Enhanced Detection of Vibrio harveyi Using a Dual-Composite DNAzyme-Based Biosensor
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Bacterial Strains
2.2. Bacterial Culture and Preparation of Extracellular Products
2.3. Preparation of DNA Libraries
2.4. Screening of DNAzyme
2.5. Screening of Candidate DNAzyme Activity
2.6. Optimization of Reaction Conditions
2.6.1. pH
2.6.2. Metal Ions
2.7. Specificity of Dual DNAzyme
2.8. Sensitivity Detection
2.9. Identification of the Target and Its Molecular Weight
2.10. Influence of RNases on Cleavage Activity of DNAzyme
2.11. Design and Optimization of Dual DNAzyme Sensors
2.12. Detection of V. harveyi in Actual Samples by the Dual DNAzyme Sensor
2.13. Data Analysis
3. Results
3.1. Screening of DNAzyme Activity
3.2. Optimization of DVh3+1 Reaction Conditions
3.3. Specificity Analysis of DVh3+1
3.4. Sensitivity of DVh3+1
3.5. Identification of the Target of DVh3+1
3.6. Effects of RNases
3.7. Design of Dual DNAzyme DVh3+1 Sensor
3.8. Detection of V. harveyi Infection in Four Actual Samples by Dual DNAzyme DVh3+1 Sensors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nguyen, H.T.; Thu Nguyen, T.T.; Tsai, M.A.; Ya-Zhen, E.; Wang, P.C.; Chen, S.C. A formalin-inactivated vaccine provides good protection against Vibrio harveyi infection in orange-spotted grouper (Epinephelus coioides). Fish Shellfish Immunol. 2017, 65, 118–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Montanchez, I.; Kaberdin, V.R. Vibrio harveyi A brief survey of general characteristics and recent epidemiological traits associated with climate change. Mar. Environ. Res. 2020, 154, 104850. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.-H.; He, X.; Austin, B. Vibrio harveyi: A serious pathogen of fish and invertebrates in mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef] [Scilit]
- Gan, L.; Zheng, J.; Xu, W.-H.; Lin, J.; Liu, J.; Zhang, Y.; Wu, Z.; Lv, Z.; Jia, Y.; Guo, Q.; et al. Deciphering the virulent Vibrio harveyi causing spoilage in muscle of aquatic crustacean Litopenaeus vannamei. Sci. Rep. 2022, 12, 16296. [Google Scholar] [CrossRef] [Scilit]
- Dubert, J.; Nelson, D.R.; Spinard, E.J.; Kessner, L.; Gomez-Chiarri, M.; Costa, F.d.; Prado, S.; Barja, J.L. Following the infection process of vibriosis in Manila clam (Ruditapes philippinarum) larvae through GFP-tagged pathogenic Vibrio species. J. Invertebr. Pathol. 2016, 133, 27–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kah Sem, N.A.D.; Abd Gani, S.; Chong, C.M.; Natrah, I.; Shamsi, S. Management and Mitigation of Vibriosis in Aquaculture: Nanoparticles as Promising Alternatives. Int. J. Mol. Sci. 2023, 24, 12542. [Google Scholar] [CrossRef] [Scilit]
- Yu, G.; Yu, H.; Yang, Q.; Wang, J.; Fan, H.; Liu, G.; Wang, L.; Bello, B.K.; Zhao, P.; Zhang, H.; et al. Vibrio harveyi infections induce production of proinflammatory cytokines in murine peritoneal macrophages via activation of p38 MAPK and NF-κB pathways, but reversed by PI3K/AKT pathways. Dev. Comp. Immunol. 2022, 127, 104292. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhang, J.; Wen, Y. An efficient DNAzyme-based DNA scaffold for label-free and sensitive bacterial pathogen detection. Anal. Biochem. 2023, 666, 115076. [Google Scholar] [CrossRef] [Scilit]
- Mougin, J.; Roquigny, R.; Travers, M.-A.; Grard, T.; Bonnin-Jusserand, M.; Le Bris, C. Development of a mreB-targeted real-time PCR method for the quantitative detection of Vibrio harveyi in seawater and biofilm from aquaculture systems. Aquaculture 2020, 525, 735337. [Google Scholar] [CrossRef] [Scilit]
- Willner, I.; Shlyahovsky, B.; Zayats, M.; Willner, B. DNAzymes for sensing, nanobiotechnology and logic gate applications. Chem. Soc. Rev. 2008, 37, 1153–1165. [Google Scholar] [CrossRef] [Scilit]
- Liu, R.; McConnell, E.M.; Li, J.; Li, Y. Advances in functional nucleic acid based paper sensors. J. Mater. Chem. B 2020, 8, 3213–3230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McConnell, E.M.; Cozma, I.; Mou, Q.; Brennan, J.D.; Lu, Y.; Li, Y. Biosensing with DNAzymes. Chem. Soc. Rev. 2021, 50, 8954–8994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, M.; Bai, W.; Zhu, C.; Huang, Y.; Yan, J.; Chen, A. Design of nuclease-based target recycling signal amplification in aptasensors. Biosens. Bioelectron. 2016, 77, 613–623. [Google Scholar] [CrossRef] [Scilit]
- Micura, R.; Höbartner, C. Fundamental studies of functional nucleic acids: Aptamers, riboswitches, ribozymes and DNAzymes. Chem. Soc. Rev. 2020, 49, 7331–7353. [Google Scholar] [CrossRef] [Scilit]
- Breaker, R.R.; Joyce, G.F. A DNA enzyme that cleaves RNA. Chem. Biol. 1994, 1, 223–229. [Google Scholar] [CrossRef] [Scilit]
- Yi, D.; Zhao, H.; Zhao, J.; Li, L. Modular Engineering of DNAzyme-Based Sensors for Spatioselective Imaging of Metal Ions in Mitochondria. J. Am. Chem. Soc. 2022, 145, 1678–1685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yun, W.; Zhong, H.; Zheng, S.; Wang, R.; Yang, L. Simple, one-step and amplified Hg2+ detection strategy based on DNAzyme motor. Sens. Actuators B Chem. 2018, 277, 456–461. [Google Scholar] [CrossRef] [Scilit]
- Deng, Y.; Chen, Y.; Zhou, X. Simultaneous Sensitive Detection of Lead(II), Mercury(II) and Silver Ions Using a New Nucleic Acid-Based Fluorescence Sensor. Acta Chim. Slov. 2018, 65, 271–277. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Liu, C.; He, L.; Liu, J.; Li, L.; Yang, S.; Tan, Y.; Liu, X.; Xiao, X. A Cascade Signal Amplification Strategy for the Ultrasensitive Fluorescence Detection of Cu2+ via λ-Exonuclease-Assisted Target Recycling with Mismatched Catalytic Hairpin Assembly. Biosensors 2023, 13, 918. [Google Scholar] [CrossRef] [Scilit]
- Yu, M.; He, T.; Wang, Q.; Cui, C. Unraveling the Possibilities: Recent Progress in DNA Biosensing. Biosensors 2023, 13, 889. [Google Scholar] [CrossRef] [Scilit]
- Yun, W.; Jiang, J.; Cai, D.; Wang, X.; Sang, G.; Liao, J.; Lu, T.; Yan, K. Ultrasensitive electrochemical detection of UO22+ based on DNAzyme and isothermal enzyme-free amplification. RSC Adv. 2016, 6, 3960–3966. [Google Scholar] [CrossRef] [Scilit]
- Aguirre, S.D.; Ali, M.M.; Salena, B.J.; Li, Y. A sensitive DNA enzyme-based fluorescent assay for bacterial detection. Biomolecules 2013, 3, 563–577. [Google Scholar] [CrossRef] [Scilit]
- Ali, M.M.; Wolfe, M.; Tram, K.; Gu, J.; Filipe, C.D.M.; Li, Y.; Brennan, J.D. A DNAzyme-Based Colorimetric Paper Sensor for Helicobacter pylori. Angew. Chem. Int. Ed. 2019, 58, 9907–9911. [Google Scholar] [CrossRef] [Scilit]
- Shen, Z.; Wu, Z.; Chang, D.; Zhang, W.; Tram, K.; Lee, C.; Kim, P.; Salena, B.J.; Li, Y. A Catalytic DNA Activated by a Specific Strain of Bacterial Pathogen. Angew. Chem. Int. Ed. 2015, 55, 2431–2434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rothenbroker, M.; McConnell, E.M.; Gu, J.; Urbanus, M.L.; Samani, S.E.; Ensminger, A.W.; Filipe, C.D.M.; Li, Y. Selection and Characterization of an RNA-Cleaving DNAzyme Activated by Legionella pneumophila. Angew. Chem. Int. Ed. 2021, 60, 4782–4788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, L.; Yan, W.; Wu, H.; Fan, S.; Ren, W.; Wang, S.; Lyu, M.; Liu, J. Selection of DNAzymes for Sensing Aquatic Bacteria: Vibrio Anguillarum. Anal. Chem. 2019, 91, 7887–7893. [Google Scholar] [CrossRef] [Scilit]
- Ali, M.M.; Slepenkin, A.; Peterson, E.; Zhao, W. A Simple DNAzyme-Based Fluorescent Assay for Klebsiella pneumoniae. ChemBioChem 2019, 20, 906–910. [Google Scholar] [CrossRef] [Scilit]
- Miao, Q.; Ding, W.; Bao, X.; Wang, S.; Lin, Q.; Xu, Y.; Lu, J.; Lyu, M.; Wang, S. An efficient DNAzyme for the fluorescence detection of Vibrio cholerae. Food Sci. Nutr. 2023, 11, 3235–3245. [Google Scholar] [CrossRef] [Scilit]
- Zeng, H.; Huang, S.; Chen, Y.; Chen, M.; He, K.; Fu, C.; Wang, Q.; Zhang, F.; Wang, L.; Xu, X. Label-Free Sequence-Specific Visualization of LAMP Amplified Salmonella via DNA Machine Produces G-Quadruplex DNAzyme. Biosensors 2023, 13, 503. [Google Scholar] [CrossRef] [Scilit]
- Yue, G.; Huang, D.; Luo, F.; Guo, L.; Qiu, B.; Lin, Z.; Chen, G. Highly selective fluorescence sensor for hydrogen sulfide based on the Cu(II)-dependent DNAzyme. J. Lumin. 2019, 207, 369–373. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Wu, J.; Ao, H.; Fu, J.; Qiao, B.; Wu, Q.; Ju, H. A Rolling Circle-Amplified G-Quadruplex/Hemin DNAzyme for Chemiluminescence Immunoassay of the SARS-CoV-2 Protein. Anal. Chem. 2021, 93, 9933–9938. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Luan, Y.; Xiong, M.; Zhang, J.; Lake, R.; Lu, Y. DNAzyme Amplified Aptasensing Platform for Ochratoxin A Detection Using a Personal Glucose Meter. ACS Appl. Mater. Interfaces 2021, 13, 9472–9481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kirichenko, A.; Bryushkova, E.; Dedkov, V.; Dolgova, A. A Novel DNAzyme-Based Fluorescent Biosensor for Detection of RNA-Containing Nipah Henipavirus. Biosensors 2023, 13, 252. [Google Scholar] [CrossRef] [Scilit]
- Guan, Y.; Ma, J.; Neng, J.; Yang, B.; Wang, Y.; Xing, F. A Novel and Label-Free Chemiluminescence Detection of Zearalenone Based on a Truncated Aptamer Conjugated with a G-Quadruplex DNAzyme. Biosensors 2023, 13, 118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hammond, S.M.; Aartsma-Rus, A.; Alves, S.; Borgos, S.E.; Buijsen, R.A.M.; Collin, R.W.J.; Covello, G.; Denti, M.A.; Desviat, L.R.; Echevarría, L.; et al. Delivery of oligonucleotide-based therapeutics: Challenges and opportunities. EMBO Mol. Med. 2021, 13, 13243. [Google Scholar] [CrossRef] [Scilit]
- Eicher, A.-C.; Dobler, D.; Kiselmann, C.; Schmidts, T.; Runkel, F. Dermal delivery of therapeutic DNAzymes via chitosan hydrogels. Int. J. Pharm. 2019, 563, 208–216. [Google Scholar] [CrossRef] [Scilit]
- Setlem, K.; Mondal, B.; Shylaja, R.; Parida, M. Dual Aptamer-DNAzyme based colorimetric assay for the detection of AFB1 from food and environmental samples. Anal. Biochem. 2020, 608, 113874. [Google Scholar] [CrossRef] [Scilit]
- Medina, A.; Mancera, J.M.; Martínez-Manzanares, E.; Moriñigo, M.A.; Arijo, S. Identification of Vibrio harveyi proteins involved in the specific immune response of Senegalese sole (Solea senegalensis, Kaup). Fish Shellfish Immunol. 2015, 47, 377–380. [Google Scholar] [CrossRef] [Scilit]
- Costa, C.; Ferreira, G.D.; Simoes, M.; Silva, J.L.; Campos, M.J. Real-Time PCR Protocol for Detection and Quantification of Three Pathogenic Members of the Vibrionaceae Family. Microorganisms 2022, 10, 2060. [Google Scholar] [CrossRef] [Scilit]
- Sithigorngul, P.; Rukpratanporn, S.; Pecharaburanin, N.; Suksawat, P.; Longyant, S.; Chaivisuthangkura, P.; Sithigorngul, W. A simple and rapid immunochromatographic test strip for detection of pathogenic isolates of Vibrio harveyi. J. Microbiol. Methods 2007, 71, 256–264. [Google Scholar] [CrossRef] [Scilit]
- Cano-Gomez, A.; Høj, L.; Owens, L.; Baillie, B.K.; Andreakis, N. A multiplex PCR-based protocol for identification and quantification of Vibrio harveyi-related species. Aquaculture 2015, 437, 195–200. [Google Scholar] [CrossRef] [Scilit]
- Cao, Y.T.; Wu, Z.H.; Jian, J.C.; Lu, Y.S. Evaluation of a loop-mediated isothermal amplification method for the rapid detection of Vibrio harveyi in cultured marine shellfish. Lett. Appl. Microbiol. 2010, 51, 24–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J.; Gao, X.; Qun, J.; Du, X.; Bi, K.; Zhang, X.; Lin, L. Comparative analysis of the survival and gene expression of pathogenic strains Vibrio harveyi after starvation. FEMS Microbiol. Lett. 2016, 363, fnw250. [Google Scholar] [CrossRef] [Scilit] [PubMed]











| Name | Oligonucleotide Sequences (5′-3′) |
|---|---|
| Lib | Phosp-GACATTACGGGGGCGTAATG-N40-GCATCTGTAGCGTAGTGTCG |
| FP | Biotin-CTACAGATGCTrAGACATTACGGGGGC |
| RP | CGACACTACGCTACAGATGC |
| DVh1 | GCCCCCGTAATGTCATGTAGCCGCAGGCGCCATCATGTTGCACCCTAAGGGATTGCATCTGTAGCGTAGTGTCG-Q |
| DVh3 | GCCCCCGTAATGTCAAGGTCCCGCAGGGGCTTTCACTTCGTCCCTGTATGTTTCGCATCTGTAGCGTAGTGTCG-Q |
| Substrate | FAM-CGACACTACGCTACAGATGCTrAGACATTACGGGGGC |
| Name | Number of Sequences | Percentage of Total Sequence | Randomized Sequence of Regions (N40, 5′-3′) |
|---|---|---|---|
| DVh1 | 23824 | 26.17% | ATGTAGCCGCAGGCGCCATCATGTTGCACCCTAAGGGATT |
| DVh2 | 20002 | 21.97% | ACTAATGTGCGAAGCTCGTTAGTTCTACGCACGCGTAATG |
| DVh3 | 9739 | 10.7% | AAGGTCCCGCAGGGGCTTTCACTTCGTCCCTGTATGTTTC |
| DVh4 | 6072 | 6.7% | GGGGCGCAACGCGCCTACCTTTCGACGTCCGGCGATGTTA |
| DVh5 | 2961 | 3.25% | AGGAAAGGAACTGCGCTCGGTCGACCTTAACGTAGTGGCC |
| DVh6 | 1507 | 1.66% | ACTAACGTGCGAAGCTCGTTAGTTCTACGCACGCGTAATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Zhang, S.; Jiang, W.; Wang, Y.; Liu, M.; Lyu, M.; Wang, S. Enhanced Detection of Vibrio harveyi Using a Dual-Composite DNAzyme-Based Biosensor. Biosensors 2024, 14, 548. https://doi.org/10.3390/bios14110548
Li S, Zhang S, Jiang W, Wang Y, Liu M, Lyu M, Wang S. Enhanced Detection of Vibrio harveyi Using a Dual-Composite DNAzyme-Based Biosensor. Biosensors. 2024; 14(11):548. https://doi.org/10.3390/bios14110548
Chicago/Turabian StyleLi, Siying, Shuai Zhang, Weihong Jiang, Yuying Wang, Mingwang Liu, Mingsheng Lyu, and Shujun Wang. 2024. "Enhanced Detection of Vibrio harveyi Using a Dual-Composite DNAzyme-Based Biosensor" Biosensors 14, no. 11: 548. https://doi.org/10.3390/bios14110548
APA StyleLi, S., Zhang, S., Jiang, W., Wang, Y., Liu, M., Lyu, M., & Wang, S. (2024). Enhanced Detection of Vibrio harveyi Using a Dual-Composite DNAzyme-Based Biosensor. Biosensors, 14(11), 548. https://doi.org/10.3390/bios14110548

