Butyrate, Forskolin, and Lactose Synergistically Enhance Disease Resistance by Inducing the Expression of the Genes Involved in Innate Host Defense and Barrier Function
Abstract
:1. Introduction
2. Results
2.1. Synergistic Induction of Chicken HDP Gene Expression by Butyrate, Forskolin, and Lactose
2.2. Induction of Tight Junction Protein and Mucin 2 Gene Expressions by Butyrate, Forskolin, and Lactose in HD11 Cells
2.3. Alleviation of NE in Broiler Chickens by Butyrate, Forskolin, and Lactose
2.4. Attenuation of Coccidiosis in Broiler Chickens by Butyrate, Forskolin, and Lactose
3. Discussion
4. Materials and Methods
4.1. Culture and Stimulation of Chicken Macrophages and Jejunal Explants
4.2. RT-qPCR Analysis of Gene Expression
4.3. Chicken NE Trials
4.4. C. perfringens Quantification
4.5. Coccidiosis Trial
4.6. Counting of the Oocyst Shedding in the Feces
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mora, Z.V.; Macias-Rodriguez, M.E.; Arratia-Quijada, J.; Gonzalez-Torres, Y.S.; Nuno, K.; Villarruel-Lopez, A. Clostridium perfringens as Foodborne Pathogen in Broiler Production: Pathophysiology and Potential Strategies for Controlling Necrotic Enteritis. Animals 2020, 10, 1718. [Google Scholar] [CrossRef]
- Chapman, H.D. Milestones in avian coccidiosis research: A review. Poult. Sci. 2014, 93, 501–511. [Google Scholar] [CrossRef] [PubMed]
- OIE. Fifth OIE Annual Report on Antimicrobial Agents Intended for Use in Animals; World Organisation for Animal Health (OIE): Paris, France, 2021. [Google Scholar]
- M’Sadeq, S.A.; Wu, S.; Swick, R.A.; Choct, M. Towards the control of necrotic enteritis in broiler chickens with in-feed antibiotics phasing-out worldwide. Anim. Nutr. 2015, 1, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Caly, D.L.; D’Inca, R.; Auclair, E.; Drider, D. Alternatives to Antibiotics to Prevent Necrotic Enteritis in Broiler Chickens: A Microbiologist’s Perspective. Front. Microbiol. 2015, 6, 1336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghosh, C.; Sarkar, P.; Issa, R.; Haldar, J. Alternatives to Conventional Antibiotics in the Era of Antimicrobial Resistance. Trends Microbiol. 2019, 27, 323–338. [Google Scholar] [CrossRef] [PubMed]
- Robinson, K.; Ma, X.; Liu, Y.; Qiao, S.; Hou, Y.; Zhang, G. Dietary modulation of endogenous host defense peptide synthesis as an alternative approach to in-feed antibiotics. Anim. Nutr. 2018, 4, 160–169. [Google Scholar] [CrossRef]
- Wu, J.; Ma, N.; Johnston, L.J.; Ma, X. Dietary Nutrients Mediate Intestinal Host Defense Peptide Expression. Adv. Nutr. 2020, 11, 92–102. [Google Scholar] [CrossRef]
- Chen, J.; Zhai, Z.; Long, H.; Yang, G.; Deng, B.; Deng, J. Inducible expression of defensins and cathelicidins by nutrients and associated regulatory mechanisms. Peptides 2020, 123, 170177. [Google Scholar] [CrossRef]
- Rodriguez-Carlos, A.; Jacobo-Delgado, Y.M.; Santos-Mena, A.O.; Rivas-Santiago, B. Modulation of cathelicidin and defensins by histone deacetylase inhibitors: A potential treatment for multi-drug resistant infectious diseases. Peptides 2021, 140, 170527. [Google Scholar] [CrossRef] [PubMed]
- Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [Google Scholar] [CrossRef] [PubMed]
- Mookherjee, N.; Anderson, M.A.; Haagsman, H.P.; Davidson, D.J. Antimicrobial host defence peptides: Functions and clinical potential. Nat. Rev. Drug Discov. 2020, 19, 311–332. [Google Scholar] [CrossRef] [PubMed]
- Magana, M.; Pushpanathan, M.; Santos, A.L.; Leanse, L.; Fernandez, M.; Ioannidis, A.; Giulianotti, M.A.; Apidianakis, Y.; Bradfute, S.; Ferguson, A.L.; et al. The value of antimicrobial peptides in the age of resistance. Lancet Infect. Dis. 2020, 20, e216–e230. [Google Scholar] [CrossRef]
- Li, W.; Separovic, F.; O’Brien-Simpson, N.M.; Wade, J.D. Chemically modified and conjugated antimicrobial peptides against superbugs. Chem. Soc. Rev. 2021, 50, 4932–4973. [Google Scholar] [CrossRef] [PubMed]
- Robinson, K.; Deng, Z.; Hou, Y.; Zhang, G. Regulation of the Intestinal Barrier Function by Host Defense Peptides. Front. Vet. Sci. 2015, 2, 57. [Google Scholar] [CrossRef]
- Lyu, W.; Curtis, A.R.; Sunkara, L.T.; Zhang, G. Transcriptional Regulation of Antimicrobial Host Defense Peptides. Curr. Protein. Pept. Sci 2015, 16, 672–679. [Google Scholar] [CrossRef]
- Zhang, L.; Liu, C.; Jiang, Q.; Yin, Y. Butyrate in Energy Metabolism: There Is Still More to Learn. Trends Endocrinol. Metab. 2021, 32, 159–169. [Google Scholar] [CrossRef]
- Liu, H.; Wang, J.; He, T.; Becker, S.; Zhang, G.; Li, D.; Ma, X. Butyrate: A Double-Edged Sword for Health? Adv. Nutr. 2018, 9, 21–29. [Google Scholar] [CrossRef] [Green Version]
- Sunkara, L.T.; Achanta, M.; Schreiber, N.B.; Bommineni, Y.R.; Dai, G.; Jiang, W.; Lamont, S.; Lillehoj, H.S.; Beker, A.; Teeter, R.G.; et al. Butyrate enhances disease resistance of chickens by inducing antimicrobial host defense peptide gene expression. PLoS ONE 2011, 6, e27225. [Google Scholar] [CrossRef]
- Xiong, H.; Guo, B.; Gan, Z.; Song, D.; Lu, Z.; Yi, H.; Wu, Y.; Wang, Y.; Du, H. Butyrate upregulates endogenous host defense peptides to enhance disease resistance in piglets via histone deacetylase inhibition. Sci. Rep. 2016, 6, 27070. [Google Scholar] [CrossRef] [Green Version]
- Sapio, L.; Gallo, M.; Illiano, M.; Chiosi, E.; Naviglio, D.; Spina, A.; Naviglio, S. The Natural cAMP Elevating Compound Forskolin in Cancer Therapy: Is It Time? J. Cell. Physiol. 2017, 232, 922–927. [Google Scholar] [CrossRef]
- Chakraborty, K.; Maity, P.C.; Sil, A.K.; Takeda, Y.; Das, S. cAMP stringently regulates human cathelicidin antimicrobial peptide expression in the mucosal epithelial cells by activating cAMP-response element-binding protein, AP-1, and inducible cAMP early repressor. J. Biol. Chem. 2009, 284, 21810–21827. [Google Scholar] [CrossRef] [Green Version]
- Sunkara, L.T.; Zeng, X.; Curtis, A.R.; Zhang, G. Cyclic AMP synergizes with butyrate in promoting beta-defensin 9 expression in chickens. Mol. Immunol. 2014, 57, 171–180. [Google Scholar] [CrossRef]
- Cederlund, A.; Kai-Larsen, Y.; Printz, G.; Yoshio, H.; Alvelius, G.; Lagercrantz, H.; Stromberg, R.; Jornvall, H.; Gudmundsson, G.H.; Agerberth, B. Lactose in human breast milk an inducer of innate immunity with implications for a role in intestinal homeostasis. PLoS ONE 2013, 8, e53876. [Google Scholar] [CrossRef] [Green Version]
- Shojadoost, B.; Vince, A.R.; Prescott, J.F. The successful experimental induction of necrotic enteritis in chickens by Clostridium perfringens: A critical review. Vet. Res. 2012, 43, 74. [Google Scholar] [CrossRef] [Green Version]
- Ali, A.M.; Seddiek Sh, A.; Khater, H.F. Effect of butyrate, clopidol and their combination on the performance of broilers infected with Eimeria maxima. Br. Poult. Sci. 2014, 55, 474–482. [Google Scholar] [CrossRef]
- Al-Badri, R.; Barta, J.R. The kinetics of oocyst shedding and sporulation in two immunologically distinct strains of Eimeria maxima, GS and M6. Parasitol. Res. 2012, 111, 1947–1952. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.; Reid, W.M. Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970, 28, 30–36. [Google Scholar] [CrossRef]
- Coussens, A.K.; Wilkinson, R.J.; Martineau, A.R. Phenylbutyrate Is Bacteriostatic against Mycobacterium tuberculosis and Regulates the Macrophage Response to Infection, Synergistically with 25-Hydroxy-Vitamin D3. PLoS Pathog. 2015, 11, e1005007. [Google Scholar] [CrossRef] [Green Version]
- Rekha, R.S.; Rao Muvva, S.S.; Wan, M.; Raqib, R.; Bergman, P.; Brighenti, S.; Gudmundsson, G.H.; Agerberth, B. Phenylbutyrate induces LL-37-dependent autophagy and intracellular killing of Mycobacterium tuberculosis in human macrophages. Autophagy 2015, 11, 1688–1699. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lyu, W.; Deng, Z.; Sunkara, L.T.; Becker, S.; Robinson, K.; Matts, R.; Zhang, G. High Throughput Screening for Natural Host Defense Peptide-Inducing Compounds as Novel Alternatives to Antibiotics. Front. Cell. Infect. Microbiol. 2018, 8, 191. [Google Scholar] [CrossRef] [PubMed]
- Sechet, E.; Telford, E.; Bonamy, C.; Sansonetti, P.J.; Sperandio, B. Natural molecules induce and synergize to boost expression of the human antimicrobial peptide beta-defensin-3. Proc. Natl. Acad. Sci. USA 2018, 115, E9869–E9878. [Google Scholar] [CrossRef] [Green Version]
- Kida, Y.; Shimizu, T.; Kuwano, K. Sodium butyrate up-regulates cathelicidin gene expression via activator protein-1 and histone acetylation at the promoter region in a human lung epithelial cell line, EBC-1. Mol. Immunol. 2006, 43, 1972–1981. [Google Scholar] [CrossRef]
- Deng, Z.; Wang, J.; Lyu, W.; Wieneke, X.; Matts, R.; Ma, X.; Zhang, G. Development of a Cell-Based High-Throughput Screening Assay to Identify Porcine Host Defense Peptide-Inducing Compounds. J. Immunol. Res. 2018, 2018, 5492941. [Google Scholar] [CrossRef] [PubMed]
- Alasbahi, R.H.; Melzig, M.F. Forskolin and derivatives as tools for studying the role of cAMP. Pharmazie 2012, 67, 5–13. [Google Scholar] [PubMed]
- Konig, J.; Wells, J.; Cani, P.D.; Garcia-Rodenas, C.L.; MacDonald, T.; Mercenier, A.; Whyte, J.; Troost, F.; Brummer, R.J. Human Intestinal Barrier Function in Health and Disease. Clin. Transl. Gastroenterol. 2016, 7, e196. [Google Scholar] [CrossRef]
- Grondin, J.A.; Kwon, Y.H.; Far, P.M.; Haq, S.; Khan, W.I. Mucins in Intestinal Mucosal Defense and Inflammation: Learning From Clinical and Experimental Studies. Front. Immunol. 2020, 11, 2054. [Google Scholar] [CrossRef] [PubMed]
- Cobo, E.R.; Kissoon-Singh, V.; Moreau, F.; Holani, R.; Chadee, K. MUC2 Mucin and Butyrate Contribute to the Synthesis of the Antimicrobial Peptide Cathelicidin in Response to Entamoeba histolytica- and Dextran Sodium Sulfate-Induced Colitis. Infect. Immunol. 2017, 85, e00905-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.; Wen, J.G.; Feng, J.J.; Wang, Y.H.; Li, T.F.; Nurmi, K.; Eklund, K.K.; Xing, D. Forskolin attenuates the NLRP3 inflammasome activation and IL-1beta secretion in human macrophages. Pediatr. Res. 2019, 86, 692–698. [Google Scholar] [CrossRef]
- Pan, L.L.; Deng, Y.Y.; Wang, R.; Wu, C.; Li, J.; Niu, W.; Yang, Q.; Bhatia, M.; Gudmundsson, G.H.; Agerberth, B.; et al. Lactose Induces Phenotypic and Functional Changes of Neutrophils and Macrophages to Alleviate Acute Pancreatitis in Mice. Front. Immunol. 2018, 9, 751. [Google Scholar] [CrossRef] [Green Version]
- Sunkara, L.T.; Jiang, W.; Zhang, G. Modulation of antimicrobial host defense peptide gene expression by free fatty acids. PLoS ONE 2012, 7, e49558. [Google Scholar] [CrossRef] [Green Version]
- Zeng, X.; Sunkara, L.T.; Jiang, W.; Bible, M.; Carter, S.; Ma, X.; Qiao, S.; Zhang, G. Induction of porcine host defense Peptide gene expression by short-chain Fatty acids and their analogs. PLoS ONE 2013, 8, e72922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, W.; Sunkara, L.T.; Zeng, X.; Deng, Z.; Myers, S.M.; Zhang, G. Differential regulation of human cathelicidin LL-37 by free fatty acids and their analogs. Peptides 2013, 50, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Liu, J.; Wang, X.; Robinson, K.; Whitmore, M.A.; Stewart, S.N.; Zhao, J.; Zhang, G. Identification of an Intestinal Microbiota Signature Associated With the Severity of Necrotic Enteritis. Front. Microbiol. 2021, 12, 703693. [Google Scholar] [CrossRef]
- Latorre, J.D.; Adhikari, B.; Park, S.H.; Teague, K.D.; Graham, L.E.; Mahaffey, B.D.; Baxter, M.F.A.; Hernandez-Velasco, X.; Kwon, Y.M.; Ricke, S.C.; et al. Evaluation of the Epithelial Barrier Function and Ileal Microbiome in an Established Necrotic Enteritis Challenge Model in Broiler Chickens. Front. Vet. Sci. 2018, 5, 199. [Google Scholar] [CrossRef]
- Wu, S.B.; Rodgers, N.; Choct, M. Real-time PCR assay for Clostridium perfringens in broiler chickens in a challenge model of necrotic enteritis. Appl. Environ. Microbiol. 2011, 77, 1135–1139. [Google Scholar] [CrossRef] [Green Version]
- Wang, R.F.; Cao, W.W.; Franklin, W.; Campbell, W.; Cerniglia, C.E. A 16S rDNA-based PCR method for rapid and specific detection of Clostridium perfringens in food. Mol. Cell. Probes 1994, 8, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Hodgson, J.N. Coccidiosis: Oocyst counting technique for coccidiostat evaluation. Exp. Parasitol. 1970, 28, 99–102. [Google Scholar] [CrossRef]
Variables | Control | NE | B | F | L | BF | BL | FL | BFL | SEM | p-Value 2 |
---|---|---|---|---|---|---|---|---|---|---|---|
Survival rate,% | 100 (12/12) | 50.0 (6/12) | 50.0 (6/12) | 25.0 (3/12) | 41.7 (5/12) | 41.7 (5/12) | 41.7 (5/12) | 33.3 (4/12) | 75.0 (9/12) | 0.018 | |
Initial weight, g | 303.7 | 299.2 | 300.8 | 303.3 | 296.8 | 299.2 | 295.0 | 308.3 | 304.3 | 7.78 | 0.98 |
Final weight, g | 665.3 a | 490.2 b | 543.2 b | 556.7 b | 512.0 b | 521.2 b | 545.2 b | 508.0 b | 560.7 b | 20.23 | <0.0001 |
Weight gain, g | 361.7 a | 191.0 b | 242.3 b | 253.3 b | 215.2 b | 222.0 b | 250.2 b | 199.8 b | 256.3 b | 19.91 | <0.0001 |
Gene 1 | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Product Size, bp | GenBank Accession Number 2 |
---|---|---|---|---|
AvBD3 | ATGCGGATCGTGTACCTGCTC | CAGAATTCAGGGCATCAACCTC | 196 | NM_204650.2 |
AvBD8 | TTCTCCTCACTGTGCTCCAA | AAGGCTCTGGTATGGAGGTG | 124 | NM_001001781.1 |
AvBD9 | GCAAAGGCTATTCCACAGCAG | AGCATTTCAGCTTCCCACCAC | 211 | NM_001001611.2 |
AvBD10 | TGGGGCACGCAGTCCACAAC | ATCAGCTCCTCAAGGCAGTG | 298 | NM_001001609.2 |
CLDN1 | TTCCAACCAGGCTTTATGATG | TGCAGAGTCAGGTCAAACAGA | 140 | NM_001013611.2 |
CLDN5 | CATCACTTCTCCTTCGTCAGC | ATCTCCCAGGTCTCTGCATTT | 103 | NM_204201.1 |
TJP1 | CATCAGCCAGAAGAGAACCAG | CCAAGAACAAAAGTGGTATGC | 117 | XM_037393868.1 |
MUC2 | TCTGGAGAGAGTTGTCCTGAC | TCCTTGCAGCAGGAACAACT | 105 | XM_021402134.1 |
GAPDH | GCACGCCATCACTATCTTCC | CATCCACCGTCTTCTGTGTG | 356 | NM_204305.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Q.; Whitmore, M.A.; Robinson, K.; Lyu, W.; Zhang, G. Butyrate, Forskolin, and Lactose Synergistically Enhance Disease Resistance by Inducing the Expression of the Genes Involved in Innate Host Defense and Barrier Function. Antibiotics 2021, 10, 1175. https://doi.org/10.3390/antibiotics10101175
Yang Q, Whitmore MA, Robinson K, Lyu W, Zhang G. Butyrate, Forskolin, and Lactose Synergistically Enhance Disease Resistance by Inducing the Expression of the Genes Involved in Innate Host Defense and Barrier Function. Antibiotics. 2021; 10(10):1175. https://doi.org/10.3390/antibiotics10101175
Chicago/Turabian StyleYang, Qing, Melanie A. Whitmore, Kelsy Robinson, Wentao Lyu, and Guolong Zhang. 2021. "Butyrate, Forskolin, and Lactose Synergistically Enhance Disease Resistance by Inducing the Expression of the Genes Involved in Innate Host Defense and Barrier Function" Antibiotics 10, no. 10: 1175. https://doi.org/10.3390/antibiotics10101175