Multiplex Portable Biosensor for Bacteria Detection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Apparatus
2.3. Procedures
2.3.1. Molybdenum Disulfide (MoS2) Flake Synthesis
2.3.2. Thionine Functionalized Carbon Nanodot (Ty-CD) Synthesis
2.3.3. DNA Solution Preparation
2.3.4. Biosensor Platform Development
Nanostructuring the Screen-Printed Electrode (SPE) Array
DNA Capture Probe Immobilization
Hybridization Reaction and Electrochemical Detection
Biosensor Selectivity Analysis
2.3.5. Multiplex Potentiostat Design and Development
Main Controller Board
Data Acquisition Board
Software Design
Communications Module
Control Module
- Multiplexer (PCA9548): The control module configures the multiplexer to select the desired channel corresponding to a specific signal conditioner on the data acquisition board. This allows the system to select which signal conditioner to expose for measurement, allowing the analysis of up to 8 samples simultaneously; simultaneously refers to obtaining all results at the end of the same operational window.
- Signal conditioner (LMP91000): The control module configures internal registers of the signal conditioner based on the operator’s commands. This configuration includes:
- 2.1
- Transimpedance control register (TIACN): Sets the amplifier gain (RTIA) and load resistance (RLOAD).
- 2.2
- Reference control register (REFCN): Determines the voltage reference (Vref) source (internal or external), sets the internal zero value as a percentage of Vref, and configures the bias sign and value as a percentage of Vref.
- 2.3
- Mode control register (MODECN): Enables or disables the FET feature and selects the operation mode of the sensor.
- 3.
- DAC (digital-to-analogue converter): The DAC integrated circuit on the data acquisition board has a single register that the control module must configure. This register sets the desired output voltage, which will be used as the Vref (reference voltage) for the signal conditioner. A variable voltage reference makes the device very flexible, as it can be configured to analyze a large diversity of samples.
- 4.
- ADC (analogue-to-digital converter): The ADC integrated circuit on the data acquisition board also requires configuration, however, these settings are handled automatically and are not accessible for operator modification. The control module ensures that the ADC is properly calibrated and set up during system start-up, allowing it to convert the analogue signal obtained from the signal conditioner accurately.
Digital Filter Module
Data Acquisition Module
User Web Interface Module
3. Results
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.-A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne Illness Acquired in the United States—Major Pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef] [PubMed]
- Bakhshandeh, B.; Sorboni, S.G.; Haghighi, D.M.; Ahmadi, F.; Dehghani, Z.; Badiei, A. New Analytical Methods Using Carbon-Based Nanomaterials for Detection of Salmonella Species as a Major Food Poisoning Organism in Water and Soil Resources. Chemosphere 2022, 287, 132243. [Google Scholar] [CrossRef] [PubMed]
- Qi, W.; Zheng, L.; Wang, S.; Huang, F.; Liu, Y.; Jiang, H.; Lin, J. A Microfluidic Biosensor for Rapid and Automatic Detection of Salmonella Using Metal-Organic Framework and Raspberry Pi. Biosens. Bioelectron. 2021, 178, 113020. [Google Scholar] [CrossRef] [PubMed]
- Conteduca, D.; Brunetti, G.; Dell’Olio, F.; Armenise, M.N.; Krauss, T.F.; Ciminelli, C. Monitoring of Individual Bacteria Using Electro-Photonic Traps. Biomed. Opt. Express 2019, 10, 3463. [Google Scholar] [CrossRef]
- Tardif, M.; Jager, J.-B.; Marcoux, P.R.; Uchiyamada, K.; Picard, E.; Hadji, E.; Peyrade, D. Single-Cell Bacterium Identification with a SOI Optical Microcavity. Appl. Phys. Lett. 2016, 109, 133510. [Google Scholar] [CrossRef]
- Di Toma, A.; Brunetti, G.; Chiriacò, M.S.; Ferrara, F.; Ciminelli, C. A Novel Hybrid Platform for Live/Dead Bacteria Accurate Sorting by On-Chip DEP Device. IJMS 2023, 24, 7077. [Google Scholar] [CrossRef]
- Li, F.; Ye, Q.; Chen, M.; Zhou, B.; Zhang, J.; Pang, R.; Xue, L.; Wang, J.; Zeng, H.; Wu, S.; et al. An Ultrasensitive CRISPR/Cas12a Based Electrochemical Biosensor for Listeria Monocytogenes Detection. Biosens. Bioelectron. 2021, 179, 113073. [Google Scholar] [CrossRef]
- Sannigrahi, S.; Kumar, A.S.; Mathiyarasu, J.; Suthindhiran, K. Detection of Escherichia Coli in Food Samples by Magnetosome-Based Biosensor. Biotechnol. Bioprocess Eng. 2023, 28, 152–161. [Google Scholar] [CrossRef]
- Zamzami, M.; Alamoudi, S.; Ahmad, A.; Choudhry, H.; Khan, M.I.; Hosawi, S.; Rabbani, G.; Shalaan, E.-S.; Arkook, B. Direct Identification of Label-Free Gram-Negative Bacteria with Bioreceptor-Free Concentric Interdigitated Electrodes. Biosensors 2023, 13, 179. [Google Scholar] [CrossRef]
- Zamzami, M.A.; Rabbani, G.; Ahmad, A.; Basalah, A.A.; Al-Sabban, W.H.; Nate Ahn, S.; Choudhry, H. Carbon Nanotube Field-Effect Transistor (CNT-FET)-Based Biosensor for Rapid Detection of SARS-CoV-2 (COVID-19) Surface Spike Protein S1. Bioelectrochemistry 2022, 143, 107982. [Google Scholar] [CrossRef]
- Rabbani, G.; Khan, M.E.; Ahmad, E.; Khan, M.V.; Ahmad, A.; Khan, A.U.; Ali, W.; Zamzami, M.A.; Bashiri, A.H.; Zakri, W. Serum CRP Biomarker Detection by Using Carbon Nanotube Field-Effect Transistor (CNT-FET) Immunosensor. Bioelectrochemistry 2023, 153, 108493. [Google Scholar] [CrossRef]
- Chen, X.; McGlynn, C.; McDonald, A.R. Two-Dimensional MoS 2 Catalyzed Oxidation of Organic Thiols. Chem. Mater. 2018, 30, 6978–6982. [Google Scholar] [CrossRef]
- Giovanelli, E.; Castellanos-Gomez, A.; Pérez, E.M. Surfactant-Free Polar-to-Nonpolar Phase Transfer of Exfoliated MoS2 Two-Dimensional Colloids. ChemPlusChem 2017, 82, 732–741. [Google Scholar] [CrossRef]
- Pina-Coronado, C.; Martínez-Sobrino, Á.; Gutiérrez-Gálvez, L.; Del Caño, R.; Martínez-Periñán, E.; García-Nieto, D.; Rodríguez-Peña, M.; Luna, M.; Milán-Rois, P.; Castellanos, M.; et al. Methylene Blue Functionalized Carbon Nanodots Combined with Different Shape Gold Nanostructures for Sensitive and Selective SARS-CoV-2 Sensing. Sens. Actuators B Chem. 2022, 369, 132217. [Google Scholar] [CrossRef]
- Chai, H.; Cheng, W.; Jin, D.; Miao, P. Recent Progress in DNA Hybridization Chain Reaction Strategies for Amplified Biosensing. ACS Appl. Mater. Interfaces 2021, 13, 38931–38946. [Google Scholar] [CrossRef]
- Martínez-Periñán, E.; García-Mendiola, T.; Enebral-Romero, E.; del Caño, R.; Vera-Hidalgo, M.; Vázquez Sulleiro, M.; Navío, C.; Pariente, F.; Pérez, E.M.; Lorenzo, E. A MoS2 Platform and Thionine-Carbon Nanodots for Sensitive and Selective Detection of Pathogens. Biosens. Bioelectron. 2021, 189, 113375. [Google Scholar] [CrossRef]
- Zuo, L.; Islam, S.K.; Mahbub, I.; Quaiyum, F. A Low-Power 1-V Potentiostat for Glucose Sensors. IEEE Trans. Circuits Syst. II 2015, 62, 204–208. [Google Scholar] [CrossRef]
- Colomer-Farrarons, J.; Miribel-Català, P.L. A CMOS Self-Powered Front-End Architecture for Subcutaneous Event-Detector Devices; Springer Netherlands: Dordrecht, The Netherlands, 2011; ISBN 978-94-007-0685-9. [Google Scholar]
- Ariza, J.Á.; Baez, H. Understanding the Role of Single-board Computers in Engineering and Computer Science Education: A Systematic Literature Review. Comput. Appl. Eng. Educ. 2022, 30, 304–329. [Google Scholar] [CrossRef]
- Vázquez Sulleiro, M.; Develioglu, A.; Quirós-Ovies, R.; Martín-Pérez, L.; Martín Sabanés, N.; Gonzalez-Juarez, M.L.; Gómez, I.J.; Vera-Hidalgo, M.; Sebastián, V.; Santamaría, J.; et al. Fabrication of Devices Featuring Covalently Linked MoS2–Graphene Heterostructures. Nat. Chem. 2022, 14, 695–700. [Google Scholar] [CrossRef]
- Del Pozo, M.V.; Alonso, C.; Pariente, F.; Lorenzo, E. DNA Biosensor for Detection of Helicobacter Pylori Using Phen-Dione as the Electrochemically Active Ligand in Osmium Complexes. Anal. Chem. 2005, 77, 2550–2557. [Google Scholar] [CrossRef]
- A Comparative Analysis of Raspberry Pi Hardware with Adruino, Phidgets, Beaglebone Black and Udoo, International Research Journal of Engineering and Technology (IRJET). Available online: https://www.irjet.net/archives/V3/i6/IRJET-V3I6299.pdf (accessed on 20 July 2023).
- Valera, A.; Soriano, A.; Vallés, M. Plataformas de Bajo Coste para la Realización de Trabajos Prácticos de Mecatrónica y Robótica. Rev. Iberoam. De Automática E Informática Ind. 2014, 11, 363–376. [Google Scholar] [CrossRef]
- Embedded Linux Board Comparison, Adafruit Industries. Available online: https://cdn-learn.adafruit.com/dowloads/pdf/embedded-linux-board-comparasion.pdf (accessed on 20 July 2023).
- Understanding the I2C Bus, Texas Instruments Application Report SLVA704. Available online: https://www.ti.com/lit/pdf/slva704 (accessed on 20 July 2023).
- Schafer, R. What Is a Savitzky-Golay Filter? [Lecture Notes]. IEEE Signal Process. Mag. 2011, 28, 111–117. [Google Scholar] [CrossRef]
- Press, W.H.; Teukolsky, S.A. Savitzky-Golay Smoothing Filters. Comput. Phys. 1990, 4, 669–672. [Google Scholar] [CrossRef]
- Krishnan, S.R.; Seelamantula, C.S. On the Selection of Optimum Savitzky-Golay Filters. IEEE Trans. Signal Process. 2013, 61, 380–391. [Google Scholar] [CrossRef]
- Sadeghi, M.; Behnia, F. Optimum Window Length of Savitzky-Golay Filters with Arbitrary Order. arXiv 2018, arXiv:1808.10489. [Google Scholar] [CrossRef]
- Sadıkoglu, F.; Kavalcıoğlu, C. Filtering Continuous Glucose Monitoring Signal Using Savitzky-Golay Filter and Simple Multivariate Thresholding. Procedia Comput. Sci. 2016, 102, 342–350. [Google Scholar] [CrossRef]
- Smith, D.R. Time-Division Multiplexing. In Digital Transmission Systems; Springer US: Boston, MA, USA, 2004; pp. 177–257. ISBN 978-1-4613-4726-2. [Google Scholar]
- Horcas, I.; Fernández, R.; Gómez-Rodríguez, J.M.; Colchero, J.; Gómez-Herrero, J.; Baro, A.M. WSXM: A Software for Scanning Probe Microscopy and a Tool for Nanotechnology. Rev. Sci. Instrum. 2007, 78, 013705. [Google Scholar] [CrossRef] [PubMed]
Synthetic DNA Sequences | ||
---|---|---|
Listeria probe | 5′-[SH-C6 H12]-CCTAGCAGGTCTAACCGCACTCACT | List-SH |
Salmonella probe | 5′-[SH-C6 H12]-GCCGCGCGCGAACGGCGAAGCGTAC | Salm-SH |
Listeria target | AGTGAGTGCGGTTAGACCTGCTAGG | List-C |
Salmonella target | GTACGCTTCGCCGTTCGCGCGCGGC | Salm-C |
Probe-FAM | 5′-[SH-C6H12]-CCATAACCTTTCCATTTTTTTTTTACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA3’-[6-FAM] | SH-Probe-FAM |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaci, K.; Enebral-Romero, E.; Martínez-Periñán, E.; Garrido, M.; Pérez, E.M.; López-Diego, D.; Luna, M.; González-de-Rivera, G.; García-Mendiola, T.; Lorenzo, E. Multiplex Portable Biosensor for Bacteria Detection. Biosensors 2023, 13, 958. https://doi.org/10.3390/bios13110958
Kaci K, Enebral-Romero E, Martínez-Periñán E, Garrido M, Pérez EM, López-Diego D, Luna M, González-de-Rivera G, García-Mendiola T, Lorenzo E. Multiplex Portable Biosensor for Bacteria Detection. Biosensors. 2023; 13(11):958. https://doi.org/10.3390/bios13110958
Chicago/Turabian StyleKaci, Karim, Estefanía Enebral-Romero, Emiliano Martínez-Periñán, Marina Garrido, Emilio M. Pérez, David López-Diego, Mónica Luna, Guillermo González-de-Rivera, Tania García-Mendiola, and Encarnación Lorenzo. 2023. "Multiplex Portable Biosensor for Bacteria Detection" Biosensors 13, no. 11: 958. https://doi.org/10.3390/bios13110958
APA StyleKaci, K., Enebral-Romero, E., Martínez-Periñán, E., Garrido, M., Pérez, E. M., López-Diego, D., Luna, M., González-de-Rivera, G., García-Mendiola, T., & Lorenzo, E. (2023). Multiplex Portable Biosensor for Bacteria Detection. Biosensors, 13(11), 958. https://doi.org/10.3390/bios13110958