Next Article in Journal
Incorporation of Hybrid Nanomaterial in Dental Porcelains: Antimicrobial, Chemical, and Mechanical Properties
Previous Article in Journal
Multidrug-Resistant Bacterial Infections in Geriatric Hospitalized Patients before and after the COVID-19 Outbreak: Results from a Retrospective Observational Study in Two Geriatric Wards
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

The Resistance to Host Antimicrobial Peptides in Infections Caused by Daptomycin-Resistant Staphylococcus aureus

by
Md Saruar Bhuiyan
1,†,
Jhih-Hang Jiang
1,†,
Xenia Kostoulias
1,
Ravali Theegala
1,
Graham J. Lieschke
2 and
Anton Y. Peleg
1,3,*
1
Infection and Immunity Program, Monash Biomedicine Discovery Institute, Department of Microbiology, Monash University, Clayton, VIC 3800, Australia
2
Australian Regenerative Medicine Institute, Monash University, Clayton, VIC 3800, Australia
3
Department of Infectious Diseases, The Alfred Hospital and Central Clinical School, Monash University, Melbourne, VIC 3004, Australia
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Antibiotics 2021, 10(2), 96; https://doi.org/10.3390/antibiotics10020096
Submission received: 10 December 2020 / Revised: 18 January 2021 / Accepted: 18 January 2021 / Published: 20 January 2021

Abstract

Daptomycin is an important antibiotic for the treatment of infections caused by Staphylococcus aureus. The emergence of daptomycin resistance in S. aureus is associated with treatment failure and persistent infections with poor clinical outcomes. Here, we investigated host innate immune responses against clinically derived, daptomycin-resistant (DAP-R) and -susceptible S. aureus paired isolates using a zebrafish infection model. We showed that the control of DAP-R S. aureus infections was attenuated in vivo due to cross-resistance to host cationic antimicrobial peptides. These data provide mechanistic understanding into persistent infections caused by DAP-R S. aureus and provide crucial insights into the adaptive evolution of this troublesome pathogen.

1. Introduction

Staphylococcus aureus continues to be one of the most important human bacterial pathogens, with the capacity to cause a broad range of infections, including S. aureus bacteremia (SAB) [1,2,3]. Treatments of SAB caused by methicillin-resistant S. aureus (MRSA) have increasingly relied on last-line antibiotics, particularly vancomycin and daptomycin [4,5,6]. Daptomycin is a cyclic lipopeptide that targets bacterial membranes to execute bactericidal effects [7,8]. The mechanisms of daptomycin actions are proposed to be similar to host cationic antimicrobial peptides (CAMPs) [7,8]. Notably, the emergence of daptomycin resistance has been associated with persistent and complicated staphylococcal infections in patients [4,9]. Recent studies have also shown that clinically derived daptomycin-resistant (DAP-R) isolates caused persistent infections in Galleria mellonella infections and murine septicemia models [10,11,12,13]. The correlation between daptomycin resistance and prolonged bacterial survival in the infected host demands further investigation.
CAMPs are important constituents of the innate immune system in mammals that influence multifaceted biological processes [14,15]. CAMPs process antimicrobial activities against microorganisms, including bacterial pathogens. Most CAMPs are cationic in nature with positive charges ranging from +2 to +9, which are thought to target negatively charged bacterial membranes via electrostatic interactions [14,15]. Perturbations of bacterial membranes are considered to be the main bactericidal mechanisms of CAMPs [14,15]. In addition to antimicrobial properties, CAMPs can also prompt the adaptive immune system via the chemoattraction of immature dendritic cells and memory T cells [16]. CAMPs have been shown to be important innate host defenses against bacterial infection, including S. aureus [17,18,19]. Of note, cross-resistance to host CAMPs has been reported in clinically derived DAP-R S. aureus isolates in in vitro studies [20,21]. However, it is unclear that the cross-resistance to CAMPs contributes to persistent infections caused by DAP-R S. aureus strains in a whole-animal infection model.
The use of the vertebrate model system Danio rerio (zebrafish) has recently revealed essential aspects of the interactions between host and pathogens [22,23]. Zebrafish share a remarkably similar immune system to humans, including innate and adaptive immunity, and have been used to study host immune responses against bacterial pathogens [23]. For instance, efforts in zebrafish have shown the evolutionary conserved role for nerve growth factor β and its receptor tyrosine kinase TrkA signaling in pathogen-specific host immunity against S. aureus [23]. Our recent study shows that S. aureus can evade neutrophil chemotaxis in zebrafish by reducing bacterial membrane phosphatidylglycerol through point mutations in the phospholipid biosynthesis gene cls2, encoding cardiolipin synthase [22].
In the present study, we investigated the impact of DAP-R S. aureus infection on host antimicrobial peptide responses in vivo, which provides insights into persistent staphylococcal infections.

2. Results

We collected S. aureus isolates from a patient with a complicated and persistent bloodstream infection that was treated with daptomycin but failed therapy, including a DAP-S parental strain, A8819, and its corresponding DAP-R daughter strain, A8817, that emerged after clinical failure [9]. To investigate the relationship between daptomycin resistance and persistent infections, we first measured the capacity of human whole blood to kill the paired DAP-S and DAP-R isolates ex vivo. DAP-R strain A8817 was significantly resistant to the killing of innate immune responses in blood compared to its parental DAP-S strain A8819 (Figure 1A). To further assess the virulence of these strains in vivo, we utilized the vertebrate zebrafish (Danio rerio) model system [23]. DAP-S strain A8819 caused lethal disease in zebrafish following a bloodstream infection, whilst its daughter strain, A8817, was significantly attenuated for virulence (Figure 1B). These data were consistent with what we and others have previously shown with multiple clinical, daptomycin-exposed pairs in a murine septicemia model [10,11,12].
We hypothesized that resistance to host CAMPs may contribute to persistent infections caused by DAP-R S. aureus. We first assessed this in vitro using human neutrophil peptide 1 (hNP-1). We showed that hNP-1 was bactericidal against DAP-S isolate A8819, with the most profound effects observed at 40 μg/mL over 2 h (Figure 1C). However, hNP-1 had little effect on the survival of the DAP-R isolate A8817 (Figure 1C). To determine the impact of this cross-resistance to daptomycin and CAMPs in vivo, zebrafish were incubated in dorsomorphin, which inhibits a key antimicrobial peptide known as hepcidin [24,25], prior to bacterial infection and for the duration of the experiment. We expected that if CAMPs were important in vivo, dorsomorphin would lead to augmented virulence of A8819, but would have no effect on A8817 infection due to its resistance and independence of CAMPs. Treatment with dorsomorphin significantly enhanced the virulence of A8819 (Figure 2A). This treatment had no effect on DAP-R A8817 infection (Figure 2B). To support these findings further, we also silenced hepcidin mRNA using a targeted morpholino. Injection of the hepcidin morpholino significantly increased the virulence of A8819 compared to the treatment with a standard negative control morpholino, whereas the virulence of the DAP-R strain A8817 remained unaffected by the knockdown of hepcidin (Figure 2C).

3. Discussion

Emerging resistance to last-line anti-staphylococcal agents has raised concerns regarding therapeutic options. In particular, infections caused by DAP-R S. aureus are often persistent, complicated and difficult to eradicate [4,9]. Here, we report that S. aureus became equipped with the ability to evade host innate immune responses during the evolution of daptomycin resistance. This immune evasion involved cross-resistance to important host antimicrobials, CAMPs. Together, the ability to circumvent crucial innate defenses provides important insights into the complex and persistent infections observed, yet unexplained, with DAP-R S. aureus infections in patients.
CAMPs are significant native components of innate host defense and provide protection against infections caused by bacterial pathogens, including S. aureus, Group A Streptococcus, and Salmonella typhimurium [17,18,26]. Resistance to CAMPs in vivo has been shown to promote persistent bacterial infections with Group A Streptococcus, with strains resistant to cathelicidin causing more severe and prolonged skin infections in a murine model [17]. However, the impact of CAMP resistance in vivo has not been shown with S. aureus thus far. Similar to previous studies [20,21], our current research showed that daptomycin resistance in S. aureus led to cross-resistance to host CAMPs in vitro. However, here we also showed the impact of daptomycin resistance on disease and CAMP sensitivity and control in vivo. We showed that CAMPs were important in controlling S. aureus infection, a phenotype dependent on CAMP sensitivity. Infection with DAP-R A8817 was unaffected by the presence or absence of the zebrafish CAMP hepcidin, whereas infection with the paired DAP-S strain A8819 caused greater mortality when hepcidin was inhibited. Future analyses are still required to investigate the mechanisms behind the cross-resistance to CAMPs and the reduced virulence of the DAP-R strain A8817 in animal infection models. In summary, the DAP-R strain was disarming the host of its most effective first-line immune defenders, providing important insights into the stealthy behavior of pathogenic S. aureus.

4. Materials and Methods

4.1. Culture of Bacterial Strains and Human Neutrophil Peptide 1 (hNP-1) Killing Assay

Clinically derived DAP-S S. aureus isolates A8819 and its DAP-R daughter strain A8817 were used as previously described [9]. S. aureus cells were cultured at 37 °C with constant shaking in BactoTM Brain Heart Infusion broth (BHI) (BD, Franklin Lakes, NJ, USA). For bactericidal activity of hNP-1, S. aureus cells were diluted into 10 mM KH2PO4, pH 7.4, containing 1% BHI broth and hNP-1 (20 μg/mL or 40 μg/mL) (Peptide Institute, INC, Osaka, Japan) to achieve a final inoculum of 106 CFU/mL and then incubated at 37 °C for 2 h. At the indicated time point, viable cells were quantified by plating the cell suspension on BHI agar plates after serial dilutions.

4.2. Ex Vivo Human Whole Blood Killing Assay

Bacterial suspensions in 50 μL PBS were mixed with 50 μL human blood to achieve final bacterial density at 2 × 104 CFU/mL in a 96-well plate. The plate was incubated at 37 °C for 3 h under continuous shaking. The number of bacterial CFU was determined after incubation by plating serial 10-fold dilutions.

4.3. Zebrafish Infection, Leukocyte Enumeration and Survival Analyses

Wild-type Tübingen and Tg(lyz:DsRed)nz50 zebrafish embryos were maintained in the Monash University AquaCore facility according to standard protocols [22]. Zebrafish embryos (48 h post-fertilization, hpf) were injected with S. aureus (1000 CFU/embryo) in common cardinal vein for a bloodstream infection for survival analyses. Five embryos were homogenized immediately after infection each time and plated on BHI agar to confirm bacterial inoculums. Ten embryos per treatment were monitored daily for survival up to 96 h post-infection (hpi) and dead embryos were recorded at each time point in three independent experiments. Zebrafish work was approved by the Monash University Animal Ethics Committee (MAS/2010/18).

4.4. Inhibition of the Antimicrobial Peptide Hepcidin In Vivo

The major zebrafish antimicrobial peptide hepcidin [25] was inhibited using two approaches. First, chemical inhibition was performed by incubating embryos in egg water containing 40 μM dorsomorphin from 30 hpf until the conclusion of the experiment. Embryos treated with egg water containing 0.3% DMSO, which was used to solubilize dorsomorphin, were used as a control. Dorsomorphin inhibits the bone morphogenetic protein signaling pathway, which is required for producing hepcidin [24]. Second, we inhibited hepcidin expression using antisense morpholino oligomers (MO) (CACGTTAGAAAGCTTCATCTTCAGT) directed at hamp (Gene Tools, LLC, Eugene OR). Yolks of one-cell embryos were injected with 1 nL of 25 mM hampATG MO in distilled water per embryo. A standard negative control MO (CCTCTTACCTCAGTTACAATTTATA) was used as a negative control.

4.5. Statistical Analysis

Statistics were generated using GraphPad Prism version 6.0, GraphPad Software, La Jolla California USA, www.graphpad.com. Statistical tests were performed as indicated in the figure legends. p < 0.05 was considered significant for all analyses.

Author Contributions

M.S.B., J.-H.J. and A.Y.P. designed the studies and wrote the manuscript; J.-H.J. and M.S.B. carried out experiments; R.T. assisted with and analyzed the human whole blood killing assay; X.K. assisted with zebrafish infection experiments and analysis; J.-H.J., M.S.B., G.J.L., and A.Y.P. analyzed and interpreted the data. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Australian National Health and Medical Research Council (NHMRC), APP1144303. A.Y.P and G.J.L. were funded by the Australian NHMRC Practitioner Fellowship and Senior Research Fellowship, respectively. The Australian Regenerative Medicine Institute is supported by grants from the State Government of Victoria and the Australian Government. M.S.B. was funded by an Australian Leadership Award (ALA) by the Australian Government.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki. The collection of human venous blood from healthy volunteers for ex vivo human whole blood killing assay was approved by Monash University Human Research Ethics Committee (Project Number CF15/3596-2015001553, Date of approval: 5 October 2015). The informed consents from the volunteers were obtained.

Data Availability Statement

Data is contained within the article.

Acknowledgments

We acknowledge the technical support for zebrafish work from Monash University AquaCore.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Lee, A.S.; de Lencastre, H.; Garau, J.; Kluytmans, J.; Malhotra-Kumar, S.; Peschel, A.; Harbarth, S. Methicillin-resistant Staphylococcus aureus. Nat. Rev. Dis. Primers 2018, 4, 18033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Wozniak, J.M.; Mills, R.H.; Olson, J.; Caldera, J.R.; Sepich-Poore, G.D.; Carrillo-Terrazas, M.; Tsai, C.M.; Vargas, F.; Knight, R.; Dorrestein, P.C.; et al. Mortality Risk Profiling of Staphylococcus aureus Bacteremia by Multi-omic Serum Analysis Reveals Early Predictive and Pathogenic Signatures. Cell 2020, 182, 1311–1327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Paling, F.P.; Hazard, D.; Bonten, M.J.M.; Goossens, H.; Jafri, H.S.; Malhotra-Kumar, S.; Sifakis, F.; Weber, S.; Kluytmans, J.; Team, A.-I.S. Association of Staphylococcus aureus Colonization and Pneumonia in the Intensive Care Unit. JAMA Netw. Open 2020, 3, e2012741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Fowler, V.G., Jr.; Boucher, H.W.; Corey, G.R.; Abrutyn, E.; Karchmer, A.W.; Rupp, M.E.; Levine, D.P.; Chambers, H.F.; Tally, F.P.; Vigliani, G.A.; et al. Daptomycin versus standard therapy for bacteremia and endocarditis caused by Staphylococcus aureus. N. Engl. J. Med. 2006, 355, 653–665. [Google Scholar] [CrossRef] [Scilit]
  5. Holubar, M.; Meng, L.; Alegria, W.; Deresinski, S. Bacteremia due to Methicillin-Resistant Staphylococcus aureus: An Update on New Therapeutic Approaches. Infect. Dis. Clin. N. Am. 2020, 34, 849–861. [Google Scholar] [CrossRef] [Scilit]
  6. Holland, T.L.; Arnold, C.; Fowler, V.G., Jr. Clinical management of Staphylococcus aureus bacteremia: A review. JAMA J. Am. Med Assoc. 2014, 312, 1330–1341. [Google Scholar] [CrossRef] [Scilit]
  7. Bayer, A.S.; Schneider, T.; Sahl, H.G. Mechanisms of daptomycin resistance in Staphylococcus aureus: Role of the cell membrane and cell wall. Ann. N. Y. Acad. Sci. 2013, 1277, 139–158. [Google Scholar] [CrossRef] [Scilit]
  8. Tran, T.T.; Munita, J.M.; Arias, C.A. Mechanisms of drug resistance: Daptomycin resistance. Ann. N. Y. Acad. Sci. 2015, 1354, 32–53. [Google Scholar] [CrossRef] [Scilit]
  9. Peleg, A.Y.; Miyakis, S.; Ward, D.V.; Earl, A.M.; Rubio, A.; Cameron, D.R.; Pillai, S.; Moellering, R.C., Jr.; Eliopoulos, G.M. Whole genome characterization of the mechanisms of daptomycin resistance in clinical and laboratory derived isolates of Staphylococcus aureus. PLoS ONE 2012, 7, e28316. [Google Scholar] [CrossRef] [Scilit]
  10. Cameron, D.R.; Mortin, L.I.; Rubio, A.; Mylonakis, E.; Moellering, R.C., Jr.; Eliopoulos, G.M.; Peleg, A.Y. Impact of daptomycin resistance on Staphylococcus aureus virulence. Virulence 2015, 6, 127–131. [Google Scholar] [CrossRef] [Scilit]
  11. Taglialegna, A.; Varela, M.C.; Rosato, R.R.; Rosato, A.E. VraSR and Virulence Trait Modulation during Daptomycin Resistance in Methicillin-Resistant Staphylococcus aureus Infection. mSphere 2019, 4, e00557-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Li, S.; Yin, Y.; Chen, H.; Wang, Q.; Wang, X.; Wang, H. Fitness Cost of Daptomycin-Resistant Staphylococcus aureus Obtained from in vitro Daptomycin Selection Pressure. Front. Microbiol. 2017, 8, 2199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Richards, R.L.; Haigh, R.D.; Pascoe, B.; Sheppard, S.K.; Price, F.; Jenkins, D.; Rajakumar, K.; Morrissey, J.A. Persistent Staphylococcus aureus isolates from two independent bacteraemia display increased bacterial fitness and novel immune evasion phenotypes. Infect. Immun. 2015, 83, 3311–3324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Haney, E.F.; Straus, S.K.; Hancock, R.E.W. Reassessing the Host Defense Peptide Landscape. Front. Chem. 2019, 7, 43. [Google Scholar] [CrossRef] [Scilit]
  15. Hancock, R.E.; Sahl, H.G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef] [Scilit]
  16. Yang, D.; Chertov, O.; Bykovskaia, S.N.; Chen, Q.; Buffo, M.J.; Shogan, J.; Anderson, M.; Schroder, J.M.; Wang, J.M.; Howard, O.M.; et al. Beta-defensins: Linking innate and adaptive immunity through dendritic and T cell CCR6. Science 1999, 286, 525–528. [Google Scholar] [CrossRef] [Scilit]
  17. Nizet, V.; Ohtake, T.; Lauth, X.; Trowbridge, J.; Rudisill, J.; Dorschner, R.A.; Pestonjamasp, V.; Piraino, J.; Huttner, K.; Gallo, R.L. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 2001, 414, 454–457. [Google Scholar] [CrossRef] [Scilit]
  18. Zhang, L.J.; Guerrero-Juarez, C.F.; Hata, T.; Bapat, S.P.; Ramos, R.; Plikus, M.V.; Gallo, R.L. Innate immunity. Dermal adipocytes protect against invasive Staphylococcus aureus skin infection. Science 2015, 347, 67–71. [Google Scholar] [CrossRef] [Scilit]
  19. Cheung, G.Y.C.; Fisher, E.L.; McCausland, J.W.; Choi, J.; Collins, J.W.M.; Dickey, S.W.; Otto, M. Antimicrobial Peptide Resistance Mechanism Contributes to Staphylococcus aureus Infection. J. Infect. Dis. 2018, 217, 1153–1159. [Google Scholar] [CrossRef] [Scilit]
  20. Jones, T.; Yeaman, M.R.; Sakoulas, G.; Yang, S.J.; Proctor, R.A.; Sahl, H.G.; Schrenzel, J.; Xiong, Y.Q.; Bayer, A.S. Failures in clinical treatment of Staphylococcus aureus Infection with daptomycin are associated with alterations in surface charge, membrane phospholipid asymmetry, and drug binding. Antimicrob. Agents Chemother. 2008, 52, 269–278. [Google Scholar] [CrossRef] [Scilit]
  21. Mishra, N.N.; McKinnell, J.; Yeaman, M.R.; Rubio, A.; Nast, C.C.; Chen, L.; Kreiswirth, B.N.; Bayer, A.S. In vitro cross-resistance to daptomycin and host defense cationic antimicrobial peptides in clinical methicillin-resistant Staphylococcus aureus isolates. Antimicrob. Agents Chemother. 2011, 55, 4012–4018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Jiang, J.H.; Bhuiyan, M.S.; Shen, H.H.; Cameron, D.R.; Rupasinghe, T.W.T.; Wu, C.M.; Le Brun, A.P.; Kostoulias, X.; Domene, C.; Fulcher, A.J.; et al. Antibiotic resistance and host immune evasion in Staphylococcus aureus mediated by a metabolic adaptation. Proc. Natl. Acad. Sci. USA 2019, 116, 3722–3727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Hepburn, L.; Prajsnar, T.K.; Klapholz, C.; Moreno, P.; Loynes, C.A.; Ogryzko, N.V.; Brown, K.; Schiebler, M.; Hegyi, K.; Antrobus, R.; et al. Innate immunity. A Spaetzle-like role for nerve growth factor beta in vertebrate immunity to Staphylococcus aureus. Science 2014, 346, 641–646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Yu, P.B.; Hong, C.C.; Sachidanandan, C.; Babitt, J.L.; Deng, D.Y.; Hoyng, S.A.; Lin, H.Y.; Bloch, K.D.; Peterson, R.T. Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat. Chem. Biol. 2008, 4, 33–41. [Google Scholar] [CrossRef] [Scilit]
  25. Park, C.H.; Valore, E.V.; Waring, A.J.; Ganz, T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J. Biol. Chem. 2001, 276, 7806–7810. [Google Scholar] [CrossRef] [Scilit]
  26. Rosenberger, C.M.; Gallo, R.L.; Finlay, B.B. Interplay between antibacterial effectors: A macrophage antimicrobial peptide impairs intracellular Salmonella replication. Proc. Natl. Acad. Sci. USA 2004, 101, 2422–2427. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Impact of daptomycin resistance on in vivo virulence and host immune responses. (A) Survival of the clinical DAP-R isolate A8817 and its parental DAP-S strain A8819 over 3 h in human blood (n = 4; * p < 0.05, Mann–Whitney test). (B) Survival of zebrafish following bloodstream infection with live S. aureus isolates (n = 30 embryos, three biological replicates; P value is a comparison of A8819 and A8817 by log-rank test). (C) Survival of the clinical DAP-R isolate A8817 and its parental DAP-S strain A8819 over 2 h in the presence of 20 μg/mL and 40 μg/mL hNP-1 (n = 3; for A8817 versus A8819, * p < 0.05 and ** p < 0.01 at indicated time points for same dosages, Student’s t-tests). Error bars represent the mean ± SEM. hNP-1: human neutrophil peptide 1.
Figure 1. Impact of daptomycin resistance on in vivo virulence and host immune responses. (A) Survival of the clinical DAP-R isolate A8817 and its parental DAP-S strain A8819 over 3 h in human blood (n = 4; * p < 0.05, Mann–Whitney test). (B) Survival of zebrafish following bloodstream infection with live S. aureus isolates (n = 30 embryos, three biological replicates; P value is a comparison of A8819 and A8817 by log-rank test). (C) Survival of the clinical DAP-R isolate A8817 and its parental DAP-S strain A8819 over 2 h in the presence of 20 μg/mL and 40 μg/mL hNP-1 (n = 3; for A8817 versus A8819, * p < 0.05 and ** p < 0.01 at indicated time points for same dosages, Student’s t-tests). Error bars represent the mean ± SEM. hNP-1: human neutrophil peptide 1.
Antibiotics 10 00096 g001
Figure 2. Impact of daptomycin resistance on infection control by antimicrobial peptides in vivo. Survival of zebrafish infected with (A) A8819 and (B) A8817 after treatments with dorsomorphin or dimethyl sulfoxide (DMSO, solvent for dorsomorphin). (C) Survival of zebrafish infected with A8819 and A8817 after injections with hepcidin morpholino oligos (MO) or scrambled morpholino oligos (control). (n = 25 embryos, three biological replicates; p value is a comparison of dorsomorphin and DMSO for (A), hepcidin morpholino and the negative control for A8819 for (C) by log-rank test).
Figure 2. Impact of daptomycin resistance on infection control by antimicrobial peptides in vivo. Survival of zebrafish infected with (A) A8819 and (B) A8817 after treatments with dorsomorphin or dimethyl sulfoxide (DMSO, solvent for dorsomorphin). (C) Survival of zebrafish infected with A8819 and A8817 after injections with hepcidin morpholino oligos (MO) or scrambled morpholino oligos (control). (n = 25 embryos, three biological replicates; p value is a comparison of dorsomorphin and DMSO for (A), hepcidin morpholino and the negative control for A8819 for (C) by log-rank test).
Antibiotics 10 00096 g002
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bhuiyan, M.S.; Jiang, J.-H.; Kostoulias, X.; Theegala, R.; Lieschke, G.J.; Peleg, A.Y. The Resistance to Host Antimicrobial Peptides in Infections Caused by Daptomycin-Resistant Staphylococcus aureus. Antibiotics 2021, 10, 96. https://doi.org/10.3390/antibiotics10020096

AMA Style

Bhuiyan MS, Jiang J-H, Kostoulias X, Theegala R, Lieschke GJ, Peleg AY. The Resistance to Host Antimicrobial Peptides in Infections Caused by Daptomycin-Resistant Staphylococcus aureus. Antibiotics. 2021; 10(2):96. https://doi.org/10.3390/antibiotics10020096

Chicago/Turabian Style

Bhuiyan, Md Saruar, Jhih-Hang Jiang, Xenia Kostoulias, Ravali Theegala, Graham J. Lieschke, and Anton Y. Peleg. 2021. "The Resistance to Host Antimicrobial Peptides in Infections Caused by Daptomycin-Resistant Staphylococcus aureus" Antibiotics 10, no. 2: 96. https://doi.org/10.3390/antibiotics10020096

APA Style

Bhuiyan, M. S., Jiang, J.-H., Kostoulias, X., Theegala, R., Lieschke, G. J., & Peleg, A. Y. (2021). The Resistance to Host Antimicrobial Peptides in Infections Caused by Daptomycin-Resistant Staphylococcus aureus. Antibiotics, 10(2), 96. https://doi.org/10.3390/antibiotics10020096

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop