Next Article in Journal
Unpuzzling Friunavirus-Host Interactions One Piece at a Time: Phage Recognizes Acinetobacter pittii via a New K38 Capsule Depolymerase
Next Article in Special Issue
Molecular Characteristics and Antimicrobial Resistance of Salmonella enterica Serovar Schwarzengrund from Chicken Meat in Japan
Previous Article in Journal
Does Systemic Methotrexate Therapy Induce Azole Resistance among Endogenous Candida Strains?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Susceptibility and Detection of Virulence-Associated Genes in Escherichia coli Strains Isolated from Commercial Broilers

by
Tímea Kocúreková
1,2,
Lívia Karahutová
1 and
Dobroslava Bujňáková
1,*
1
Centre of Biosciences of the Slovak Academy of Sciences, Institute of Animal Physiology, Šoltésovej 4-6, 040 01 Košice, Slovakia
2
University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, 040 01 Košice, Slovakia
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(11), 1303; https://doi.org/10.3390/antibiotics10111303
Submission received: 21 September 2021 / Revised: 20 October 2021 / Accepted: 22 October 2021 / Published: 26 October 2021

Abstract

The aim of this study was to investigate the presence of iron-uptake and virulence genes, antibiotic resistance profiles, and phylogenetic relatedness in 115 Escherichia coli (E. coli) strains isolated from broilers in Slovakia and to determine their potential threat to human health. The most frequent phylogroups were B1 (37%) and A (21%), and 33.9% strains were included in pathogenic groups. The commonly observed iron-uptake genes were feoB (94%), sitA (83%), and iutA (58%). Protectins (iss, kpsMTII) were identified in 30% of samples. Four percent of B2-associated broilers carried the papC (P fimbria) gene connected with upper urinary tract infection. The dominant resistance was to tetracycline (49%), ampicillin (66%), ampicillin + sulbactam (27%), ciprofloxacin (61%), and trimethoprim + sulfonamide (34%); moreover, sporadically occurring resistance to cephalosporins, aminoglycosides, fluoroquinolones, and polypeptide colistin was observed. Genotypic analysis of resistance revealed the presence of blaCTX-M-1 and blaCTX-M-2 in two isolates from broilers. Commercial broilers can be reservoirs of virulent and resistant genes as well as E. coli causing (extra-)intestinal infections, which can be a potential threat to humans via direct contact and food.

1. Introduction

The presence of potentially pathogenic E. coli strains in bird faeces may pose some risks to other animals and humans. In birds, E. coli isolates containing virulence factors are designated as avian pathogenic E. coli (APEC), which cause avian colibacillosis, and together with uropathogenic E. coli (UPEC) and E. coli causing meningitis in the newborn (NMEC), they belong among the extra-intestinal E. coli (ExPEC) strains. Since all ExPEC strains present the same phylogenetic origin and a notable degree of overlap in serogroups, sequence types (STs), and virulence-associated genes, several studies have suggested their zoonotic potential [1,2].
Another health concern is the presence of antibiotic-resistant bacteria, an emerging global problem in human and veterinary medicine and one of the main challenges for the twenty-first century. Bacteria can become resistant to antibiotics as a result of efficient horizontal gene-transfer mechanisms through mobile genetic elements such as plasmids, transposons, and integrons [3], the latter of which are able to integrate or excise gene cassettes in their structures.
Consequently, the presence of such pathogenic drug-resistant bacteria poses a public health threat. Humans can be infected due to non-compliance of hygiene procedures, such as washing hands with soap after manual manipulation with poultry and not wearing protective clothing and shoes on farms (it is possible to transfer faeces on shoes and contaminate the domestic environment). The other possibility is foodborne infections, because of contamination of meat during slaughtering or eggs during laying and subsequent insufficient heat treatment of these contaminated products [4].
Numerous studies on phylogenetic groups, virulence-associated genes, and antimicrobial resistance in APEC isolates from farm poultry derived from various colibacillosis have been conducted in many countries, to prevent drug-resistant pathogenic strains reaching consumer foodstuffs [2]. These pathogenic strains result generally from commensals by the acquisition of infectious capacity through horizontal transfer of virulence genes [5]. In order to better understand the risks of emergence of antibiotic-resistant pathogens from healthy animal reservoirs, it is necessary to know the presence and prevalence of virulence factors and antibiotic resistance in faecal commensal E. coli. In this context, the aim of our study was to analyse the distribution of phylogenetic groups and the occurrence of virulence factors and antimicrobial resistance in faecal E. coli strains isolated from healthy broilers kept on commercial farms in Slovakia.

2. Results

A total of 115 E. coli strains found in asymptomatic broilers from five commercial poultry farms were included in this study.

2.1. Clermont’s Phylogenetic Typing

Of the assumed commensal strains (n = 115) isolated from asymptomatic broilers, 21% belonged in phylogroup A; 37% in B1; 17% in D and F phylogroups and clade I (6 versus 4%); and 6% of isolates belonged in group B2. Eight isolates remained unknown.

2.2. Detection of Iron-Uptake and Virulence-Associated Genes (VGs)

A total of eight genes ascribed to the strains for iron uptake (feoB, sitA, irp2, fyuA, iutA, iha, iroN, and ireA) and six virulence-associated genes (tsh, papC, cvaC, iss, kpsMTII, and ibeA) were the subject of our study.
The most common iron-uptake genes observed in broilers were feoB (94%), sitA (83%), and iutA (58%). Other genes for iron transport were represented in lower percentages, namely, irp2 = 22%, fyuA = 14%, iha = 4%, and iroN = 28%. The ireA gene was not detected in any sample.
Genes encoding protectins (iss, kpsMTII) were identified in an average of 30% of broiler samples (iss–34, kpsMTII–35 isolates). The presence of a gene encoding P fimbriae (papC), which is strongly connected with upper urinary tract infections, was confirmed in 4% of B2-associated E. coli.
Our isolates were sorted into the ExPEC subpathotype according to the presence of extra genes as described by Johnson et al. [6] (≥2 VGs: papA/papC; sfa/foc; afa/dra; kpsMTII; iutA). APEC diagnostic approaches (ExPEC + ≥4 VGs: kpsMTII; iss; tsh; iutA/fyuA; sfa/foc/papA/papC/papEF) were used as described by Stromberg et al. [7] and based on criteria according to Spurbeck et al. [8], whereby the strains were defined as UPEC (≥2 VGs: chuA; fyuA; vat; yfcV). Based on the established criteria for pathotype definition, twenty-five broiler isolates (21.7%) possessed ExPEC characteristics; eight (7.0%) were defined as UPEC and seven (6.1%) as APEC. Table 1 moreover shows the distribution of individual pathotypes related to phylogenetic groups, which implies that UPEC is associated only with B2 and D phylogroups.

2.3. Antimicrobial Resistance

Antimicrobial testing showed that the most prevalent resistance in broilers was to ampicillin (66%; MIC 90 (minimum inhibitory concentration required to inhibit the growth of 90% of microorganisms) = 64 mg/L), followed by ciprofloxacin (61%; MIC 90 = 8 mg/L), tetracycline (49%; MIC 90 = 32 mg/L), trimethoprim + sulphonamide (34%; MIC 90 = 8 mg/L), and ampicillin + sulbactam (27%; MIC 90 = 32 mg/L). In eleven isolates, resistance to cephalosporins was detected, namely, to cefuroxime (5.88%; MIC 90 = 8 mg/L) and cefotaxime (4.9%; MIC 90 = 0.25 mg/L). Reduced sensitivity to tazobactam, ceftazidime, gentamicin, tobramycin, and colistin was found in less than 3% of bacterial isolates (Figure 1).
Multi-drug resistance (MDR), i.e., resistance to three and more antibiotics from different groups, occurred in seven strains from broilers reared on commercial farms, which was 6.1%. The MDR strains were identified in phylogroups A, B1, B2, and D. Of all tested strains, 76 were antibiotic-resistant. In general commensal groups, A, B1, and C comprised more than half of the resistant strains, specifically 53.9% altogether (A = 17.1%, B1 = 35.5%, C = 1.3%), in comparison to pathogenic groups (39.5%). Of resistant strains, 6.6% were not classified in any phylogroup (Table 2).
Interpretative reading revealed the following mechanisms of resistance: TEM-1,2/SHV-1:low (approx. 18%); TEM-1,2/SHV-1:high (42%). Other mechanisms detected in broilers were extended-spectrum β-lactamases (ESBL) in 6%, of which ESBL TEM was in less than 4% and ESBL CTX-M type in <2%. The other important mechanisms were AGL AAC(6′)I, i.e., incomplete fluoroquinolone cross-resistance conferring resistance also to kanamycin (1.96%), and AGL ANT(2′)I (0.98%), i.e., cross-resistance between some aminoglycosides. Based on the above results, we focused on monitoring the gene conferring resistance to cephalosporins (blaCTX-M); fluoroquinolones (qnrA, qnrB, qnrS, aac(6′)-Ib-cr); tetracyclines (tetA, tetB); sulfonamides (sul1, sul2); aminoglycosides (aadA); trimethoprim (dfrA, dfrB); and plasmid-mediated colistin resistance (mcr 1–2). The most interesting resistant and virulent patterns are shown in Table 3. Considering the results, we should also mention the presence of genes for resistance to cephalosporins (blaCTX-M-1, blaCTX-M-2). A positive result was the non-presence of resistance to carbapenems (ertapenem, meropenem).

3. Discussion

In our study, we found six virulence-associated genes of ExPEC in isolates from the intestinal microbiota of broilers, namely, tsh (9.6%), papC (4.3%), cvaC (21.7%), iss (29.6%), kpsMTII (30.4%), and ibeA (3.5%). The percentages indicate that the most numerous virulence factors were protectins. These protectins are typical for avian pathogenic E. coli (APEC), and they also contribute to survival and proliferation of microorganisms in the host [9]. Wang et al. [10] analysed the presence of invasion by brain endothelium protein A in isolates from ducks with colibacillosis, but none were found in healthy birds. Our results showed the presence of ibeA gene only in 3.5% of strains from healthy (asymptomatic) chickens, belonging to groups B2 and D. The recent study by Meena et al. [11] testifies to the presence of the genes characteristic for ExPEC (iroN, cvaC, and kpsMTII) more often in groups B2 and D, while papC gene was distributed among all phylogroups. Our results show iroN mainly in B1; kpsMTII in D; and cvaC and papC equally in broiler B2 and D groups. The strains containing genes for the synthesis of capsule and P fimbrie were classified in the ExPEC pathotype. The production of adhesins (fimbriae/pilli) is one of the virulence factors in UPEC enabling the colonization, adherence, and creation of the host inflammatory response [12]. P fimbriae coded by the papC gene, localized at the cell surface, are associated with upper urinary tract infections by binding to the endothelium of the kidney vascular system. Colonizing of the urinary tract by UPEC associated with papC gene can lead to pyelonephritis [13]. We found the papC gene in a total of five strains from broilers, of which three were UPEC (group B2), one was APEC (D group), and the remaining strain was ExPEC (unknown group).
E. coli strains colonizing human and animal guts can acquire genes coding virulence factors from pathogenic strains and can cause intestinal or extra-intestinal infections in various organ systems (specifically, urinary tract infections, pneumonia, meningitis, and sepsis). Köhler and Dobrindt [14] characterized virulence factors typical for extra-intestinal pathogenic E. coli (ExPEC), such as various adhesins (e.g., S/F1C and P fimbriae), toxins (e.g., cytotoxic necrotizing factor 1), factors for eliminating the host defense system (e.g., increased serum survival, colicin V, and capsule synthesis), and for nutrition acquisition (e.g., siderophores and their receptors). These virulence factors are often carried on mobile genetic elements such as pathogenity islands (PAI), which help to transport genes between commensals and pathogens. Iron availability modulates the gut microbiota composition [15]. Bacterial iron recovery is thus also one of the virulence factors available to bacteria. One method of getting iron from the environment is through the production of specific iron chelators, called siderophores, and their receptors on cell surfaces [16]. Tu et al. [17] investigated the influence of iron-uptake genes fyuA and irp2 on APEC pathogenesis. Deletion of these genes from the genome led to reduced transcription of virulence genes and their ability to adhere to cells. In general, pathogenicity was more reduced through the absence of fyuA than in strains with the deletion of irp2. These authors summarized the hypothesis about the cooperation of irp2 and fyuA in APEC pathogenicity, which can be the reason for the presence of irp2 gene in all isolates containing gene fyuA analysed in the present study. The iron acquisition systems used in low-iron conditions are encoded by sitA, iroN, and iutA genes. More than half of the strains from broilers and goshawks possessed these genes in the research by Handrová and Kmeť [18]. Our results point to the presence of all three genes in E. coli strains isolated from broilers. The Feo system is able to transport Fe2+, which occurs in anaerobic conditions and at low pH and which is necessary for bacteria living in such environments. Proteins FeoB and FeoA, which are components of the Feo system, participated in bacterial virulence [19]. The feoB together with sitA were the most common genes identified by us (on average, around 90%) in broilers.
Previous studies have demonstrated the function of phylogroups. Groups A and B1 form the commensal microbiota and B2 and D are connected with extra-intestinal infections, and they are also called pathogenic groups [20]. The strains isolated from healthy chickens were classified mainly as commensal groups B1 (36.5%) and A (20.9%). APEC with UPEC are part of the E. coli group responsible for extra-intestinal infections. The strain classified as ExPEC must present two or more virulence factors including P fimbriae (papA, papC), S/F1C fimbriae (sfa/foc), Dr-binding adhesins (afa/dra), capsule synthesis (kpsMT), and aerobactin receptor (iutA) [6]. Of all our isolated E. coli strains (n = 115), 40 were included in pathotype ExPEC and the remaining 75 in non-ExPEC. The distribution of phylogroups among ExPEC and non-ExPEC was different. The ExPEC pathotype includes strains belonging in groups B2 (15%), D (27.5%), F (17.5%), clade I (2.5%), A (22.5%), and B1 (10%). However, in non-ExPEC, the dominant groups were B1 (50.7%) and A (20%) versus D (12%), clade I (5.3%), C (2.7%), and B2 (1.3%). Virulence factors typical for ExPEC were more often detected in groups B2 and D.
A large diversity of antimicrobials is used to raise poultry in most countries, and most of them are considered to be essential in human medicine [21]. The study conducted by Joosten et al. [22] reported that aminopenicillins (ampicillin and amoxicilin), fluoroquinolones, and tetracycline were the most frequently used antimicrobials in broilers in nine European countries, and only 3 to 26% of drugs were of the “highest priority critically important for human health” group of drugs (including colistin, quinolones, cephalosporins, and macrolides). This roughly reflects the situation in our farms, where the occurrence of resistance was as follows: the highest resistance was to ampicillin followed by ciprofloxacin, tetracycline, and ampicillin + sulbactam. The resistance to cephalosporins, aminoglycosides, and polymyxins was detected at less than 6% of isolates.
In our study, we detected altogether 76 strains (66.1%) resistant to at least one antibiotic. Multidrug-resistant strains represented 6.1% (seven strains).
Johar et al. [23] analysed resistance of the APEC strain in healthy and non-healthy chickens. The resistance to ampicillin, cephalothin, ciprofloxacin, tetracycline, and fosfomycin was higher than 75% in both bird groups. Isolates from sick birds showed resistance to cefuroxime, ceftriaxone (4.4%), piperacillin-tazobactam (1.5%), and colistin (33.3%). Resistance to cephalosporins, namely, cefuroxime, cefotaxime, and ceftazidime, was found in 5.88%, 4.9%, and 2.94% of birds, respectively and to piperacillin-tazobactam (1.96%) in healthy broilers in our study. Of broilers, 2.94% demonstrated phenotypic resistance to colistin, but the value of MIC 90 was 1.0 mg/L, i.e., less than what is listed in EUCAST clinical breakpoints (2.0 mg/L). The resistance of E. coli from broilers in EU member states was analysed and evaluated by the European Food Safety Authority (EFSA) and the European Centre for Disease Prevention and Control (ECDC). Their results showed that the average of resistance to cephalosporins was 3%, with 8.5% in Spain, 3% in France and Poland, and 1% in Germany [24]. In another study from Italy, the susceptibility of E. coli from various poultry sources was investigated. The results confirmed the resistance to cephalosporins of the first (cefazolin—16%), second (cefoxitin—2%), and third (ceftazidime—2%) generation [25]. The results of these studies are consistent with our findings regarding cephalosporins in broilers (cefuroxime—5.88%, cefotaxime—4.9%, and ceftazidime—2.94%). Higher percentages detected by us represent resistance to ampicillin (65.69% of broilers), ampicillin-sulbactam (26.47%), tetracycline (49.02%), and trimethoprim-sulphonamide (33.66%). Tetracycline is commonly used in poultry treatment, and this is the main reason for the high resistance to this antibiotic [26]. E. coli isolates from southwestern Nigeria were resistant to tetracycline in 81% of samples, which was the highest level found in this study [27]. In our findings, we detected resistance to tetracyclines as the third highest resistance in broilers (49.02%). E. coli isolated from broilers reared on farms in the Netherlands were resistant to ciprofloxacin in 50% of cases, in comparison to turkeys (45%) and laying hens (0%) [28]. Reduced sensitivity to ciprofloxacin was confirmed in our study too, namely, in 60.78% of broilers. Resistance to aminoglycosides was confirmed in commercial poultry in Nepal, where seven strains isolated from laying hens were resistant to gentamicin. On the other hand, broilers had not developed this resistance. Resistance to amikacin was not detected in any of the samples [29]. The E. coli from broilers in our study showed resistance to gentamicin in 2.94% and to tobramycin in 1.96% of samples. Two chicken isolates (1.96%) were detected as susceptible with increased exposure to amikacin.
Genotypic resistance was analysed only in some strains according to the results of our interpretive reading.
Cefotaximases confer resistance against all β-lactam antibiotics apart from cephamycins and carbapenems. Furthermore, CTX-M-producing E. coli strains are often resistant to other families of antibiotics such as quinolones, aminoglycosides, or cotrimoxazole. This remains a major emerging health concern because the choice of effective antimicrobial drugs is limited [30]. We found similar results as follows: CTX-M-producing E. coli were confirmed in two broilers. One of them was positive for presence of the gene blaCTX-M-1 and the second for blaCTX-M-2. One strain had a gene encoding resistance to aminoglycosides; both of them were phenotypically resistant to ciprofloxacin and trimetoprim-sulfonamide. The Enterobacterales family often has a connection between plasmid-mediated quinolone resistance and extended-spectrum β-lactamases (ESBL) mechanisms [31]. The presence of aac(6′)-Ib-cr was confirmed in both strains from broilers with an identified mechanism of resistance. The acquisition of resistance leads to the formation of multi-drug-resistant strains and to the limitation of the effects of antimicrobial therapy [32].
Reduced sensitivity to carbapenems was not confirmed in any of our isolates. This is positive information for human medicine, because of their use as a last resort in treating bacterial infections, together with polymyxin colistin as the last choice in the treatment of human infections caused by carbapenem-resistant enterobacteria. The development of resistance to these antibiotics is therefore a global threat to the treatment of bacterial infections in humans and animals [33]. Cepas and Soto [34] described the relationship between growing resistance and a reduced amount of virulence factors. One possible hypothesis is that the process of acquisition of antimicrobial resistance is connected with deletion of virulence-associated genes from DNA regions. Several studies have focused on investigating UPEC strains and their susceptibility to quinolones and virulence. The strains resistant to quinolones did not possess virulence factors such as aerobactin and P-fimbriae [35]. Furthermore, E. coli strains producing haemolysins were more susceptible to tetracycline, nalidixic acid, cefotaxime, and cotrimoxazol than isolates without haemolysin production [36]. High resistance and low virulence were observed in non-B2 strains, and, in contrast, the B2 group had wide virulence factor capacity in isolates in a study carried out in French hospitals [37]. Our E. coli isolates of broiler origin presented higher average numbers of virulence factors, specifically 7.9, 7.6, and 4.1 in groups F, B2, and D, respectively. Less virulent were strains from groups A and B1, which accounted for approximately 3.0 factors. Despite the fact that most of the virulence genes were found in the pathogenic phylogroups, their susceptibility was higher compared to the commensal ones. In contrast, more than half (52.6%) of the resistant strains were groups A and B1, but they were poor in terms of virulence. This can be a reason for these strains’ survival and growth in an antimicrobial environment, whereas their ability to survive in normal conditions can be limited.

4. Materials and Methods

4.1. Samples, Bacterial Isolation, and Identification

A total of 115 E. coli strains isolated from cloacal swabs of asymptomatic broilers from commercial farms were analysed in this study. The samples were collected from five broiler commercial farms, which are situated in regions of the North and the West Slovakia. All chickens were 12–30 days of age and reared in a large-capacity farm with litter floor rearing. In our study were examined the broiler breed Ross 308. Samples were inoculated in buffered peptone water (Oxoid, Basingstoke, UK) at 37 °C for 12 h and then cultured on MacConkey (Oxoid, Basingstoke, UK) and Uriselect agar (Bio-Rad Laboratories, Hercules, CA, USA) under the same temperature conditions overnight. Individual colonies were identified as E. coli using a matrix-assisted laser desorption/ionization time-of-flight mass spectrophotometry (MALDI-TOF MS) biotyper (Bruker Daltonics, Leipzig, Germany), according to the method described by Bessède et al. [38].

4.2. DNA Extraction, Clermont’s Phylogenetic Typing, and Detection of Iron Uptake and Virulence-Associated Genes

Genomic DNA used for polymerase chain reaction (PCR) analysis was extracted from overnight culture by means of the boiling DNA extraction method. Briefly, samples were centrifuged at 12,000× g for 15 min, the supernatant was eliminated, and then the pellets were washed with filtered distilled water. Then, the pellets were re-suspended in 200 µL of filtered distilled water, subjected to boiling at 100 °C in a heat block for 10 min, cooled on ice for 10 min, and centrifuged for 2 min at 12,000× g, and then the supernatant was used for PCR. The isolated DNA was quantitatively and qualitatively analysed with a Nanodrop 2000c Spectrofotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and stored at −20 °C.
The isolates were subjected to phylogenetic typing using the quadruplex phylogroup assignment method [39] for detection of eight E. coli phylogroups. The protocols are based on amplification of chuA, yjaA, arpA, and TspE4.C2 DNA fragments and additional testing for specific genes in the E (arpAgpE) and C (trpAgpC) groups. All detected genes, their primer sequences, PCR products sizes, annealing temperatures, and relevant references used in PCR are listed in Table 4.
Multiplex and/or single PCR analysis was also used to confirm the presence of iron acquisition genes including iha-hemaglutinin adhesine; iroN-siderophore salmochelin; fyuA-siderophore yersiniabactin; ireA-iron-responsive element; sitA-iron and manganese transport; feoB-Fe2+ transporter; irp2-iron regulatory protein and virulence genes: iss-increased serum survival gene; papC-fimbrial adhesine; iutA-siderophore aerobactin; cvaC-colicin V; kpsMTII-capsule; and tsh-temperature-sensitive hemaglutinin; ibeA-invasion of brain (Table 4).
The reaction mixture for PCR in each tube contained: 2 μL DNA; 0.2 μL each of the 0.1–1 μM primers; 0.2 μL 1U Taq DNA polymerase; 1.5–2 μL 1.5 mM MgCl2; 2.5 μL 200 μM dNTP; and 2.5 μL 10x reaction buffer in a total volume of 25 μL. The conditions for running the PCR reaction were: initial denaturation (95 °C, 10 min), 30 cycles of denaturation (95 °C, 20–30 s), annealing (50–65 °C, depending on the primers, 30–60 s), extension (72 °C, 30–60 s), and final elongation (72 °C, 5–10 min).
PCR amplicons were visualized on 1.5% agarose gel prepared in 1× TAE buffer coloured with GoodViewTM (Beijing SBSGenetech Co., Ltd., Beijing, China) using a Mid-Range DNA Ladder (Jena Bioscience, Jena, Germany). The DNA fragments were visualized with an ultraviolet lamp (UV Transilluminator, Geno View, VWR, Radnor, PA, USA).

4.3. Antimicrobial Susceptibility Testing

Antibiotic susceptibility was determined by means of minimum inhibitory concentration (MIC) testing performed according to Gattringer et al. [60] using the Bel-MIDITECH automated diagnostic system (Bratislava, Slovakia). This diagnostic system consists of antimicrobial drugs: ampicillin (AMP); ampicillin + sulbactam (SAM); piperacillin + tazobactam (TZP); cefuroxime (CXM); cefotaxime (CTX); ceftazidime (CAZ); cefoperazone + sulbactam (SPZ); cefepime (FEP); ertapenem (ETP); meropenem (MEM); gentamicin (GEN); tobramycin (TOB); amikacin (AMI); tigecycline (TGC); ciprofloxacin (CIP); tetracycline (TET); colistin (COL); and trimethoprim + sulfonamide (COT). The results of MIC values for each antibiotic were interpreted according to clinical breakpoints (CBPs) described in EUCAST 2020 [61].

4.4. Detection of Antimicrobial Resistance Genes

The detection of various antimicrobial resistance genes was carried out with a PCR assay. We detected genes encoding plasmid-mediated quinolone resistance (PMQR): qnrA, qnrB, qnrS, and aac(6′)IbCr and genes conferring resistance to polymyxin (mcr1, mcr2); cephalosporins (blaCTX-M); tetracycline (tetA, tetB); sulfonamide (sul1 and sul2); aminoglycosides (aadA); trimethoprim (dfrA, dfrB); integrase 1 (Int1); and transposon (Tn3) (Table 4).

5. Conclusions

In conclusion, our results indicate that broilers reared for human consumption can be considered as potential reservoirs and carriers of ExPEC strains, containing high numbers of virulence-associated genes with the possibility of causing infections in both humans and animals. Some of these isolates were resistant to antimicrobials used in human treatments, such as cephalosporines and fluoroquinolones (presence of E. coli with CTX-M; and plasmid quinolone resistance qnrS; aac(6′)-Ib-cr), and 6.1% of broiler-associated isolates showed multi-drug resistance. In addition, the high prevalence of mobile elements (Int1 and Tn3) may allow gene dissemination. Based on these findings, we conclude that commercial broilers can be a potential threat for other animals and humans, because of the potential for meat and other products to become contaminated due to non-compliance with hygiene practices in farming or food-handling.

Author Contributions

Conceptualization, D.B.; methodology, T.K.; validation, D.B., T.K., and L.K.; writing—original draft preparation, T.K., D.B., and L.K.; writing—review and editing, D.B.; supervision, D.B.; project administration, D.B.; funding acquisition, D.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by VEGA grant number 2/0010/21.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Maluta, R.P.; Logue, C.M.; Casas, M.R.T.; Meng, T.; Guastalli, E.A.L.; Rojas, T.C.G.; Montelli, A.C.; Sadatsune, T.; de Carvalho Ramos, M.; Nolan, L.K.; et al. Overlapped Sequence Types (STs) and Serogroups of Avian Pathogenic (APEC) and Human Extra-Intestinal Pathogenic (ExPEC) Escherichia coli Isolated in Brazil. PLoS ONE 2014, 9, e105016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Jeong, J.; Lee, J.-Y.; Kang, M.-S.; Lee, H.-J.; Kang, S.-I.; Lee, O.-M.; Kwon, Y.-K.; Kim, J.-H. Comparative Characteristics and Zoonotic Potential of Avian Pathogenic Escherichia coli (APEC) Isolates from Chicken and Duck in South Korea. Microorganisms 2021, 9, 946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Liu, Y.; Tong, Z.; Shi, J.; Jia, Y.; Yang, K.; Wang, Z. Correlation between Exogenous Compounds and the Horizontal Transfer of Plasmid-Borne Antibiotic Resistance Genes. Microorganisms 2020, 8, 1211. [Google Scholar] [CrossRef] [Scilit]
  4. Kabir, S.M.L. Avian Colibacillosis and Salmonellosis: A Closer Look at Epidemiology, Pathogenesis, Diagnosis, Control and Public Health Concerns. Int. J. Environ. Res. Public Health 2010, 7, 89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Messaili, C.; Messai, Y.; Bakour, R. Virulence Gene Profiles, Antimicrobial Resistance and Phylogenetic Groups of Fecal Escherichia coli Strains Isolated from Broiler Chickens in Algeria. Vet. Ital. 2019, 55, 35–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Johnson, J.R.; Murray, A.C.; Gajewski, A.; Sullivan, M.; Snippes, P.; Kuskowski, M.A.; Smith, K.E. Isolation and Molecular Characterization of Nalidixic Acid-Resistant Extraintestinal Pathogenic Escherichia coli from Retail Chicken Products. Antimicrob. Agents Chemother. 2003, 47, 2161–2168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Stromberg, Z.R.; Johnson, J.R.; Fairbrother, J.M.; Kilbourne, J.; Van Goor, A.; Curtiss, R.; Mellata, M. Evaluation of Escherichia coli Isolates from Healthy Chickens to Determine Their Potential Risk to Poultry and Human Health. PLoS ONE 2017, 12, e0180599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Spurbeck, R.R.; Dinh, P.C.; Walk, S.T.; Stapleton, A.E.; Hooton, T.M.; Nolan, L.K.; Kim, K.S.; Johnson, J.R.; Mobley, H.L.T. Escherichia Coli Isolates That Carry Vat, FyuA, ChuA, and YfcV Efficiently Colonize the Urinary Tract. Infect. Immun. 2012, 80, 4115–4122. [Google Scholar] [CrossRef] [Scilit]
  9. Kathayat, D.; Lokesh, D.; Ranjit, S.; Rajashekara, G. Avian Pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies. Pathogens 2021, 10, 467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Wang, Y.; Tang, C.; Yu, X.; Xia, M.; Yue, H. Distribution of Serotypes and Virulence-Associated Genes in Pathogenic Escherichia coli Isolated from Ducks. Avian Pathol. 2010, 39, 297–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Meena, P.R.; Yadav, P.; Hemlata, H.; Tejavath, K.K.; Singh, A.P. Poultry-origin Extraintestinal Escherichia coli Strains Carrying the Traits Associated with Urinary Tract Infection, Sepsis, Meningitis and Avian Colibacillosis in India. J. Appl. Microbiol. 2021, 130, 2087–2101. [Google Scholar] [CrossRef] [Scilit]
  12. Dadi, B.R.; Abebe, T.; Zhang, L.; Mihret, A.; Abebe, W.; Amogne, W. Distribution of Virulence Genes and Phylogenetics of Uropathogenic Escherichia coli among Urinary Tract Infection Patients in Addis Ababa, Ethiopia. BMC Infect. Dis. 2020, 20, 108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Yazdi, M.; Bouzari, M.; Ghaemi, E.A. Detection of Fim, Pap, Sfa and Afa Adhesin-Encoding Operons in Escherichia coli Strains Isolated from Urinary Tract Infections. Med. Lab. J. 2018, 12, 10–15. [Google Scholar] [CrossRef] [Scilit]
  14. Köhler, C.-D.; Dobrindt, U. What Defines Extraintestinal Pathogenic Escherichia Coli? Int. J. Med. Microbiol. 2011, 301, 642–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Seyoum, Y.; Baye, K.; Humblot, C. Iron Homeostasis in Host and Gut Bacteria—A Complex Interrelationship. Gut Microbes 2021, 13, 1874855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Fardeau, S.; Mullié, C.; Dassonville-Klimpt, A.; Audic, N.; Sonnet, P. Bacterial iron uptake: A promising solution against multidrug resistant bacteria. In Science Against Microbial Pathogens: Communicating Current Research and Technological Advances; Vilas, M., Ed.; Formatex Research Center: Badajoz, Spain, 2011; Volume 2, pp. 695–705. [Google Scholar]
  17. Tu, J.; Xue, T.; Qi, K.; Shao, Y.; Huang, B.; Wang, X.; Zhou, X. The Irp2 and FyuA Genes in High Pathogenicity Islands Are Involved in the Pathogenesis of Infections Caused by Avian Pathogenic Escherichia coli (APEC). Pol. J. Vet. Sci. 2016, 19, 21–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Handrova, L.; Kmet, V. Antibiotic Resistance and Virulence Factors of Escherichia coli from Eagles and Goshawks. J. Environ. Sci. Health Part B 2019, 54, 605–614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Lau, C.K.Y.; Krewulak, K.D.; Vogel, H.J. Bacterial Ferrous Iron Transport: The Feo System. FEMS Microbiol. Rev. 2016, 40, 273–298. [Google Scholar] [CrossRef] [Scilit]
  20. Mosquito, S.; Pons, M.J.; Riveros, M.; Ruiz, J.; Ochoa, T.J. Diarrheagenic Escherichia coli Phylogroups Are Associated with Antibiotic Resistance and Duration of Diarrheal Episode. Sci. World J. 2015, 2015, 610403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Jibril, A.H.; Okeke, I.N.; Dalsgaard, A.; Olsen, J.E. Association between Antimicrobial Usage and Resistance in Salmonella from Poultry Farms in Nigeria. BMC Vet. Res. 2021, 17, 234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Joosten, P.; Sarrazin, S.; Van Gompel, L.; Luiken, R.E.C.; Mevius, D.J.; Wagenaar, J.A.; Heederik, D.J.J.; Dewulf, J.; EFFORT consortium; Graveland, H.; et al. Quantitative and Qualitative Analysis of Antimicrobial Usage at Farm and Flock Level on 181 Broiler Farms in Nine European Countries. J. Antimicrob. Chemother. 2019, 74, 798–806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Johar, A.; Al-Thani, N.; Al-Hadidi, S.H.; Dlissi, E.; Mahmoud, M.H.; Eltai, N.O. Antibiotic Resistance and Virulence Gene Patterns Associated with Avian Pathogenic Escherichia coli (APEC) from Broiler Chickens in Qatar. Antibiotics 2021, 10, 564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Roth, N.; Käsbohrer, A.; Mayrhofer, S.; Zitz, U.; Hofacre, C.; Domig, K.J. The Application of Antibiotics in Broiler Production and the Resulting Antibiotic Resistance in Escherichia Coli: A Global Overview. Poult. Sci. 2019, 98, 1791–1804. [Google Scholar] [CrossRef] [Scilit]
  25. Sgariglia. Antibiotic Resistance Pattern and Virulence Genesin Avian Pathogenic Escherichia coli (APEC) from Different Breeding Systems. Vet. Ital. 2019, 55, 26–33. [Google Scholar] [CrossRef] [Scilit]
  26. Agyare, C.; Etsiapa Boamah, V.; Ngofi Zumbi, C.; Boateng Osei, F. Antibiotic Use in Poultry Production and Its Effects on Bacterial Resistance. In Antimicrobial Resistance—A Global Threat; Kumar, Y., Ed.; IntechO: London, UK, 2019. [Google Scholar] [CrossRef] [Scilit]
  27. Adelowo, O.O.; Fagade, O.E.; Agersø, Y. Antibiotic Resistance and Resistance Genes in Escherichia coli from Poultry Farms, Southwest Nigeria. J. Infect. Dev. Ctries. 2014, 8, 1103–1112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Van den Bogaard, A.E. Antibiotic Resistance of Faecal Escherichia coli in Poultry, Poultry Farmers and Poultry Slaughterers. J. Antimicrob. Chemother. 2001, 47, 763–771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Khanal, T.; Raut, S.B.; Paneru, U. Study of Antibiotic Resistance on Escherichia coli in Commercial Poultry of Nepal. Nep. Vet. J. 2017, 34, 6–17. [Google Scholar] [CrossRef] [Scilit]
  30. Cassier, P.; Lallechère, S.; Aho, S.; Astruc, K.; Neuwirth, C.; Piroth, L.; Chavanet, P. Cephalosporin and Fluoroquinolone Combinations Are Highly Associated with CTX-M β-Lactamase-Producing Escherichia Coli: A Case–Control Study in a French Teaching Hospital. Clin. Microbiol. Infect. 2011, 17, 1746–1751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Carattoli, A. Resistance Plasmid Families in Enterobacteriaceae. Antimicrob. Agents Chemother. 2009, 53, 2227–2238. [Google Scholar] [CrossRef] [Scilit]
  32. Baudry, P.J.; Nichol, K.; DeCorby, M.; Lagacé-Wiens, P.; Olivier, E.; Boyd, D.; Mulvey, M.R.; Hoban, D.J.; Zhanel, G.G. Mechanisms of Resistance and Mobility among Multidrug-Resistant CTX-M–Producing Escherichia coli from Canadian Intensive Care Units: The 1st Report of QepA in North America. Diagn. Microbiol. Infect. Dis. 2009, 63, 319–326. [Google Scholar] [CrossRef] [Scilit]
  33. Meletis, G. Carbapenem Resistance: Overview of the Problem and Future Perspectives. Ther. Adv. Infect. 2016, 3, 15–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Cepas, V.; Soto, S.M. Relationship between Virulence and Resistance among Gram-Negative Bacteria. Antibiotics 2020, 9, 719. [Google Scholar] [CrossRef] [Scilit]
  35. Liu, X.; Liu, H.; Li, Y.; Hao, C. Association between Virulence Profile and Fluoroquinolone Resistance in Escherichia coli Isolated from Dogs and Cats in China. J. Infect. Dev. Ctries. 2017, 11, 306–313. [Google Scholar] [CrossRef] [Scilit]
  36. Karam, M.R.A.; Habibi, M.; Bouzari, S. Relationships between Virulence Factors and Antimicrobial Resistance among Escherichia coli Isolated from Urinary Tract Infections and Commensal Isolates in Tehran, Iran. Osong Public Health Res. Perspect. 2018, 9, 217–224. [Google Scholar] [CrossRef] [Scilit]
  37. Jauréguy, F.; Carbonnelle, E.; Bonacorsi, S.; Clećh, C.; Casassus, P.; Bingen, E.; Picard, B.; Nassif, X.; Lortholary, O. Host and Bacterial Determinants of Initial Severity and Outcome of Escherichia coli Sepsis. Clin. Microbiol. Infect. 2007, 13, 854–862. [Google Scholar] [CrossRef] [Scilit]
  38. Bessède, E.; Angla-gre, M.; Delagarde, Y.; Sep Hieng, S.; Ménard, A.; Mégraud, F. Matrix-Assisted Laser-Desorption/Ionization BIOTYPER: Experience in the Routine of a University Hospital. Clin. Microbiol. Infect. 2011, 17, 533–538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli Phylo-Typing Method Revisited: Improvement of Specificity and Detection of New Phylo-Groups: A New E. Coli Phylo-Typing Method. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Lescat, M.; Clermont, O.; Woerther, P.L.; Glodt, J.; Dion, S.; Skurnik, D.; Djossou, F.; Dupont, C.; Perroz, G.; Picard, B.; et al. Commensal Escherichia coli Strains in Guiana Reveal a High Genetic Diversity with Host-Dependant Population Structure: Commensal Escherichia coli Population Structure. Environ. Microbiol. Rep. 2013, 5, 49–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Johnson, J.R.; Russo, T.A.; Tarr, P.I.; Carlino, U.; Bilge, S.S.; Vary, J.C.; Stell, A.L. Molecular Epidemiological and Phylogenetic Associations of Two Novel Putative Virulence Genes, Iha and IroN E. coli, among Escherichia coli Isolates from Patients with Urosepsis. Infect. Immun. 2000, 68, 3040–3047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Johnson, J.R.; Stell, A.L. Extended Virulence Genotypes of Escherichia coli Strains from Patients with Urosepsis in Relation to Phylogeny and Host Compromise. J. Infect. Dis. 2000, 181, 261–272. [Google Scholar] [CrossRef] [Scilit]
  43. Russo, T.A.; Carlino, U.B.; Johnson, J.R. Identification of a New Iron-Regulated Virulence Gene, IreA, in an Extraintestinal Pathogenic Isolate of Escherichia. Coli. Infect. Immun. 2001, 69, 6209–6216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Runyen-Janecky, L.J.; Reeves, S.A.; Gonzales, E.G.; Payne, S.M. Contribution of the Shigella Flexneri Sit, Iuc, and Feo Iron Acquisition Systems to Iron Acquisition In Vitro and in Cultured Cells. Infect. Immun. 2003, 71, 1919–1928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Rodriguez-Siek, K.E.; Giddings, C.W.; Doetkott, C.; Johnson, T.J.; Nolan, L.K. Characterizing the APEC Pathotype. Vet. Res. 2005, 36, 241–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Ewers, C.; Li, G.; Wilking, H.; Kiebling, S.; Alt, K.; Antao, E.; Laturnus, C.; Diehl, I.; Glodde, S.; Homeier, T. Avian Pathogenic, Uropathogenic, and Newborn Meningitis-Causing Escherichia Coli: How Closely Related Are They? Int. J. Med. Microbiol. 2007, 297, 163–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Le Bouguenec, C.; Archambaud, M.; Labigne, A. Rapid and Specific Detection of the Pap, Afa, and Sfa Adhesin-Encoding Operons in Uropathogenic Escherichia coli Strains by Polymerase Chain Reaction. J. Clin. Microbiol. 1992, 30, 1189–1193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Dozois, C.M.; Dho-Moulin, M.; Brée, A.; Fairbrother, J.M.; Desautels, C.; Curtiss, R. Relationship between the Tsh Autotransporter and Pathogenicity of Avian Escherichia coli and Localization and Analysis of the Tsh Genetic Region. Infect. Immun. 2000, 68, 4145–4154. [Google Scholar] [CrossRef] [Scilit]
  49. Germon, P.; Chen, Y.-H.; He, L.; Blanco, J.E.; Brée, A.; Schouler, C.; Huang, S.-H.; Moulin-Schouleur, M. IbeA, a Virulence Factor of Avian Pathogenic Escherichia Coli. Microbiology 2005, 151, 1179–1186. [Google Scholar] [CrossRef] [Scilit]
  50. Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A.; Hooper, D.C. Qnr Prevalence in Ceftazidime-Resistant Enterobacteriaceae Isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of Plasmid-Mediated Colistin Resistance Mechanism MCR-1 in Animals and Human Beings in China: A Microbiological and Molecular Biological Study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef] [Scilit]
  52. Xavier, B.B.; Lammens, C.; Ruhal, R.; Kumar-Singh, S.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Identification of a Novel Plasmid-Mediated Colistin-Resistance Gene, Mcr-2, in Escherichia Coli, Belgium, June 2016. Eurosurveillance 2016, 21, 30280. [Google Scholar] [CrossRef] [Scilit]
  53. Woodford, N.; Fagan, E.J.; Ellington, M.J. Multiplex PCR for Rapid Detection of Genes Encoding CTX-M Extended-Spectrum β-Lactamases. J. Antimicrob. Chemother. 2006, 57, 154–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Guillaume, G.; Verbrugge, D.; Chasseur-Libotte, M.-L.; Moens, W.; Collard, J.-M. PCR Typing of Tetracycline Resistance Determinants (Tet A–E) in Salmonella Enterica Serotype Hadar and in the Microbial Community of Activated Sludges from Hospital and Urban Wastewater Treatment Facilities in Belgium. FEMS Microbiol. Ecol. 2000, 32, 77–85. [Google Scholar] [CrossRef] [Scilit]
  55. Kerrn, M.B. Susceptibility of Danish Escherichia coli Strains Isolated from Urinary Tract Infections and Bacteraemia, and Distribution of Sul Genes Conferring Sulphonamide Resistance. J. Antimicrob. Chemother. 2002, 50, 513–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Hollingshead, S.; Vapnek, D. Nucleotide Sequence Analysis of a Gene Encoding a Streptomycin/Spectinomycin Adenyltransferase. Plasmid 1985, 13, 17–30. [Google Scholar] [CrossRef] [Scilit]
  57. Navia, M.M.; Ruiz, J.; Sanchez-Cespedes, J.; Vila, J. Detection of Dihydrofolate Reductase Genes by PCR and RFLP. Diagn. Microbiol. Infect. Dis. 2003, 46, 295–298. [Google Scholar] [CrossRef] [Scilit]
  58. Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic Resistance in the ECOR Collection: Integrons and Identification of a Novel Aad Gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Weill, F.-X.; Demartin, M.; Fabre, L.; Grimont, P.A.D. Extended-Spectrum-β-Lactamase (TEM-52)-Producing Strains of Salmonella Enterica of Various Serotypes Isolated in France. J. Clin. Microbiol. 2004, 42, 3359–3362. [Google Scholar] [CrossRef] [Scilit]
  60. Gattringer, R.; Niks, M.; Ostertag, R.; Schwarz, K.; Medvedovic, H.; Graninger, W.; Georgopoulos, A. Evaluation of MIDITECH Automated Colorimetric MIC Reading for Antimicrobial Susceptibility Testing. J. Antimicrob. Chemother. 2002, 49, 651–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. EUCAST (European Committee of Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 11.0, Valid from 1 January 2021. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_11.0_Breakpoint_Tables.pdf (accessed on 6 September 2021).
Figure 1. The values of percentage of resistance and MIC 90 in E. coli of asymptomatic broilers. Abbreviations: AMP = ampicillin; SAM = ampicillin + sulbactam; TZP = piperacillin + tazobactam; CXM = cefuroxime; CTX = cefotaxime; CAZ = ceftazidime; SPZ = cefoperazone + sulbactam; FEP = cefepime; ETP = ertapenem; MEM = meropenem; GEN = gentamicin; TOB = tobramycin; AMI = amikacin; CIP = ciprofloxacin; TET = tetracycline; TGC = tigecycline; COL = colistin and COT = trimethoprim + sulphonamide.
Figure 1. The values of percentage of resistance and MIC 90 in E. coli of asymptomatic broilers. Abbreviations: AMP = ampicillin; SAM = ampicillin + sulbactam; TZP = piperacillin + tazobactam; CXM = cefuroxime; CTX = cefotaxime; CAZ = ceftazidime; SPZ = cefoperazone + sulbactam; FEP = cefepime; ETP = ertapenem; MEM = meropenem; GEN = gentamicin; TOB = tobramycin; AMI = amikacin; CIP = ciprofloxacin; TET = tetracycline; TGC = tigecycline; COL = colistin and COT = trimethoprim + sulphonamide.
Antibiotics 10 01303 g001
Table 1. Distribution of individual pathotypes related to phylogenetic groups in broilers.
Table 1. Distribution of individual pathotypes related to phylogenetic groups in broilers.
PathotypeNumber (%) of All SamplesAB1B2DFClade IUnknown
ExPEC25 (21.7)9 (36.0)2 (8.0)0 (0)9 (36.0)4 (16.0)0 (0)1 (4.0)
UPEC8 (7.0)0 (0)0 (0)6 (75.0)2 (25.0)0 (0)0 (0)0 (0)
APEC7 (6.1)0 (0)2 (28.6)0 (0)0 (0)3 (42.9)1 (14.3)1 (14.3)
Abbreviations: ExPEC = extra-intestinal pathogenic E. coli; UPEC = uropathogenic E. coli; APEC = avian pathogenic E. coli.
Table 2. Antibiotic resistant isolates of commercial broilers associated with phylogroups.
Table 2. Antibiotic resistant isolates of commercial broilers associated with phylogroups.
PhylogroupResistant Strains
n%
A1317.1
B12735.5
B256.6
C11.3
D1621.1
F79.2
Clade I22.6
Unknown56.6
Total76100
Abbreviations: n = number of isolates.
Table 3. Combination of virulence factors and phenotypic and genotypic resistance in selected strains.
Table 3. Combination of virulence factors and phenotypic and genotypic resistance in selected strains.
Strain GroupMobilomeVirulencePhenotypic
Resistance
Genotypic
Resistance
Commensals B-1
B1
Int1, Tn3feoBAMP, SAM, CXM, CAZ, TOB, CIP, COTaac(6′)-Ib-cr, sul1, dfrA
B-2
A
Int1, Tn3feoBAMP, SAM, CXM, CTX, CAZ, CIP, COTaac(6′)-Ib-cr, sul1, dfrA
B-13
B1
Tn3feoB, sitA, iroN, issAMP, CXM, CTX, CIP, TET, COTtetA,
blaCTX-M-2
B-23
A
feoB, sitA, iutA, iroN, tsh, iss, cvaCAMP, SAM, CIPqnrS
UPEC B-22
B2
Int1, Tn3sitA, chuA, iutA, irp2, fyuA, papC, cvaCAMP, CXM, CTX, CIP, TET, COTaadA, sul2, tetB, dfrA,
blaCTX-M-1
B-42
B2
feoB, sitA, chuA, iutA, iroN, ibeA, irp2, fyuA, tsh, iss, cvaCSensitive
B-21
B2
Tn3feoB, sitA, chuA, iutA, irp2, fyuA, papC, cvaCAMP, CIP, TETaadA, sul2, tetB, dfrA
B-32
D
Int1, Tn3feoB, sitA, chuA, iutA, irp2, fyuA, kpsMTIIAMP, SAM, CIP, COTaadA
APEC B-31
F
Tn3feoB, sitA, chuA, iutA, iroN, irp2, tsh, iss, cvaC, kpsMTIIAMP, SAM, CIP, TETqnrS, tetA
B-71
clade I
Int1, Tn3feoB, sitA, chuA, iutA, iroN, irp2, fyuA, papC, cvaC, kpsMTIIAMP, CIP, COTaadA, sul2, tetB
ExPEC B-93
D
Int1, Tn3feoB, sitA, chuA, iutA, ibeA, iss, kpsMTIIAMP, GEN, TOB, CIP, TET, COTaadA, sul1, sul2, tetA, dfrA
Abbreviations: UPEC = uropathogenic E. coli; APEC = avian pathogenic E. coli; ExPEC = extra-intestinal pathogenic E. coli; B = broiler; genes encode mobilome, virulence, and resistance, and abbreviations of antibiotics are mentioned in the “Materials and Methods” section.
Table 4. Target genes and primers sequences used in the PCRs performed in this study to determine the E. coli phylogroups, iron uptake system, virulence factors, and antimicrobial resistance.
Table 4. Target genes and primers sequences used in the PCRs performed in this study to determine the E. coli phylogroups, iron uptake system, virulence factors, and antimicrobial resistance.
GenePrimer Sequences (5′–3′)Product (bp)Annealing (°C)References
arpAAACGCTATTCGCCAGCTTGC
TCTCCCCATACCGTACGCTA
40059[39]
chuAATGGTACCGGACGAACCAAC
TGCCGCCAGTACCAAAGACA
28859[39]
yjaACAAACGTGAAGTGTCAGGAG
AATGCGTTCCTCAACCTGTG
21159[39]
TspE4.C2CACTATTCGTAAGGTCATCC
AGTTTATCGCTGCGGGTCGC
15259[39]
arpA
(group C)
GATTCCATCTTGTCAAAATATGCC
GAAAAGAAAAAGAATTCCCAAGAG
30157[40]
trpA
(group E)
AGTTTTATGCCCAGTGCGAG
TCTGCGCCGGTCACGCCC
31959[40]
ihaCTGGCGGAGGCTCTGAGATCA
TCCTTAAGCTCCCGCGGCTGA
82760[41]
iroNAAGTCAAAGCAGGGGTTGCCCG
GACGCCGACATTAAGACGCAG
65560[41]
fyuATGATTAACCCCGCGACGGGAA
CGCAGTAGGCACGATGTTGTA
88055[42]
ireATGGTCTTCAGCTATATGG
ATCTATGATTGTGTTGGT
41555[43]
sitAAGGGGGCACAACTGATTCTCG
TACCGGGCCGTTTTCTGTGC
60859[44]
feoBAATTGGCGTGCATGAAGATAACTG
AGCTGGCGACCTGATAGAACAATG
47059[45]
irp2AAGGATTCGCGTGAC
TCGTCGGGCAGCGTTTCTTCT
28759[45]
issATCACATAGGATTCTGCCG
ACAAAAAGTTCTATCGCTTCC
70061[46]
papCGACGGCTGTACTGCAGGGTGTGGCG
ATATCCTTTCTGCAGGGATGCAATA
32861[47]
iutAGGCTGGACATGGGAACTGG
CGTCGGGAACGGGTAGAATCG
30063[42]
cvaCCACACACAAACGGGAGCTGTT
CACACACAAACGGGAGCTGTT
68063[42]
tshGGTGGTGCACTGGAGTGG
AGTCCAGCGTGATAGTGG
62055[48]
ibeATGAACGTTTCGGTTGTTTTG
TGTTCAAATCCTGGCTGGAA
81455[49]
kps MTIIGCGCATTTGCTGATACTGTTG
CATCCAGACGATAAGCATGAGCA
27263[42]
qnrAATTTCTCACGCCAGGATTTG
GATCGGCAAAGGTTAGGTCA
51653[50]
qnrBGATCGTGAAAGCCAGAAAGG
ACGATGCCTGGTAGTTGTCC
46953[50]
qnrSACGACATTCGTCAACTGCAA
TAAATTGGCACCCTGTAGGC
41753[50]
aac(6)-Ib-crGATCTCATATCGTCGAGTGGTGG
GAACCATGTACACGGCTGGAC
43558[50]
mcr-1CGGTCAGTCCGTTTGTTC
CTTGGTCGGTCTGTAGGG
30958[51]
mcr-2TGTTGCTTGTGCCGATTGGA
AGATGGTATTGTTGGTTGCTG
56758[52]
blaCTX-M-1AAAAATCACTGCGCCAGTTC
AGCTTATTCATCGCCACGTT
41552[53]
blaCTX-M-2CGACGCTACCCCTGCTATT
CCAGCGTCAGATTTTTCAGG
55252[53]
tetAGGCCTCAATTTCCTGACG
AAGCAGGATGTAGCCTGTGC
37255[54]
tetBGAGACGCAATCGAATTCGG
TTTAGTGGCTATTCTTCCTGCC
22855[54]
sul1CGGCGTGGGCTACCTGAACG
GCCGATCGCGTGAAGTTCCG
43369[55]
sul2GCGCTCAAGGCAGATGGCATT
GCGTTTGATACCGGCACCCGT
29369[55]
aadATGATTTGCTGGTTACGGTGAC
CGCTATGTTCTCTTGCTTTTG
28460[56]
dfrAGTGAAACTATCACTAATGG
TTAACCCTTTTGCCAGATTT
47455[57]
drfBGATCGCCTGCGCAAGAAATC
AAGCGCAGCCACAGGATAAAT
14160[57]
Int1GGGTCAAGGATCTGGATTTCG
ACATGCGTGTAAATCATCGTCG
48362[58]
Tn3CACGAATGAGGGCCGACAGGA
ACCCACTCGTGCACCCAACTG
50058[59]
Abbreviations: arpA, chuA, yjaA, TspE4.C2, arpA gp.C, trpA gp.E = identification of phylogroups; iha = hemaglutinin adhesine; iroN = siderophore salmochelin; fyuA = siderophore yersiniabactin; ireA = iron-responsive element; sitA = iron transport; feoB = Fe2+ transporter; irp2 = iron regulatory protein; iss = increased serum survival gene; papC = fimbrial adhesine; iutA = siderophore aerobactin; cvaC = colicin V; tsh = temperature-sensitive hemagglutinin; ibeA = invasion of brain endothelium; kps MTII = capsule synthesis; qnrA, qnrB, qnrS, aac(6)-Ib-cr, = quinolone resistance; mcr-1, mcr-2 = resistance to colistin; blaCTX-M-1, blaCTX-M-2 = cephotaximases; tetA, tetB = resistance to tetracycline; sul1, sul2 = resistance to sulfonamide; aadA = aminoglycoside resistance; dfrA, dfrB = resistance to trimepthoprim; Int1 = integrase 1; Tn3 = transposon.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kocúreková, T.; Karahutová, L.; Bujňáková, D. Antimicrobial Susceptibility and Detection of Virulence-Associated Genes in Escherichia coli Strains Isolated from Commercial Broilers. Antibiotics 2021, 10, 1303. https://doi.org/10.3390/antibiotics10111303

AMA Style

Kocúreková T, Karahutová L, Bujňáková D. Antimicrobial Susceptibility and Detection of Virulence-Associated Genes in Escherichia coli Strains Isolated from Commercial Broilers. Antibiotics. 2021; 10(11):1303. https://doi.org/10.3390/antibiotics10111303

Chicago/Turabian Style

Kocúreková, Tímea, Lívia Karahutová, and Dobroslava Bujňáková. 2021. "Antimicrobial Susceptibility and Detection of Virulence-Associated Genes in Escherichia coli Strains Isolated from Commercial Broilers" Antibiotics 10, no. 11: 1303. https://doi.org/10.3390/antibiotics10111303

APA Style

Kocúreková, T., Karahutová, L., & Bujňáková, D. (2021). Antimicrobial Susceptibility and Detection of Virulence-Associated Genes in Escherichia coli Strains Isolated from Commercial Broilers. Antibiotics, 10(11), 1303. https://doi.org/10.3390/antibiotics10111303

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop