Next Article in Journal
AquaVib: Enabling the Separate Evaluation of Effects Induced by Acoustic Pressure and Particle Motion on Aquatic Organisms
Previous Article in Journal
Seasonal Dynamics of Microalgal Biomass and Its Biomethanation Potential: A Case Study from the Bay of Gdansk, Poland
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JMSE
Volume 13
Issue 10
10.3390/jmse13101884
jmse-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Towards Sustainable Aquafeeds: Valorization of Codium sp. and Osmundea sp. as Functional Ingredients to Enhance Nutrient and Bioactive Compounds in European Seabass

by
Inês Guerreiro
1,2,
Filipa Fontinha
1,2,
Marta Monteiro
1,2,
Joana Oliveira
1,2,
Raquel Marçal
3,
Rui Magalhães
1,2,
Mário Pacheco
3,
Mohamed Soula
4,
Aires Oliva-Teles
1,2,*,
Paula Enes
1,2,† and
Ana Couto
1,2,†
1
CIIMAR/CIMAR LA, Centro Interdisciplinar de Investigação Marinha e Ambiental, Universidade do Porto, Terminal de Cruzeiros do Porto de Leixões, Av. General Norton de Matos s/n, 4450-208 Matosinhos, Portugal
2
Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre, Ed. FC4, 4169-007 Porto, Portugal
3
CESAM—Centro de Estudos do Ambiente e do Mar, Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro, Portugal
4
ANFACO–CECOPESCA, Estrada Colexio Universitario, 16, Vigo, 36310 Pontevedra, Spain
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Mar. Sci. Eng. 2025, 13(10), 1884; https://doi.org/10.3390/jmse13101884
Submission received: 2 August 2025 / Revised: 25 September 2025 / Accepted: 27 September 2025 / Published: 1 October 2025
(This article belongs to the Section Marine Aquaculture)
Browse Figures
Versions Notes

Abstract

This study aimed to valorize Codium sp. and Osmundea sp. as functional ingredients for European seabass diets. For this purpose, triplicate groups of 25 fish (20.6 g) were fed, during 8 weeks, one of seven diets: the control (CTR), 5% of Codium and Osmundea ground (diets CO and OS, respectively), 5% of Codium and Osmundea ground and autoclaved (diets COA and OSA, respectively), and 0.5% of Codium and Osmundea polysaccharide extracts (diets COP and OSP, respectively). The same diets were used for a digestibility trial. Fish fed the CO diet presented lower growth and an apparent digestibility coefficient (ADC) for dry matter and protein compared to fish fed the CTR and OS diets. Diet COA counteracted these negative effects. No differences were observed in feed intake, feed efficiency, and lipid ADC. Antioxidant enzyme activities and distal intestine histomorphology, an indicator of gut health, were not affected. The expression of interleukin-1β and interleukin-6 increased in fish fed the COP diet. In conclusion, the processing methods counteracted the negative effects of raw Codium, enhancing its value as a dietary ingredient, while its polysaccharides showed immunomodulatory potential that could be valuable during stress or disease periods. These findings support the valorization of these algae for aquafeeds, with Osmundea being safely included at 5% without processing.

1. Introduction

Aquaculture has experienced steady growth over the years [1]. With this progressive increase, sustainability has become a key concern. In fact, improving fish health and growth could help boost European aquaculture. Despite increases in global aquaculture production, in Europe, fisheries still account for 74% of the total aquatic animal production [2]. A major factor influencing aquaculture sustainability is its reliance on conventional feed resources. Aquaculture growth, therefore, depends on the sustainable production of aquafeeds, which still depend on fisheries (fish meal and oil) and agricultural (e.g., soybean, corn, rapeseed meals) resources [1]. Reducing the dependency on these feedstuffs could significantly improve sustainability by decreasing overfishing, deforestation, land and water use, and carbon emissions, while at the same time boosting the local economy through the valorization of underutilized resources [3].
In this context, locally available macroalgae, such as Codium sp. and Osmundea sp., emerge as a promising alternative. These macroalgae accumulate onshore with minimal use since, although edible and consumed in some regions (e.g., in parts of Asia or Europe (Portugal, Spain, Scotland)), their current use in human diets is still limited. Using them in aquafeeds allows for the development of novel and sustainable ingredients that decrease the pressure on the traditional plant ingredients and fishmeal resources [4,5,6,7]. Moreover, valorizing this biomass for aquafeeds aligns with circular economy principles, transforming an ecological burden into a value-added resource.
Both Codium (green macroalgae) and Osmundea (red macroalgae) exhibit variable macronutrient profiles, with a protein content ranging from 5 to 24%, carbohydrates from 18 to 67%, fibers from 11 to 36%, and lipids from less than 1% up to 7.5%, mainly in the form of saturated and long-chain fatty acids, with Osmundea also being a source of omega-3 polyunsaturated fatty acids [4,6,8,9,10,11,12,13,14,15,16]. The variable nutritional profile of Codium and Osmundea, like those of other macroalgae, is related to the species, developmental stage, season, temperature, salinity, nutrient availability, and geographic location [6,17,18].
Beyond their nutritional value, these macroalgae are also functional ingredients, being a source of bioactive compounds with antioxidant, antibacterial, antiviral, and immunoregulatory properties [6,7,19,20,21,22]. Codium is rich in bioactive compounds such as siphonaxanthin, canthaxanthin, oleamide, and sulfated polysaccharides, which possess, for instance, immunostimulatory, anti-inflammatory, anticoagulant, antioxidant, and antiviral activities [6]. The genus Osmundea is also reported to present biological activity, namely prebiotic, antioxidant, and antimicrobial (antiviral, antiprotozoal, antibacterial, and antifungal) properties [4,5]. Despite their potential as functional ingredients in aquafeeds, this area remains underexplored, and only a few studies on fish are available [23,24,25]. For instance, Codium fragile sulfated polysaccharides demonstrated strong antioxidant activity in zebrafish (Danio rerio) [24] and an immunostimulatory effect in olive flounder (Paralichthys olivaceus) [23], and also reduced the mortality in rockfish (Sebastes schlegelii) infected with Edwardsiella tarda [25].
European seabass (Dicentrarchus labrax) is one of the main species produced in Europe, with high economic importance. It is a predatory fish and, in nature, feeds on small fish, prawns, crabs, and cuttlefish (trophic level 3.5 ± 0.5), while in the aquaculture context, European seabass can be fed with diets containing as little as 5–10% fishmeal [26,27,28,29]. This is the first study to assess Codium and Osmundea as ingredients in European seabass. Only a few studies have evaluated the use of other macroalgae in this species. While some reported that the use of up to 5–8% Gracilaria gracilis did not affect growth performance [30,31,32], others reported that 5% Rugulopteryx okamurae [33,34] or 5% Ulva rigida [35] decreased fish growth performance. This decrease in the growth performance might be due to the complex polysaccharide-rich structure of the macroalgae cellular wall and the presence of antinutrients (phytates, tannins, oxalates, and lectins) that might compromise the nutrient availability, digestibility, and gut morphology [17,36].
To overcome these limitations, several processing techniques have been applied to increase their nutritional value, including physical–mechanical treatments (e.g., vibratory grinding mill, ultrasounds, autoclaving, and microwaves), enzymatic hydrolysis, chemical treatments (acid and alkaline), and fermentation processes [17,33,34,35,37]. Among these, autoclaving, a cost-effective and time-efficient treatment method, has been shown to increase protein and decrease cellulose and hemicellulose content in U. rigida [35]. In addition, autoclaving also inactivated the heat-sensitive antinutritional factors present in Ulva ohnoi, which affected fish digestive proteases [38]. Rainbow trout (Oncorhynchus mykiss) fed autoclaved Ulva meal presented an improved n-3 fatty acid content and protein apparent digestibility coefficient (ADC) when compared with fish fed a control diet, although this was not reflected in growth improvement [39]. Similarly, macroalgae extracts obtained by enzymatic hydrolysis, which disrupt polysaccharides and complex proteins, thus liberating peptides (some with bioactive properties), are a promising strategy to provide additional physiological health benefits to fish [37].
Macroalgae extracts have also been used in European seabass diets; for instance, 0.35% G. gracilis extract [31,40] or 1 and 3% Ulva lactuca extract [41]. Although with a less pronounced effect than the G. gracilis biomass diets, the G. gracilis extract diet improved immune and antioxidant capacity and modulated the gut microbiota by reducing potential pathogens [31,40], while 3% Ulva lactuca extract led to an increase in fish growth rate [41].
Thus, the aim of this study was the valorization of Codium sp. and Osmundea sp. as functional ingredients for European seabass due to their bioactive potential and abundance around Galicia (Spain) and north of Portugal. To increase nutrient and bioactive compound bioavailability, both macroalgae were either submitted to a thermal–pressure (autoclave) treatment or enzymatic hydrolysis for polysaccharide extraction. Their potential was evaluated regarding the effects on growth performance, digestibility, antioxidant enzyme activity, immune-related gene expression, and gut histolomorphology. This work was performed as part of the project 0558_ALGALUP_6_E (Integral alternative for the exploitation of macroalgae in the area of Galicia and Portugal).

2. Materials and Methods

2.1. Codium sp. and Osmundea sp.

Macroalgae, identified to the genus level based on their morphological traits, were collected at the North Coast of Portugal/Galicia, washed with deionized water to remove sand and impurities, and air dried. Thereafter, Codium (4.6% moisture) and Osmundea (9.2% moisture) were ground through 1.0 and 0.5 mm dies, respectively.
A portion of each ground algae was mixed with water (10% w/v) and autoclaved at 121 °C, ≈1.0 bar, for 30 min in an attempt to improve the bioavailability of nutrients and active compounds.
The polysaccharide extracts of Codium and Osmundea were provided by ANFACO (Vigo, Spain). The soluble polysaccharide extracts were obtained by enzymatic hydrolysis. The enzymes used for the hydrolysis of the macroalgae were supplied by a company that produces enzymes for industrial use. Two enzymes were used: one with protease activity and another with cellulase, hemicellulase, and pectinase activity. Due to confidentiality regarding ongoing developments in work with macroalgae, which are subject to industrial protection, more specific information on the enzymes cannot be provided. Enzymatic hydrolysis of the macroalgae was carried out in a thermostatically controlled 5 L glass reactor. Both enzymes were used simultaneously, and, after hydrolysis, the medium was inactivated by heating at 90 °C for 5 min. Subsequently, the non-hydrolyzed solid and the liquid were separated by sieving the medium, centrifuging, and filtering it, and the liquid was fractionated using membranes.

2.2. Experimental Diets

Seven diets were formulated to be isoproteic (42% crude protein) and isolipidic (18% crude lipid). A practical plant-based diet (65% plant feedstuffs; 15% fish meal) without algal inclusion was used as the control (CTR diet). Six other diets were formulated identically to the control but included 5% of ground Codium and Osmundea (diets CO and OS, respectively), 5% of ground and autoclaved Codium and Osmundea (diets COA and OSA, respectively), and 0.5% of Codium and Osmundea polysaccharide extracts (diets COP and OSP, respectively). The inclusion levels (5% whole algae and 0.5% polysaccharide extract) were selected based on values commonly reported in other studies and widely accepted dosages for aquafeeds [25,33,34,35,42,43]. Chromium oxide at 0.5% was added to the diets as an inert marker for digestibility estimation. Algae and algae extracts were added to the diets, replacing wheat meal and α-cellulose, respectively.
Diets were supplemented with dibasic calcium phosphate, methionine, and taurine to avoid phosphorous and amino acid deficiencies, respectively. All dietary ingredients were finely ground, well mixed, and dry pelleted in a laboratory pellet mill (California Pellet Mill, CPM, Crawfordsville, IN, USA) through a 2 mm die. The pellets were then dried in an oven at 40 °C for 24 h and stored at −20 °C in airtight bags until use. Ingredients and proximate composition of the experimental diets are presented in Table 1.

2.3. Ethics Statements

The growth and digestibility trials were approved by the Portuguese National Authority for Animal Health (DGAV; reference ORBEA_CIIMAR_27_2019), directed by accredited scientists (following FELASA category C recommendations), and conducted according to the European Union Directive (2010/63/EU) on the protection of animals for scientific purposes.

2.4. Growth Trial

European seabass juveniles (Dicentrarchus labrax) were obtained from a commercial fish farm (Sonríonansa, Cantabria, Spain) and transported to the Interdisciplinary Centre of Marine and Environmental Research (CIIMAR, University of Porto, Portugal) where the experiment was performed. After transport, fish were submitted to a quarantine period of 15 days, during which they were fed a commercial diet (45% protein and 18% lipids, NEO GOLD BLUE, Sorgal, Ovar, Portugal). Before the growth trial, fish were acclimatized to the experimental system for one month. During this period, fish were fed the commercial diet used during the quarantine period. Thereafter, seven groups in triplicate (21 tanks) of 25 fish with an initial mean body weight of 20.6 ± 0.01 g were established, and the experimental diets were randomly assigned to triplicate tanks. The trial was conducted in a recirculating aquaculture system equipped with 21 fiberglass tanks of 500 L water capacity, thermo-regulated to 22.0 ± 1.0 °C, and supplied with a continuous flow of natural seawater (22.0 ± 1.0 g L−1 salinity, circa 8 mg L−1 oxygen). Ammonia and nitrites were maintained below 0.1 and 0.5 mg L−1, respectively. Water quality parameters (temperature, salinity, oxygen, ammonia, and nitrites) were measured daily. The photoperiod was set to 12 h light and 12 h dark using artificial illumination.
The trial lasted 8 weeks, and fish were fed by hand twice a day, 6 days per week, until apparent visual satiation. Utmost care was taken to avoid feed waste and to assure that all feed supplied was consumed.

2.5. Digestibility Trial

The digestibility trial was carried out in a recirculating water system equipped with 10 fiberglass tanks with 60 L water capacity designed according to Cho et al. [44], with a settling column connected to the outlet of each tank for feces collection. Tanks were supplied with a continuous flow of natural seawater (25.0 ± 1.0 g L−1 salinity, approximately 8 mg L−1 oxygen) thermo-regulated to 22.0 ± 1.0 °C. Ammonia and nitrites were maintained below 0.1 and 0.5 mg L−1, respectively. Water quality parameters (temperature, salinity, oxygen, ammonia, and nitrites) were measured daily. The assigned photoperiod was 12 h light and 12 h dark.
Ten groups of 10 fish with a mean initial body weight of 22.2 ± 1.6 g were randomly distributed to each tank. Diets CTR, CO, COA, OS, and OSA were randomly assigned to duplicate groups. The digestibility of diets COP and OSP was not assessed, since bioactivities described for the polysaccharides present in green and red algae are primarily associated with immunomodulatory, antioxidant, anti-inflammatory, and other bioactive properties, rather than effects on macronutrient digestibility [45].
An initial adaptation phase of 5 days was provided for the fish to become adapted to the experimental diets, during which no fecal samples were collected. This was followed by a 15-day period for feces collection. The feeding and sampling routine was repeated for each diet over two consecutive cycles to allow for result replication. To minimize potential tank-related effects, the allocation of diets to tanks was randomized within each cycle, ensuring that different tanks were used in each period. Each dietary treatment was tested over a 20-day period, with two repetitions conducted (n = 4), over a total of 40 days. During the trial, fish were hand-fed to apparent satiation twice daily, 5 days a week. Fecal sampling occurred once daily, before the morning feeding, by collecting the feces of the settling column. Collected feces from each tank were immediately centrifuged at 3000 g for 10 min and frozen at −20 °C. Prior to analysis, samples were dried at 60 °C until constant weight.

2.6. Sampling

At both the start and end of the growth trial, all fish in each tank were group-weighed following a 24 h fasting period. For the weighing, fish were lightly anesthetized using 0.3 mL L−1 ethylene glycol monophenyl ether. After the final weight measurements, feeding was maintained for an additional 3 days to minimize any stress caused by handling. Subsequently, three fish per tank were sampled 4 h after the morning feeding and euthanized using an overdose of anesthetic to collect (i) a portion of the distal intestine for histological evaluation, (ii) the remaining distal intestine for gene expression analyses, and (iii) the remaining intestine, without pyloric caeca, for antioxidant enzyme measurement. Samples collected for histological evaluation were fixed in phosphate-buffered formalin (4%, pH 7.4) for 24 h and then transferred to 70% ethanol until further processing. Samples for gene expression analyses were later preserved overnight in RNA at 4 °C, and then stored at −80 °C. Finally, samples for antioxidant enzyme measurement were immediately frozen in liquid nitrogen and stored at −80 °C.

2.7. Proximate Analysis

The proximate composition (dry matter, ash, crude protein, and crude lipids) of ingredients, experimental diets, and feces was analyzed according to the Association of Official Analytical Chemists methods [46]. Gross energy content was determined using an oxygen bomb calorimeter (Parr 1281 Calorimeter, Parr Instrument Company, Moline, IL, USA). Chromic oxide in diets and feces was determined by acid digestion according to Furukawa and Tsukahara [47].

2.8. Gene Expression Analysis

Total RNA was extracted from distal intestine samples using a Direct-zol™ RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA) following manufacturer instructions and homogenized using the Precellys 24 homogenizer (Bertin Technologies, Montigny-Le-Bretonneux, France). RNA elution was performed using 25 µL of DEPC-treated water and quality-assessed using μDrop™ Plate (Thermo Scientific, Courtaboeuf, France) in a Multiskan GO Spectrophotometer (Thermo Scientific, Courtaboeuf, France); the integrity of 28S and 18S rRNA bands was verified with electrophoresis. The cDNA was generated from 1 µg of total RNA using the NZY First-Strand cDNA Synthesis Kit (NZYTech, Lisbon, Portugal) following the manufacturer’s protocol.
Gene expression of the pro-inflammatory cytokines interleukine-1-beta (IL-1β), interleukine-6 (IL-6), and tumor necrosis factor-alpha (TNF-α), as well as the anti-inflammatory cytokine, interleukine-10 (IL-10), was determined in the distal intestine using real-time quantitative PCR (CFX Connect™ Real-Time System, Bio-Rad, Berkeley, CA, USA). cDNA amplification was performed using specific PCR primers (Table 2).
Real-time qPCR reactions were performed using 0.5 μL of each primer (final concentration 0.5 μM) and 1 μL cDNA (100 ng per reaction) from each sample in a reaction volume of 10 μL. The specificity of the reactions and the real-time qPCR conditions were as specified in Monteiro et al. [48].
Relative expression of each transcript was normalized to the selected housekeeping gene (18S ribosomal RNA, 18S) due to its expression stability in the intestine and calculated using the Pfaffl method [49].

2.9. Enzymatic Activity

Intestine samples were homogenized (dilution 1:5) in ice-cold phosphate buffer (0.1 M, pH 7.4). Homogenates were centrifuged at 12,000 rpm for 20 min at 4 °C, the resultant supernatant was collected, and aliquots were used to measure superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6), and glutathione reductase (GR; EC 1.6.4.2) activities, as described by Carvalhais et al. [50].
Protein concentration in the homogenates was determined according to Bradford [51] using Bio-Rad Protein Assay Dye Reagent (ref. 5000006, Amadora, Portugal) with bovine serum albumin as standard. All enzymatic assays were carried out at 25 °C in a Multiskan GO Microplate Reader (Model 5111 9200; Thermo Scientific, Nanjing, China).

2.10. Histological Processing and Morphological Evaluation

Samples of the distal intestine were prepared and sectioned following conventional histological procedures, then stained with hematoxylin and eosin for microscopic evaluation. A blinded evaluation was conducted with a specific focus on inflammatory changes [52,53], particularly villi length, widening of the lamina propria and submucosa, the presence of goblet cells, leukocyte infiltration within both the lamina propria and submucosa, and structural alterations in enterocytes, including supranuclear vacuolization. Distal intestine samples were evaluated using a continuous scoring system ranging from 0 to 5, with 5 indicating major alterations, as described by Penn et al. [54]. Images were acquired with Zen software (Blue edition, Carl Zeiss, Jena, Germany).

2.11. Statistical Analysis

Before analyses, all data were tested for normality (Shapiro–Wilk test) and homogeneity (Levene test). The experimental unit considered was the tank for growth performance, gene expression, antioxidant enzymes, and histomorphology (n = 3), as well as for diet digestibility (n = 4). All data, with the exception of histology, were analyzed by One-way Analysis of Variance (ANOVA), with the dietary treatment as a factor. Tukey’s multiple range tests were performed to determine significant differences between means. Histological data were analyzed by Kruskal–Wallis nonparametric tests and subsequent pairwise comparisons since the data were neither normal nor homogeneous and could not be normalized. A significant level of 0.05 was used for the rejection of the null hypothesis. All statistical analysis was performed using SPSS 27.0 software package for Windows (IBM® SPSS® Statistics, New York, NY, USA). Gene expression graphs were created using GraphPad Prism version 10.6.0 (GraphPad Software, San Diego, CA, USA).

3. Results

A decrease of fish final body weight and daily growth index was observed in fish fed with the CO diet compared with fish fed the CTR and OS diets (Table 3). No statistically significant effect of diet composition was observed in feed intake (p = 0.05), feed efficiency, protein efficiency ratio, and survival.
The ADC of dry matter was lower in fish fed the CO diet compared with the CTR and OS groups (Table 4). Diet OSA led to lower ADC of dry matter than the CTR diet. Concerning the ADC of protein, diets CO and COA showed lower values compared with the CTR diet, and diet CO had a lower value than diet OS. Energy ADC was lower in fish fed diet COA compared with fish fed diets CTR and CO. Lipid ADC was not affected by diet composition.
Intestinal antioxidant enzymes, namely SOD, CAT, and GR activities, were not affected by diet composition (Table 5). Similarly, no effect was observed on the histomorphology of the distal intestine (Table 6; Figure 1).
Diet composition did not significantly affect tnf-α and il-10 gene expression (Figure 2). Fish fed diet COP presented an increased expression of il-1β and il-6 when compared with fish fed OS and OSP diets.

4. Discussion

Macroalgae are recognized as a good source of bioactive compounds [19,20,21]. Nonetheless, several studies reported negative impacts on fish performance when macroalgae are included at levels higher than 10% [55,56,57,58,59,60]. Meanwhile, in European seabass, macroalgae incorporation even at lower levels (5–8%) provided contradictory outputs, with some studies suggesting no effects on growth performance [30,31,32] and others reporting a decreased fish growth performance [33,34,35]. In this present study, the use of 5% Osmundea did not affect growth performance, while 5% Codium significantly decreased European seabass growth. Several hypotheses were already advanced in previous studies to explain the lower growth when fish were fed macroalgae, such as lower feed intake [58]; low nutritive value of the macroalgae [55], probably connected with high fiber and non-starch polysaccharide content [36]; or the presence of antinutritional factors that decrease the nutritional quality and nutrient digestion/absorption [56,57,58,61]. Modified feed palatability does not seem to be the case since fish fed the CO diet presented similar feed intake as fish fed the other dietary treatments. On the other hand, several macroalgae (Porphyra dioica, Ulva spp., Gracilaria vermiculophylla, and Sargassum muticum) decreased diet digestibility in rainbow trout and Nile tilapia (Oreochromis niloticus) [62]. Nonetheless, while only dry matter and protein digestibility were affected by dietary Codium in this present study, in rainbow trout and Nile tilapia lower dry matter, protein, lipid, and energy digestibility was generally observed with the tested macroalgae (Porphyra dioica, Ulva spp., Gracilaria vermiculophylla, and Sargassum muticum) [62]. This could probably be related to the higher macroalgae incorporation level, 30% against the 5% of this present study. In addition, the lack of negative effects on digestibility caused by Osmundea can be related to the lower fiber content (21% [63]) when compared with the level present in Codium (32% [63]). Supporting the presence of antinutrients that could affect nutrient digestion/absorption, the COA diet was able to counteract the observed decreased dry matter digestibility of the CO diet. This was also reflected in the final weight of European seabass fed the COA diet that was not significantly different from the fish fed the CTR diet. This suggests that heat-sensitive antinutrients were at least partially inactivated by autoclaving. Nonetheless, the presence of antinutrients in the CO diet was not enough to elicit alterations in the histomorphology of the intestine. Several antinutrients are known to affect growth and diet digestibility, such as tannins, protease inhibitors, and phytic acid [64,65]. Although not measured in this current study, the decreased digestibility and growth performance observed in fish fed the CO diet might be related to the presence of protease inhibitors. Protease inhibitors are reported to affect growth and digestion while usually not being associated with intestinal inflammation and have been reported to be present in U. ohnoi and Enteromorpha spp., two green algae like Codium [38,65]. Vizcaíno et al. [38] studied the presence of protease inhibitors in the macroalga U. ohnoi and their inhibitory effect on the digestive proteases of gilthead seabream (Sparus aurata), Senegalese sole (Solea senegalensis), and European seabass. The protease inhibitors were able to inhibit up to 70% of the proteolytic activity in sole and 65% in the other two fish species. Interestingly, it was also found that the autoclaved Ulva reduced the inhibitory capacity to less than 20% inhibition [38]. This finding is consistent with this present study’s results, where the COA diet was able to mitigate the negative effects observed in fish fed the CO diet. Nonetheless, improved digestibility from autoclaving may come at the cost of losing thermolabile bioactive compounds with antioxidant and immunostimulatory properties [17,66]. As for energy ADC, although it was lower in fish fed the COA diet, it cannot be considered a true biological effect since all the dietary treatments led to a digestibility of 99.79% (COA diet) or higher. Currently, there is no strong evidence supporting the presence of protease inhibitors in red macroalgae, including Osmundea, as is reported for the green algae group [38,64]. This may partially explain the lack of negative effects on digestibility and growth in fish fed the OS diet.
Although both Codium and Osmundea have been reported to present bioactive compounds with antioxidant and immunoregulatory properties [4,5,6,7], in this present study, none of the measured antioxidant enzymes were affected by the dietary treatments. To the authors’ knowledge, this present study is the first to incorporate Osmundea in fish feeds, and besides the Codium polysaccharides studies performed in zebrafish, rockfish, and olive flounder [23,24,25], no other study is available on the use of raw Codium in fish. Thus, a direct comparison is not possible. Nonetheless, studies with other macroalgae such as G. gracilis showed that similarly to our study, CAT activity was not affected in European seabass fed this algae at 2.5, 5, and 8% or 0.35% of G. gracilis extract [30,31]. Nonetheless, an increase in SOD activity was reported for the inclusion of G. gracilis at 2.5 and 5%, and also for the extract [31]. In gilthead seabream, 5% U. lactuca or 5% Chondrus crispus were also reported to not affect the antioxidant enzyme activities [67]. This suggests a limited effect of some macroalgae on fish antioxidant enzymes. On the other hand, it is also possible that the polysaccharide extraction and autoclaving treatment used in this present study were not effective in improving the bioavailability of the macroalgae’s bioactive compounds. In fact, Güroy et al. [39] observed that autoclaved Ulva led to lower rainbow trout growth performance compared to raw Ulva, which may be attributed to the destruction of heat-sensitive compounds such as the carotenoids, known for antioxidant properties [17].
Regarding the immunoregulatory properties, the COP diet led to an increased expression of the pro-inflammatory cytokines il-1β and il-6, which, in the absence of detrimental effects on growth and intestinal histomorphology, might suggest an immunostimulatory effect. Nonetheless, without performing a functional challenge assay (e.g., pathogen exposure), it is not possible to confirm that fish were under an immunostimulatory rather than an early stress or inflammatory response. Cytokines are important signaling molecules of the immune system, intervening in both innate and acquired responses, and are modulated by diverse stimuli [68]. Contrary to this present study, in rockfish intestine, 0.5% of C. fragile crude sulfated polysaccharides lead to a decrease in the intestinal expression of il-1β, an increase in the expression of the anti-inflammatory il-10, and no effect on il-6 expression at 2 weeks of feeding, while the observed effect on the il-1β disappeared at 4 weeks [25]. Similarly to this present study, intestinal tnf-α expression was also not affected by 0.5% of C. fragile crude polysaccharides [25]. Meanwhile, in olive flounder intraperitoneally injected with C. fragile sulfated polysaccharide fraction, the expression of tnf-α was more influenced by the type of tissue analyzed and the sampling time than by the polysaccharide treatment itself [23]. This suggests that the lack of changes observed in the expression of tnf-α in this present study may be related to the specific tissue that was sampled or the sampling time, rather than an actual lack of immunomodulatory effect. Differences among studies might also be related to the method used to obtain the extracts; in this present study, the extracts were obtained by enzymatic hydrolysis, the C. fragile crude polysaccharides were obtained with aqueous extraction and ethanol-induced precipitation [25], and the C. fragile sulfated polysaccharide fraction was obtained using ion-exchange chromatography [23].
Contrary to the observed Codium polysaccharide stimulatory effect in the immune-related expression, the inclusion of Osmundea polysaccharides did not exert any effect. While the major sulfated polysaccharides of green algae are sulfated heteropolysaccharides that contain galactose, xylose, arabinose, glucuronic acid, mannose, or glucose, the ones present in red algae are galactans (e.g., carrageenan) [69]. The sulfated galactans present in the red algae also present immunomodulatory activity [70], as observed for the sulfated polysaccharides present in the green algae. However, while there are a few studies on the sulfated polysaccharides of Codium showing their immunostimulatory effect [23,25], there are no studies on the sulfated galactans of Osmundea. Thus, the different polysaccharide profiles of the macroalgae studied herein and possibly the concentration tested were not enough to elicit an enhanced immune response in fish fed Osmundea polysaccharides. Moreover, the whole algae and autoclaved algae diets did not exert any effect on immune-related expression, suggesting that concentrating algae’s bioactive compounds through extraction and purification processes may be more beneficial and efficient in the enhancement of fish immune response than providing the whole or autoclaved algal matrix. Although thermal treatments of algae materials, such as autoclaving, could favor their digestibility and nutritional value, as reported for soybean meal [71], by inactivating antinutritional factors, such treatments could also destroy not only essential amino acids and vitamins but also other heat-sensitive compounds, thus reducing the immunostimulant potential of the algal materials [66].
In this study, both Codium and Osmundea presented a high fiber content (32% and 21%, respectively [63]), yet the histomorphological evaluation of the distal intestine revealed no detrimental effects on gut integrity or signs of inflammation across dietary treatments. This is noteworthy given that some complex carbohydrates, particularly insoluble fibers and non-starch polysaccharides, can negatively affect the intestine morphology [17]. Because soluble and insoluble fiber fractions may differentially influence nutrient digestibility and gut health, future studies should explore their distinct role. Similarly, antinutritional factors commonly associated with gut inflammation, such as lectins, present in green and red macroalgae [36], did not affect intestinal integrity in European seabass. The absence of distal intestine damage is particularly relevant in the COP diet since the increased expression of pro-inflammatory cytokines could have led to an intestinal inflammatory response. Nonetheless, the possibility of other intestinal portions being more sensitive cannot be excluded. For instance, in a study where European seabass were fed a blend of algae (Gracilaria sp., Nannochloropsis sp., and Aurantiochytrium sp.), the subtle histological differences were mostly observed in the mid-intestine [72]. Nonetheless, the reported effects of macroalgae on European seabass intestines are somehow contradictory. Some studies observed negative effects, such as a decrease in the villus length in fish fed 5% G. gracilis and 0.35% G. gracilis extract [31], whereas others found no effect in the intestinal histomorphology of fish fed 8% G. gracilis [30] or fed with 2, 4, and 6% of microalgae (Nannochloropsis oceanica and Chlorella vulgaris) and macroalgae (G. gracilis and U. rigida) [73]. In contrast, 5% R. okamurae led to positive changes in the structure of the villi and microvilli, including increased serosa and submucosa layer height, microvilli length, enterocyte apical area, and absorption surface [34]. Taken together, these differences among studies suggest that macroalgae effects on gut histomorphology could be related to the algae species, number of fibers, source, processing, and concentration used, as well as diet composition and the experimental conditions.

5. Conclusions

In conclusion, Codium negatively affected diet digestibility and fish growth. However, autoclaving improved Codium utilization, as indicated by the increased dry matter digestibility and fish growth, suggesting enhanced nutrient bioavailability and the potential of autoclaving as a macroalgae valorization method. Nonetheless, future cost–benefit studies should be conducted to evaluate the feasibility of using this process at an industrial scale. Additionally, Codium polysaccharides seem to have an immunostimulatory effect, which could be useful during stress or disease periods.
Osmundea at 5% can be included in diets for European seabass without negatively affecting digestibility, growth, intestinal health, or immune or oxidative status. Meanwhile, autoclaved Osmundea and its polysaccharide extracts did not improve nutrient and bioactive compound bioavailability.
Overall, Osmundea without any processing methods or autoclaved Codium seems to be the most promising to be included in European seabass diets, although it did not present a functional role, while Codium polysaccharides, as well as their potential role in immune status, need to be further studied.
To our knowledge, this is the first study evaluating the use of Osmundea and Codium in European seabass diets. Given that the nutritional composition of macroalgae varies seasonally, future studies should evaluate whether such variation affects growth, digestibility, and health. Dose–response studies are also needed to determine the optimal inclusion levels for improving fish performance. Furthermore, long-term experiments, a higher number of replicas, and studies under stress or disease challenge conditions are required to better understand the potential immunostimulatory and functional roles of these macroalgae. In an ecological and economic context, future studies should also address economic feasibility, regional biomass availability, and processing costs at an industrial scale.

Author Contributions

Conceptualization, M.S., A.O.-T. and A.C.; Formal Analysis, I.G., F.F., M.M. and J.O.; Investigation, I.G., F.F., M.M., J.O., R.M. (Raquel Marçal), R.M. (Rui Magalhães), M.P., M.S., P.E. and A.C.; Writing—Original Draft Preparation, I.G.; Writing—Review and Editing, I.G., P.E. and A.C.; Supervision, A.O.-T., P.E. and A.C.; Project Administration, M.S., A.O.-T., P.E. and A.C.; Funding Acquisition, M.P., M.S., A.O.-T. and A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financed by the 0558_ALGALUP_6_E “Integral alternative for the exploitation of macroalgae in the area of Galicia and Portugal”, which was co-financed by the European Regional Development Fund (ERDF) through the Program INTERREG V-A Spain–Portugal (POCTEP) 2018–2021. This research was also partially supported by national funds through FCT—Fundação para a Ciência e a Tecnologia within the scope of the Strategic Funding UIDB/04423/2020 (https://doi.org/10.54499/UIDB/04423/2020), UIDP/04423/2020 (https://doi.org/10.54499/UIDP/04423/2020), LA/P/0101/2020 (https://doi.org/10.54499/LA/P/0101/2020), and UID/50006 + LA/P/0094/2020 (https://doi.org/10.54499/LA/P/0094/2020). The researcher I.G. had a scientific employment contract supported by national funds through FCT (https://doi.org/10.54499/2022.00885.CEECIND/CP1728/CT0013).

Institutional Review Board Statement

The growth and digestibility trials were approved by the Portuguese National Authority for Animal Health (DGAV; reference ORBEA_CIIMAR_27_2019), directed by accredited scientists (following FELASA category C recommendations), and conducted according to the European Union Directive (2010/63/EU) on the protection of animals for scientific purposes.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
ADCApparent digestibility coefficient
CATCatalase
COCodium
COACodium autoclaved
COPCodium polysaccharides
CTRControl
GRGlutathione reductase
il-10Interleukin-10
il-1βInterleukin-1-beta
il-6Interleukin-6
OSOsmundea
OSAOsmundea autoclaved
OSPOsmundea polysaccharides
SODSuperoxide dismutase
tnf-αTumor necrosis factor-alpha

References

  1. FAO. The State of World Fisheries and Aquaculture 2024. Blue Transformation in Action; Food and Agriculture Organization of the United Nations: Rome, Italy, 2024. [CrossRef]
  2. Eurostat. EU Fisheries Remained Ahead of Aquaculture in 2022. 2024. Available online: https://ec.europa.eu/eurostat/web/products-eurostat-news/w/ddn-20240731-1 (accessed on 3 September 2024).
  3. Glencross, B.; Fracalossi, D.M.; Hua, K.; Izquierdo, M.; Mai, K.; Øverland, M.; Robb, D.; Roubach, R.; Schrama, J.; Small, B.; et al. Harvesting the benefits of nutritional research to address global challenges in the 21st century. J. World Aquac. Soc. 2023, 54, 343–363. [Google Scholar] [CrossRef]
  4. Campos, A.M.; Matos, J.; Afonso, C.; Gomes, R.; Bandarra, N.M.; Cardoso, C. Azorean macroalgae (Petalonia binghamiae, Halopteris scoparia and Osmundea pinnatifida) bioprospection: A study of fatty acid profiles and bioactivity. Int. J. Food Sci. Technol. 2019, 54, 880–890. [Google Scholar] [CrossRef]
  5. Silva, P.; Pereira, L. Concise review of Osmundea pinnatifida (Hudson) stackhouse. J. Appl. Phycol. 2020, 32, 2761–2771. [Google Scholar] [CrossRef]
  6. Meinita, M.D.N.; Harwanto, D.; Choi, J.S. A concise review of the bioactivity and pharmacological properties of the genus Codium (Bryopsidales, Chlorophyta). J. Appl. Phycol. 2022, 34, 2827–2845. [Google Scholar] [CrossRef] [PubMed]
  7. Moreira, A.; Cruz, S.; Marques, R.; Cartaxana, P. The underexplored potential of green macroalgae in aquaculture. Rev. Aquac. 2022, 14, 5–26. [Google Scholar] [CrossRef]
  8. Ortiz, J.; Uquiche, E.; Robert, P.; Romero, N.; Quitral, V.; Llantén, C. Functional and nutritional value of the Chilean seaweeds Codium fragile, Gracilaria chilensis and Macrocystis pyrifera. Eur. J. Lipid Sci. Technol. 2009, 111, 320–327. [Google Scholar] [CrossRef]
  9. Patarra, R.F.; Paiva, L.; Neto, A.I.; Lima, E.; Baptista, J. Nutritional value of selected macroalgae. J. Appl. Phycol. 2011, 23, 205–208. [Google Scholar] [CrossRef]
  10. Paiva, L.; Lima, E.; Patarra, R.F.; Neto, A.I.; Baptista, J. Edible Azorean macroalgae as source of rich nutrients with impact on human health. Food Chem. 2014, 164, 128–135. [Google Scholar] [CrossRef]
  11. Rodrigues, D.; Freitas, A.C.; Pereira, L.; Rocha-Santos, T.A.; Vasconcelos, M.W.; Roriz, M.; Rodríguez-Alcalá, L.M.; Gomes, A.M.P.; Duarte, A.C. Chemical composition of red, brown and green macroalgae from Buarcos bay in Central West Coast of Portugal. Food Chem. 2015, 183, 197–207. [Google Scholar] [CrossRef]
  12. Arguelles, E.D. Evaluation of nutritional composition and in vitro antioxidant and antibacterial activities of Codium intricatum Okamura from Ilocos Norte (Philippines). Jordan J. Biol. Sci. 2020, 13, 375–382. [Google Scholar]
  13. Echave, J.; Lourenço-Lopes, C.; Carreira-Casais, A.; Chamorro, F.; Fraga-Corral, M.; Otero, P.; Garcia-Perez, P.; Baamonde, S.; Fernández-Saa, F.; Cao, H.; et al. Nutritional composition of the Atlantic seaweeds Ulva rigida, Codium tomentosum, Palmaria palmata and Porphyra purpurea. Chem. Proc. 2021, 5, 67. [Google Scholar] [CrossRef]
  14. Freitas, M.V.; Inácio, L.G.; Martins, M.; Afonso, C.; Pereira, L.; Mouga, T. Primary composition and pigments of 11 red seaweed species from the center of Portugal. J. Mar. Sci. Eng. 2022, 10, 1168. [Google Scholar] [CrossRef]
  15. Negm, M.S.; Elrayess, R.A.; El-Shoubaky, G.A.; Osman, N.A. Chemical composition and bioactivity of Codium dwarkense collected from the earthquake crack region of Ras Muhammad National Park, Red Sea, Egypt. S. Afr. J. Bot. 2024, 173, 245–254. [Google Scholar] [CrossRef]
  16. Sousa, C.; Sousa-Pinto, I.; Oliveira, I.; Marinho, G.S. Seasonal variation in the composition and antioxidant potential of Codium tomentosum and Ulva lacinulata produced in a land-based integrated multi-trophic aquaculture system. J. Appl. Phycol. 2025, 37, 1557–1572. [Google Scholar] [CrossRef]
  17. Wan, A.H.; Davies, S.J.; Soler-Vila, A.; Fitzgerald, R.; Johnson, M.P. Macroalgae as a sustainable aquafeed ingredient. Rev. Aquac. 2019, 11, 458–492. [Google Scholar] [CrossRef]
  18. Biancacci, C.; Abell, R.; McDougall, G.J.; Day, J.G.; Stanley, M.S. Annual compositional variation in wild Osmundea pinnatifida (Hudson) Stackhouse from the west coast of Scotland. J. Appl. Phycol. 2022, 34, 1661–1675. [Google Scholar] [CrossRef]
  19. Ibañez, E.; Cifuentes, A. Benefits of using algae as natural sources of functional ingredients. J. Sci. Food Agric. 2013, 93, 703–709. [Google Scholar] [CrossRef]
  20. Wells, M.L.; Potin, P.; Craigie, J.S.; Raven, J.A.; Merchant, S.S.; Helliwell, K.E.; Smith, A.G.; Camire, M.E.; Brawley, S.H. Algae as nutritional and functional food sources: Revisiting our understanding. J. Appl. Phycol. 2017, 29, 949–982. [Google Scholar] [CrossRef]
  21. Boukid, F.; Castellari, M. Algae as nutritional and functional food sources. Foods 2022, 12, 122. [Google Scholar] [CrossRef] [PubMed]
  22. Kamble, M.T.; Wongprasert, K.; Chavan, B.R.; Daunde, V.V.Y.; Palekar, G.K.R.; Tayade, S.H.; Thompson, K.D.; Gabriel, N.N.; Medhe, S.V.; Pirarat, N. Red seaweeds in aquaculture: Impacts on growth, immunity, antioxidant status, gene expression, and gut health. Ann. Anim. Sci. 2025; ahead of print. [Google Scholar] [CrossRef]
  23. Yang, Y.; Park, J.; You, S.G.; Hong, S. Immuno-stimulatory effects of sulfated polysaccharides isolated from Codium fragile in olive flounder, Paralichthys olivaceus. Fish Shellfish Immunol. 2019, 87, 609–614. [Google Scholar] [CrossRef]
  24. Wang, L.; Oh, J.Y.; Je, J.G.; Jayawardena, T.U.; Kim, Y.S.; Ko, J.Y.; Fu, X.; Jeon, Y.J. Protective effects of sulfated polysaccharides isolated from the enzymatic digest of Codium fragile against hydrogen peroxide-induced oxidative stress in in vitro and in vivo models. Algal Res. 2020, 48, 101891. [Google Scholar] [CrossRef]
  25. Yang, Y.; Lim, J.; Li, C.; Lee, S.; Hong, S. Effects of sulfated polysaccharides isolated from Codium fragile on inflammatory cytokine gene expression and Edwardsiella tarda infection in rockfish, Sebastes schlegelii. Fish Shellfish Immunol. 2021, 112, 125–134. [Google Scholar] [CrossRef] [PubMed]
  26. Kaushik, S.J.; Coves, D.; Dutto, G.; Blanc, D. Almost total replacement of fish meal by plant protein sources in the diet of a marine teleost, the European seabass, Dicentrarchus labrax. Aquaculture 2004, 230, 391–404. [Google Scholar] [CrossRef]
  27. Dias, J.; Conceição, L.E.; Ribeiro, A.R.; Borges, P.; Valente, L.M.P.; Dinis, M.T. Practical diet with low fish-derived protein is able to sustain growth performance in gilthead seabream (Sparus aurata) during the grow-out phase. Aquaculture 2009, 293, 255–262. [Google Scholar] [CrossRef]
  28. Kousoulaki, K.; Sæther, B.S.; Albrektsen, S.; Noble, C. Review on European sea bass (Dicentrarchus labrax, Linnaeus, 1758) nutrition and feed management: A practical guide for optimizing feed formulation and farming protocols. Aquac. Nutr. 2015, 21, 129–151. [Google Scholar] [CrossRef]
  29. Torrecillas, S.; Robaina, L.; Caballero, M.J.; Montero, D.; Calandra, G.; Mompel, D.; Karalazos, V.; Kaushik, S.; Izquierdo, M.S. Combined replacement of fishmeal and fish oil in European sea bass (Dicentrarchus labrax): Production performance, tissue composition and liver morphology. Aquaculture 2017, 474, 101–112. [Google Scholar] [CrossRef]
  30. Batista, S.; Pereira, R.; Oliveira, B.; Baião, L.F.; Jessen, F.; Tulli, F.; Messina, M.; Silva, J.L.; Abreu, H.; Valente, L.M.P. Exploring the potential of seaweed Gracilaria gracilis and microalga Nannochloropsis oceanica, single or blended, as natural dietary ingredients for European seabass Dicentrarchus labrax. J. Appl. Phycol. 2020, 32, 2041–2059. [Google Scholar] [CrossRef]
  31. Passos, R.; Correia, A.P.; Pires, D.; Pires, P.; Ferreira, I.; Simões, M.; do Carmo, B.; Santos, P.; Pombo, A.; Afonso, C.; et al. Potential use of macroalgae Gracilaria gracilis in diets for European seabass (Dicentrarchus labrax): Health benefits from a sustainable source. Fish Shellfish Immunol. 2021, 119, 105–113. [Google Scholar] [CrossRef]
  32. Valente, L.M.P.; Batista, S.; Ribeiro, C.; Pereira, R.; Oliveira, B.; Garrido, I.; Baião, L.F.; Tulli, F.; Messina, M.; Pierre, R.; et al. Physical processing or supplementation of feeds with phytogenic compounds, alginate oligosaccharide or nucleotides as methods to improve the utilization of Gracilaria gracilis by juvenile European seabass (Dicentrarchus labrax). Aquaculture 2021, 530, 735914. [Google Scholar] [CrossRef]
  33. Fonseca, F.; Fuentes, J.; Vizcaíno, A.J.; Alarcón, F.J.; Mancera, J.M.; Martínez-Rodríguez, G.; Martos-Sitcha, J.A. From invasion to fish fodder: Inclusion of the brown algae Rugulopteryx okamurae in aquafeeds for European sea bass Dicentrarchus labrax (L., 1758). Aquaculture 2023, 568, 739318. [Google Scholar] [CrossRef]
  34. Vizcaíno, A.J.; Sáez, M.I.; Galafat, A.; Galindo-Melero, R.; Perera, E.; Casal-Porras, I.; Zubía, E.; Vega, J.; Figueroa, F.L.; Martínez, T.F.; et al. Effects of feeding European seabass (Dicentrarchus labrax) juveniles with crude, hydrolysed and fermented biomass of the invasive macroalga Rugulopteryx okamurae (Ochrophyta). Aquac. Rep. 2024, 34, 101877. [Google Scholar] [CrossRef]
  35. Fernandes, H.; Martins, N.; Vieira, L.; Salgado, J.M.; Castro, C.; Oliva-Teles, A.; Belo, I.; Peres, H. Pre-treatment of Ulva rigida improves its nutritional value for European seabass (Dicentrarchus labrax) juveniles. Algal Res. 2022, 66, 102803. [Google Scholar] [CrossRef]
  36. González-Meza, G.M.; Elizondo-Luevano, J.H.; Cuellar-Bermudez, S.P.; Sosa-Hernández, J.E.; Iqbal, H.M.; Melchor-Martínez, E.M.; Parra-Saldívar, R. New perspective for macroalgae-based animal feeding in the context of challenging sustainable food production. Plants 2023, 12, 3609. [Google Scholar] [CrossRef] [PubMed]
  37. Batista, S.; Pintado, M.; Marques, A.; Abreu, H.; Silva, J.L.; Jessen, F.; Tulli, F.; Valente, L.M.P. Use of technological processing of seaweed and microalgae as strategy to improve their apparent digestibility coefficients in European seabass (Dicentrarchus labrax) juveniles. J. Appl. Phycol. 2020, 32, 3429–3446. [Google Scholar] [CrossRef]
  38. Vizcaíno, A.J.; Galafat, A.; Sáez, M.I.; Martínez, T.F.; Alarcón, F.J. Partial characterization of protease inhibitors of Ulva ohnoi and their effect on digestive proteases of marine fish. Mar. Drugs 2020, 18, 319. [Google Scholar] [CrossRef]
  39. Güroy, B.; Ergün, S.; Merrifield, D.L.; Güroy, D. Effect of autoclaved Ulva meal on growth performance, nutrient utilization and fatty acid profile of rainbow trout, Oncorhynchus mykiss. Aquac. Int. 2013, 21, 605–615. [Google Scholar] [CrossRef]
  40. Gonçalves, A.T.; Simões, M.; Costa, C.; Passos, R.; Baptista, T. Modulatory effect of Gracilaria gracilis on European seabass gut microbiota community and its functionality. Sci. Rep. 2022, 12, 14836. [Google Scholar] [CrossRef] [PubMed]
  41. Pappou, S.; Bakopoulos, V.; Valsamidis, M.A.; Krokida, M.; Batjakas, I. Supplementation of a commercial diet of European seabass by an algal ethanolic extract of Ulva lactuca. Bull. Univ. Agric. Sci. Vet. Med. Cluj-Napoca Food Sci. Technol. 2024, 80, 157–162. [Google Scholar] [CrossRef]
  42. Khanzadeh, M.; Beikzadeh, B.; Hoseinifar, S.H. The effects of Laurencia caspica algae extract on hemato-immunological parameters, antioxidant defense, and resistance against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus). Aquac. Nutr. 2023, 2023, 8882736. [Google Scholar] [CrossRef]
  43. Kiadaliri, M.; Firouzbakhsh, F.; Deldar, H. Effects of feeding with red algae (Laurencia caspica) hydroalcoholic extract on antioxidant defense, immune responses, and immune gene expression of kidney in rainbow trout (Oncorhynchus mykiss) infected with Aeromonas hydrophila. Aquaculture 2020, 526, 735361. [Google Scholar] [CrossRef]
  44. Cho, C.Y.; Slinger, S.J.; Bayley, H.S. Bioenergetics of salmonid fishes: Energy intake, expenditure and productivity. Comp. Biochem. Physiol. B 1982, 73, 25–41. [Google Scholar] [CrossRef]
  45. Besednova, N.N.; Zaporozhets, T.S.; Kuznetsova, T.A.; Makarenkova, I.D.; Kryzhanovsky, S.P.; Fedyanina, L.N.; Ermakova, S.P. Extracts and marine algae polysaccharides in therapy and prevention of inflammatory diseases of the intestine. Mar. Drugs 2020, 18, 289. [Google Scholar] [CrossRef]
  46. AOAC. Official Methods of Analysis; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2000. [Google Scholar]
  47. Furukawa, A.; Tsukahara, H. On the acid digestion method for the determination of chromic oxide as an index substance in the study of digestibility of fish feed. Bull. Japan. Soc. Sci. Fish 1966, 32, 502–506. [Google Scholar] [CrossRef]
  48. Monteiro, M.; Lavrador, A.S.; Santos, R.; Rangel, F.; Iglesias, P.; Tárraga, M.; Couto, A.; Serra, C.R.; Tafalla, C.; Da Costa, E.; et al. Evaluation of the potential of marine algae extracts as a source of functional ingredients using zebrafish as animal model for aquaculture. Mar. Biotechnol. 2021, 23, 529–545. [Google Scholar] [CrossRef]
  49. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  50. Carvalhais, A.; Pereira, B.; Sabato, M.; Seixas, R.; Dolbeth, M.; Marques, A.; Guilherme, S.; Pereira, P.; Pacheco, M.; Mieiro, C. Mild effects of sunscreen agents on a marine flatfish: Oxidative stress, energetic profiles, neurotoxicity and behaviour in response to titanium dioxide nanoparticles and oxybenzone. Int. J. Mol. Sci. 2021, 22, 1567. [Google Scholar] [CrossRef] [PubMed]
  51. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
  52. Baeverfjord, G.; Krogdahl, A. Development and regression of soybean meal induced enteritis in Atlantic salmon, Salmo salar L., distal intestine: A comparison with the intestines of fasted fish. J. Fish Dis. 1996, 19, 375–387. [Google Scholar] [CrossRef]
  53. Krogdahl, Å.; Bakke-McKellep, A.M.; Baeverfjord, G. Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquac. Nutr. 2003, 9, 361–371. [Google Scholar] [CrossRef]
  54. Penn, M.H.; Bendiksen, E.Å.; Campbell, P.; Krogdahl, Å. High level of dietary pea protein concentrate induces enteropathy in Atlantic salmon (Salmo salar L.). Aquaculture 2011, 310, 267–273. [Google Scholar] [CrossRef]
  55. Valente, L.M.P.; Gouveia, A.; Rema, P.; Matos, J.; Gomes, E.F.; Pinto, I.S. Evaluation of three seaweeds Gracilaria bursa-pastoris, Ulva rigida and Gracilaria cornea as dietary ingredients in European sea bass (Dicentrarchus labrax) juveniles. Aquaculture 2006, 252, 85–91. [Google Scholar] [CrossRef]
  56. Azaza, M.S.; Mensi, F.; Ksouri, J.; Dhraief, M.N.; Brini, B.; Abdelmouleh, A.; Kraïem, M.M. Growth of Nile tilapia (Oreochromis niloticus L.) fed with diets containing graded levels of green algae ulva meal (Ulva rigida) reared in geothermal waters of southern Tunisia. J. Appl. Ichthyol. 2008, 24, 202–207. [Google Scholar] [CrossRef]
  57. Marinho, G.; Nunes, C.; Sousa-Pinto, I.; Pereira, R.; Rema, P.; Valente, L.M.P. The IMTA-cultivated Chlorophyta Ulva spp. as a sustainable ingredient in Nile tilapia (Oreochromis niloticus) diets. J. Appl. Phycol. 2013, 25, 1359–1367. [Google Scholar] [CrossRef]
  58. Silva, D.M.; Valente, L.M.P.; Sousa-Pinto, I.; Pereira, R.; Pires, M.A.; Seixas, F.; Rema, P. Evaluation of IMTA-produced seaweeds (Gracilaria, Porphyra, and Ulva) as dietary ingredients in Nile tilapia, Oreochromis niloticus L., juveniles. Effects on growth performance and gut histology. J. Appl. Phycol. 2015, 27, 1671–1680. [Google Scholar] [CrossRef]
  59. Zhu, D.; Wen, X.; Xuan, X.; Li, S.; Li, Y. The green alga Ulva lactuca as a potential ingredient in diets for juvenile white spotted snapper Lutjanus stellatus Akazaki. J. Appl. Phycol. 2016, 28, 703–711. [Google Scholar] [CrossRef]
  60. Sotoudeh, E.; Mardani, F. Antioxidant-related parameters, digestive enzyme activity and intestinal morphology in rainbow trout (Oncorhynchus mykiss) fry fed graded levels of red seaweed, Gracilaria pygmaea. Aquac. Nutr. 2018, 24, 777–785. [Google Scholar] [CrossRef]
  61. Dallaire, V.; Lessard, P.; Vandenberg, G.; De La Noüe, J. Effect of algal incorporation on growth, survival and carcass composition of rainbow trout (Oncorhynchus mykiss) fry. Bioresour. Technol. 2007, 98, 1433–1439. [Google Scholar] [CrossRef]
  62. Pereira, R.; Valente, L.M.P.; Sousa-Pinto, I.; Rema, P. Apparent nutrient digestibility of seaweeds by rainbow trout (Oncorhynchus mykiss) and Nile tilapia (Oreochromis niloticus). Algal Res. 2012, 1, 77–82. [Google Scholar] [CrossRef]
  63. ALGALUP Green Future. Composición de Macroalgas en Galicia y Portugal. Available online: https://algalup.eu/wp-content/uploads/2022/07/Composicion.pdf (accessed on 18 September 2025).
  64. Juul, L.; Stødkilde, L.; Ingerslev, A.K.; Bruhn, A.; Jensen, S.K.; Dalsgaard, T.K. Digestibility of seaweed protein from Ulva sp. and Saccharina latissima in rats. Algal Res. 2022, 63, 102644. [Google Scholar] [CrossRef]
  65. Prashant, N.; Sangwan, M.; Singh, P.; Das, P.; Srivastava, U.; Bast, F. Anti-nutritional factors and heavy metals in edible seaweeds: Challenges, health implications, and strategies for safer consumption. J. Food Compos. Anal. 2025, 140, 107283. [Google Scholar] [CrossRef]
  66. Peres, H.; Lim, C.; Klesius, P.H. Nutritional value of heat-treated soybean meal for channel catfish (Ictalurus punctatus). Aquaculture 2003, 225, 67–82. [Google Scholar] [CrossRef]
  67. Guerreiro, I.; Magalhães, R.; Coutinho, F.; Couto, A.; Sousa, S.; Delerue-Matos, C.; Domingues, V.F.; Oliva-Teles, A.; Peres, H. Evaluation of the seaweeds Chondrus crispus and Ulva lactuca as functional ingredients in gilthead seabream (Sparus aurata). J. Appl. Phycol. 2019, 31, 2115–2124. [Google Scholar] [CrossRef]
  68. Zou, J.; Secombes, C.J. The function of fish cytokines. Biology 2016, 5, 23. [Google Scholar] [CrossRef]
  69. Ngo, D.H.; Kim, S.K. Sulfated polysaccharides as bioactive agents from marine algae. Int. J. Biol. Macromol. 2013, 62, 70–75. [Google Scholar] [CrossRef]
  70. Khongthong, S.; Theapparat, Y.; Roekngam, N.; Tantisuwanno, C.; Otto, M.; Piewngam, P. Characterization and immunomodulatory activity of sulfated galactan from the red seaweed Gracilaria fisheri. Int. J. Biol. Macromol. 2021, 189, 705–714. [Google Scholar] [CrossRef] [PubMed]
  71. Barrows, F.T.; Stone, D.A.; Hardy, R.W. The effects of extrusion conditions on the nutritional value of soybean meal for rainbow trout (Oncorhynchus mykiss). Aquaculture 2007, 265, 244–252. [Google Scholar] [CrossRef]
  72. Ferreira, M.; Sousa, V.; Oliveira, B.; Canadas-Sousa, A.; Abreu, H.; Dias, J.; Kiron, V.; Valente, L.M.P. An in-depth characterisation of European seabass intestinal segments for assessing the impact of an algae-based functional diet on intestinal health. Sci. Rep. 2023, 13, 11686. [Google Scholar] [CrossRef]
  73. Ferreira, M.; Machado, M.; Mota, C.S.C.; Abreu, H.; Silva, J.; Maia, M.R.G.; Kiron, V.; Costas, B.; Valente, L.M.P. Micro- and macroalgae blend modulates the mucosal and systemic immune responses of European seabass (Dicentrarchus labrax) upon infection with Tenacibaculum maritimum. Aquaculture 2023, 566, 739222. [Google Scholar] [CrossRef]
Jmse 13 01884 g001
Figure 1. Histomorphological appearance of the distal intestine of European seabass fed the experimental diets: CTR: control diet (A); CO: Codium diet (B); COA: autoclaved Codium diet (C); COP: Codium polysaccharide diet (D); OS: Osmundea diet (E); OSA: autoclaved Osmundea diet (F); OSP: Osmundea polysaccharide diet (G). Histomorphological features: VL: Villi; GC: Goblet cells; SB: Submucosa; LP: Lamina propria; SV: Supranuclear vacuole; IL: Intraepithelial leukocytes; EG: Eosinophilic granulocytes.
Figure 1. Histomorphological appearance of the distal intestine of European seabass fed the experimental diets: CTR: control diet (A); CO: Codium diet (B); COA: autoclaved Codium diet (C); COP: Codium polysaccharide diet (D); OS: Osmundea diet (E); OSA: autoclaved Osmundea diet (F); OSP: Osmundea polysaccharide diet (G). Histomorphological features: VL: Villi; GC: Goblet cells; SB: Submucosa; LP: Lamina propria; SV: Supranuclear vacuole; IL: Intraepithelial leukocytes; EG: Eosinophilic granulocytes.
Jmse 13 01884 g001
Jmse 13 01884 g002
Figure 2. Expression of immune-related genes in the distal intestine of European seabass fed the experimental diets. Data are presented as mean ± standard deviation (n = 3). Values are expressed as fold change relative to the control diet group. Different letters indicate significant differences between dietary treatments (p < 0.05). CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; COP: Codium polysaccharide diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet; OSP: Osmundea polysaccharide diet.
Figure 2. Expression of immune-related genes in the distal intestine of European seabass fed the experimental diets. Data are presented as mean ± standard deviation (n = 3). Values are expressed as fold change relative to the control diet group. Different letters indicate significant differences between dietary treatments (p < 0.05). CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; COP: Codium polysaccharide diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet; OSP: Osmundea polysaccharide diet.
Jmse 13 01884 g002
Table 1. Ingredient composition and proximate analysis of the experimental diets.
Table 1. Ingredient composition and proximate analysis of the experimental diets.
Diets
CTRCOCOACOPOSOSAOSP
Ingredients (% dry weight basis)
Fishmeal 115.015.015.015.015.015.015.0
Osmundea 2----5.0--
Osmundea autoclaved 2-----5.0-
Codium 3-5.0-----
Codium autoclaved 3--5.0----
Osmundea polysaccharide extract 4------0.5
Codium polysaccharide extract 4---0.5---
Wheat gluten 55.05.05.05.05.05.05.0
Corn gluten 69.19.29.29.18.48.49.1
Rapeseed meal 710.010.010.010.010.010.010.0
Soybean meal 825.025.025.025.025.025.025.0
Sunflower meal 97.57.57.57.57.57.57.5
Wheat meal 108.43.23.28.43.94.08.4
α-cellulose0.50.50.5-0.50.5-
Fish oil15.015.015.015.015.115.115.0
Vitamin premix 111.01.01.01.01.01.01.0
Mineral premix 121.01.01.01.01.01.01.0
Binder 131.01.01.01.01.01.01.0
Choline chloride (50%)0.50.50.50.50.50.50.5
Dibasic calcium phosphate0.050.10.10.050.10.10.05
Chromium oxide0.50.50.50.50.50.50.5
Methionine 140.10.10.10.10.20.20.1
Taurine 150.30.30.30.30.30.30.3
Proximate analyses (% dry weight basis)
Dry matter 97.897.097.097.697.897.298.1
Crude protein41.741.742.042.341.742.342.5
Crude lipid17.117.617.817.517.217.616.9
Ash7.69.69.77.28.88.67.7
Energy (kJ g−1)23.222.923.123.522.822.823.7
CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; COP: Codium polysaccharide diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet; OSP: Osmundea polysaccharide diet. 1 Steam-dried fishmeal made from trimmings (tuna and sardine), Portugal, SAVINOR SA/Sorgal, S.A. (crude protein, CP: 74.9% dry matter, DM; crude lipid, CL: 10.7% DM). 2 Collected at the north coast of Portugal/Galicia (CP: 25.0% DM; CL: 0.9% DM). 3 Collected at the north coast of Portugal/Galicia (CP: 14.5% DM; CL: 1.9% DM). 4 Extracted obtained by ANFACO. 5 Sorgal, S.A. Ovar, Portugal (CP: 80.0% DM; CL: 1.5% DM). 6 Sorgal, S.A. Ovar, Portugal (CP: 69.0% DM; CL: 3.3% DM). 7 Sorgal, S.A. Ovar, Portugal (CP: 39.2% DM; CL: 2.9% DM). 8 Sorgal, S.A. Ovar, Portugal (CP: 50.9% DM; CL: 1.6% DM). 9 Sorgal, S.A. Ovar, Portugal (CP: 32.2% DM; CL: 1.7% DM). 10 Sorgal, S.A. Ovar, Portugal (CP: 14.5% DM; CL: 1.2% DM). 11 Vitamins (mg kg−1 diet): retinol, 18,000 (IU kg−1 diet); cholecalciferol, 2000 (IU kg−1 diet); α-tocopherol, 35; menadione sodium bisulphate, 10; thiamine, 15; riboflavin, 25; Ca pantothenate, 50; nicotinic acid, 200; pyridoxine, 5; folic acid, 10; cyanocobalamin, 0.02; biotin, 1.5; ascorbyl monophosphate, 50; inositol, 400. 12 Minerals (mg kg−1 diet): cobalt sulfate, 1.91; copper sulfate, 19.6; iron sulfate, 200; sodium fluoride, 2.21; potassium iodide, 0.78; magnesium oxide, 830; manganese oxide, 26; sodium selenite, 0.66; zinc oxide, 37.5; dibasic calcium phosphate, 5.93 (g kg−1 diet); potassium chloride, 1.15 (g kg−1 diet); sodium chloride, 0.44 (g kg−1 diet). 13 Aquacube. Agil, UK. 14 Feed-grade methionine, Sorgal, S.A. Ovar, Portugal. 15 Feed-grade taurine, Sorgal, S.A. Ovar, Portugal.
Table 2. Primer sequences used for transcript amplification by RT-PCR.
Table 2. Primer sequences used for transcript amplification by RT-PCR.
GeneSequenceEfficiencyAccession
Number
18SF: AGGGTGTTGGCAGACGTTAC2.0AM490061
R: CTTCTGCCTGTTGAGGAACC
IL-1βF: ATCTGGAGGTGGTGGACAAA1.9AJ311925
R: AGGGTGCTGATGTTCAAACC
IL-6F: ACTCCTCGGTCTCTCCTCGTATCCGC1.9AM490062
R:CTGTGTCGAGATCATCGTTGGCTTCATAAAAGTC
TNF-αF: CACAAGAGCGGCCATTCATTTACAAGGAG2.0DQ200910
R: GGAAAGACGCTTGGCTGTAGATGG
IL-10F: ATCACAGTTCCGGCGTATTT2.0DQ821114
R: ATGGACACGTCAAAGGTGCC
Table 3. Growth performance and feed utilization efficiency of European seabass fed the experimental diets.
Table 3. Growth performance and feed utilization efficiency of European seabass fed the experimental diets.
Diets
CTRCOCOACOPOSOSAOSPSEMp Value
Final body weight70.5 b59.7 a62.6 ab63.3 ab68.9 b63.9 ab63.6 ab0.950.01
Daily Growth Index 12.48 b2.08 a2.19 ab2.22 ab2.42 b2.24 ab2.23 ab0.040.01
Feed Intake (g Kg ABW−1 day−1) 220.719.519.519.520.819.520.00.160.05
Feed Efficiency 30.950.890.920.930.930.930.910.010.27
Protein Efficiency Ratio 42.282.142.192.202.222.192.140.010.14
Survival (%)97.397.398.7100.098.798.7100.00.410.50
Values presented as means (n = 3). SEM: standard error of the mean. Different superscript letters within a row represent significant differences between treatments (p < 0.05). CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; COP: Codium polysaccharide diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet; OSP: Osmundea polysaccharide diet. Average body weight (ABW): (Initial body weight + Final body weight)/2. 1 Daily growth index = [(Final weight1/3 − Initial weight1/3)/Time in days] × 100. 2 Feed intake = Dry feed intake/Average body weight/Days. 3 Feed efficiency = Wet weight gain/Dry feed intake. 4 Protein efficiency ratio = Wet weight gain/Crude protein intake.
Table 4. Apparent digestibility coefficients (ADC 1) of the experimental diets.
Table 4. Apparent digestibility coefficients (ADC 1) of the experimental diets.
Diets
CTRCOCOAOSOSASEMp Value
Dry matter73.8 c64.6 a68.5 abc73.3 bc67.4 ab0.990.002
Protein94.4 c91.9 a92.9 ab93.9 bc93.1 abc0.230.000
Energy99.84 b99.83 b99.79 a99.80 ab99.82 ab0.010.014
Lipids96.29595.996.795.20.300.388
Values presented as means (n = 4). SEM: standard error of the mean. Different superscript letters within a row represent significant differences between treatments (p < 0.05). CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet. 1 ADC = [1 − ((dietary Cr2O3 level × feces nutrient/energy level)/(feces Cr2O3 level × dietary nutrient/energy level))] × 100.
Table 5. Intestinal levels of superoxide dismutase (SOD), catalase (CAT) (U mg protein−1), and glutathione reductase (GR) (mU mg protein−1) activities of European seabass fed the experimental diets.
Table 5. Intestinal levels of superoxide dismutase (SOD), catalase (CAT) (U mg protein−1), and glutathione reductase (GR) (mU mg protein−1) activities of European seabass fed the experimental diets.
Diets
CTRCOCOACOPOSOSAOSPSEMp Value
Superoxide dismutase32.533.234.837.931.534.136.91.030.687
Catalase62.659.167.458.260.865.260.21.520.710
Glutathione reductase12.812.013.712.112.411.512.00.370.856
Values presented as means (n = 3). SEM: standard error of the mean. CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; COP: Codium polysaccharide diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet; OSP: Osmundea polysaccharide diet.
Table 6. Details of the score-based evaluation of the distal intestine histology of European seabass fed the experimental diets.
Table 6. Details of the score-based evaluation of the distal intestine histology of European seabass fed the experimental diets.
Diets
CTRCOCOACOPOSOSAOSPSEMp Value
Villi length1.781.781.752.001.891.331.560.090.508
Lamina propria size1.001.001.131.331.001.111.110.030.099
Submucosa widening1.111.561.001.331.111.221.220.060.274
Supranuclear vacuole size2.001.781.381.781.782.331.780.090.140
Goblet cells1.671.331.382.001.891.561.890.080.132
Eosinophilic granulocytes1.111.331.131.331.111.001.220.050.635
Intraepithelial leukocytes1.221.441.381.561.221.221.220.060.616
Values presented as means (n = 3). SEM: standard error of the mean. CTR: control diet; CO: Codium diet; COA: autoclaved Codium diet; COP: Codium polysaccharide diet; OS: Osmundea diet; OSA: autoclaved Osmundea diet; OSP: Osmundea polysaccharide diet.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guerreiro, I.; Fontinha, F.; Monteiro, M.; Oliveira, J.; Marçal, R.; Magalhães, R.; Pacheco, M.; Soula, M.; Oliva-Teles, A.; Enes, P.; et al. Towards Sustainable Aquafeeds: Valorization of Codium sp. and Osmundea sp. as Functional Ingredients to Enhance Nutrient and Bioactive Compounds in European Seabass. J. Mar. Sci. Eng. 2025, 13, 1884. https://doi.org/10.3390/jmse13101884

AMA Style

Guerreiro I, Fontinha F, Monteiro M, Oliveira J, Marçal R, Magalhães R, Pacheco M, Soula M, Oliva-Teles A, Enes P, et al. Towards Sustainable Aquafeeds: Valorization of Codium sp. and Osmundea sp. as Functional Ingredients to Enhance Nutrient and Bioactive Compounds in European Seabass. Journal of Marine Science and Engineering. 2025; 13(10):1884. https://doi.org/10.3390/jmse13101884

Chicago/Turabian Style

Guerreiro, Inês, Filipa Fontinha, Marta Monteiro, Joana Oliveira, Raquel Marçal, Rui Magalhães, Mário Pacheco, Mohamed Soula, Aires Oliva-Teles, Paula Enes, and et al. 2025. "Towards Sustainable Aquafeeds: Valorization of Codium sp. and Osmundea sp. as Functional Ingredients to Enhance Nutrient and Bioactive Compounds in European Seabass" Journal of Marine Science and Engineering 13, no. 10: 1884. https://doi.org/10.3390/jmse13101884

APA Style

Guerreiro, I., Fontinha, F., Monteiro, M., Oliveira, J., Marçal, R., Magalhães, R., Pacheco, M., Soula, M., Oliva-Teles, A., Enes, P., & Couto, A. (2025). Towards Sustainable Aquafeeds: Valorization of Codium sp. and Osmundea sp. as Functional Ingredients to Enhance Nutrient and Bioactive Compounds in European Seabass. Journal of Marine Science and Engineering, 13(10), 1884. https://doi.org/10.3390/jmse13101884

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop