEN/TET/SUL/CEP/CAR | 11 | 2.39 |
| QNL/PHE/AMN/PEN/TET/SUL/CEP | 62 | 13.45 | |
| 8 | QNL/PHE/AMN/PEN/TET/SUL/CEP/CAR | 10 | 2.17 |
| Total | 238 | 51.6 | |
| Antibiotic | % of Resistant ESBL E. coli Producers (n = 301) | % of Resistant Non-ESBL E. coli Producers (n = 160) | p-Value |
|---|---|---|---|
| Ciprofloxacin | 41.2(124) | 30.6(49) | 0.000 |
| Chloramphenicol | 36.2(109) | 28.1(45) | 0.000 |
| Nalidixic acid | 59.8(180) | 45.0(72) | 0.000 |
| Gentamycin | 33.6(101) | 29.4(47) | 0.000 |
| Tetracycline | 70.1(211) | 57.5(92) | 0.000 |
| Doxycycline | 52.5(158) | 45.6(73) | 0.000 |
| Trimethoprim/ Sulfamethoxazole | 55.5(167) | 50.0(80) | 0.000 |
| Antibiotic | % Quinolone Resistance (n = 173) | % Non-Quinolone Resistance (n = 288) | Chi-Square | p-Value |
|---|---|---|---|---|
| Chloramphenicol | 70.5(122) | 11.1(32) | 171.469 | 0.000 |
| Gentamycin | 60.1(104) | 15.3(44) | 99.683 | 0.000 |
| Ampicillin | 82.1(142) | 37.2(107) | 87.830 | 0.000 |
| Tetracycline | 92.5(160) | 49.7(143) | 88.022 | 0.000 |
| Doxycycline | 80.9(140) | 31.6(91) | 105.191 | 0.000 |
| Trimethoprim/ Sulfamethoxazole | 82.7(143) | 36.1(104) | 94.152 | 0.000 |
| Cefotaxime | 52.0(90) | 40.6(117) | 5.675 | 0.017 |
| Meropenem | 11.0(19) | 1.0(3) | 24.028 | 0.000 |
| ESBL Producer Isolate | Quinolone-Resistant Isolate | ||||||
|---|---|---|---|---|---|---|---|
| R | S | p-Value | R | S | p-Value | ||
| CHL | 36.2(109) | 63.8(192) | 0.080 | CHL | 70.5(122) | 11.1(32) | 0.000 |
| GEN | 33.6(101) | 64.4(200) | 0.360 | GEN | 60.1(104) | 15.3(44) | 0.000 |
| TET | 70.1(211) | 29.9(90) | 0.007 | TET | 92.5(160) | 49.7(143) | 0.000 |
| DOX | 52.5(158) | 47.5(143) | 0.160 | DOX | 80.9(140) | 31.6(91) | 0.000 |
| SXT | 55.5(167) | 44.5(134) | 0.261 | SXT | 82.7(143) | 36.1(104) | 0.000 |
| AMR Genes | E. coli No (%) | Sample Type | |
|---|---|---|---|
| Poultry | Domestic Pigs | ||
| blaCTX-M | 16/20 (80) | 7 | 9 |
| blaTEM | 0/20 (0) | 0 | 0 |
| blaSHV | 0/20 (0) | 0 | 0 |
| qrnA | 0/20 (0) | 0 | 0 |
| qrnB | 2/20 (10) | 0 | 2 |
| qnrS | 0/20 (0) | 0 | 0 |
| qnrC | 0/20 (0) | 0 | 0 |
| qnrD | 0/20 (0) | 0 | 0 |
| aac(6)-Ib-cr | 3/20 (15) | 2 | 1 |
| qepA | 1/20 (5) | 1 | 0 |
| Gene | Primer Set and Sequence (5′-3′) | Amplicon Size | Reference |
|---|---|---|---|
| CTX-M | F: SCSATGTGCAGYACCAGTAA R: ACCAGAAYVAGCGGBGC | 585 bp | [90,91] |
| qnrA | F: TCAGCAAGAGGATTTCTCA R: GGCAGCACTATTACTCCCA | 627 bp | [92] |
| qnrB | F: GGMATHGAAATTCGCCACTG R: TTTGCYGYYCGCCAGTCGAA | 264 bp | [92] |
| qnrS | F: ATGGAAACCTACAATCATAC R: AAAAACACCTCGACTTAAGT | 467 bp | [92] |
| aac(6′)-Ib-cr | F: TTGCGATGCTCTATGAGTGGCTA R: CTCGAATGCCTGGCGTGTTT | 482 bp | [92,93] |
| TEM | F: ATGAGTATTCAACATTTCCG R: CTGACAGTTACCAATGCTTA | 868 bp | [94] |
| SHV | F: GGTTATGCGTTATATTCGCC R: TTAGCGTTGCCAGTGCTC | 867 bp | [94] |
| qnrC | F: GGGTTGTACATTTATTGAATC R: TCCACTTTACGAGGTTCT | 447 bp | [75] |
| qnrD | F: CGAGATCAATTTACGGGGAATA R: AACAAGCTGAAGCGCCTG | 582 bp | [75] |
| qepA | F: TGGTCTACGCCATGGACCTCA R: TGAATTCGGACACCGTCTCCG | 1137 bp | [75] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kimera, Z.I.; Mgaya, F.X.; Misinzo, G.; Mshana, S.E.; Moremi, N.; Matee, M.I.N. Multidrug-Resistant, Including Extended-Spectrum Beta Lactamase-Producing and Quinolone-Resistant, Escherichia coli Isolated from Poultry and Domestic Pigs in Dar es Salaam, Tanzania. Antibiotics 2021, 10, 406. https://doi.org/10.3390/antibiotics10040406
Kimera ZI, Mgaya FX, Misinzo G, Mshana SE, Moremi N, Matee MIN. Multidrug-Resistant, Including Extended-Spectrum Beta Lactamase-Producing and Quinolone-Resistant, Escherichia coli Isolated from Poultry and Domestic Pigs in Dar es Salaam, Tanzania. Antibiotics. 2021; 10(4):406. https://doi.org/10.3390/antibiotics10040406
Chicago/Turabian StyleKimera, Zuhura I., Fauster X. Mgaya, Gerald Misinzo, Stephen E. Mshana, Nyambura Moremi, and Mecky I. N. Matee. 2021. "Multidrug-Resistant, Including Extended-Spectrum Beta Lactamase-Producing and Quinolone-Resistant, Escherichia coli Isolated from Poultry and Domestic Pigs in Dar es Salaam, Tanzania" Antibiotics 10, no. 4: 406. https://doi.org/10.3390/antibiotics10040406
APA StyleKimera, Z. I., Mgaya, F. X., Misinzo, G., Mshana, S. E., Moremi, N., & Matee, M. I. N. (2021). Multidrug-Resistant, Including Extended-Spectrum Beta Lactamase-Producing and Quinolone-Resistant, Escherichia coli Isolated from Poultry and Domestic Pigs in Dar es Salaam, Tanzania. Antibiotics, 10(4), 406. https://doi.org/10.3390/antibiotics10040406

