Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Objects and Devices
2.2. Test Grouping
2.3. Acoustic Signal Processing
2.4. Sample Collection and Measurement
2.5. Tissue Sectioning and Observation
2.6. RT-qPCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Influence of the Duration of Starvation on the Duration of Feeding in the Large Yellow Croaker
3.2. Effect of the Duration of Starvation on the Feeding Rate of the Large Yellow Croaker
3.3. Effect of Duration of Starvation on Blood Glucose Concentration in Serum of the LARGE Yellow Croaker
3.4. Effect of Intermittent Fasting on the Histological Morphology of the Liver of Large Yellow Croakers
3.5. Effect of Starvation Duration on the Expression Level of Hepatic Inflammatory Factor-Related Genes in the Large Yellow Croaker
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lin, M. Developing Large-Scale Deep Sea Aquaculture: Problems, Modes and Realization Ways. Manag. World 2022, 38, 39–60. [Google Scholar]
- Xu, H.; Cui, M.; Liu, H. Techno-economic analysis of deep-sea aquaculture in China. Ship Eng. 2024, 46, 28–39. [Google Scholar]
- Hou, J.; Zhou, W.; Wang, L. Spatial analysis of the aquaculture potential of China’s deep ocean. Resour. Sci. 2020, 42, 1325–1337. [Google Scholar]
- Chen, Z.; Li, S.; Xu, L.; Zhou, Y.; Wang, S.; Liu, Y.; Jiang, Y.; Lin, W. Analysis and Comparison of Muscle Quality in Deep Sea Aquaculture of Larimichthys croceas. Fujian Agric. Sci. Technol. 2024, 55, 25–32. [Google Scholar]
- Chen, Y.; Huang, W.; Shan, X.; Chen, J.; Weng, H.; Yang, T.; Wang, H. Growth characteristics of cage-cultured large yellow croaker (Larimichthys crocea). Aquac. Rep. 2020, 16, 100242. [Google Scholar] [CrossRef]
- Liu, F.; Lv, X.; Liu, Y.; Lou, B.; Chen, R. Effects of fasting on digestive enzyme activities of juvenile yellow croaker (Larimichthys crocea). J. Ocean Univ. China (Nat. Sci. Ed.) 2018, 48, 16–22. [Google Scholar]
- Ren, X.; Gao, D.; Yao, Y.; Yang, F.; Liu, J.; Xie, F. Studies on vocalization and signaling characteristics of the large yellow croaker (Rhinopithecus roxellana). J. Dalian Coll. Fish. 2007, 22, 123–128. [Google Scholar]
- Parmentier, E.; Lagardère, J.-P.; Braquegnier, J.-B.; Vandewalle, P.; Fine, M.L. Sound production mechanism in carapid fish: First example with a slow sonic muscle. J. Exp. Biol. 2006, 209, 2952–2960. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Huang, W.; Cui, M. Effects of stocking densities on growth performance, nutrient composition serum biochemical, digestion and energy metabolism of large yellow croaker(Larimichthys crocea). Fish. Mod. 2023, 50, 64–71. [Google Scholar]
- Chang, Y.; Wang, W.; Xu, W.; Li, M.; Xue, L.; Liang, L. Genetic differentiation between F2 and F3 cultured populations in large yellow croaker Pseudosciaena crocea. Oceanol. Limnol. Sin. 2009, 40, 414–422. [Google Scholar]
- Weng, L.; Zhang, L.; Liu, J.; Xiao, W.; Wang, Q.; Zou, L. Label-free Quantitative Differential Proteomic Analysis of Large Yellow Croaker Cultured under Different Aquaculture Modes. Food Sci. 2023, 44, 137–142. [Google Scholar]
- Ai, Q.; Wang, Y.; Zhang, J.; Liu, J.; Mai, K. Effects of Scallop Peptide in Micro-Diets on Growth Performance, Digestive Enzyme Activity and Antioxidant Capacity of Large Yellow Croaker (Larimichthys crocea) Larvae. Period. Ocean. Univ. China 2024, 54, 95–100. [Google Scholar]
- Qiu, H.; Huang, L.; Yin, H.; Wang, H.; Tao, C.; Wang, P. Multi-omics integrated analysis reveals the physiological response of large yellow croaker (Larimichthys crocea) to starvation and refeeding during overwintering. Aquac. Rep. 2024, 38, 102301. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, H.; Wang, G.; Liu, T.; Li, H.; Liu, C.; Li, H.; Qu, X.; Xue, Y.; Luo, L. Comparison of physiological status of short-term starvation and feeding of mandarin fish (Siniperca chuatsi) at low temperature in winter. Aquac. Fish. 2022, 46, 1572–1581. [Google Scholar]
- Martin, S.A.; Douglas, A.; Houlihan, D.F.; Secombes, C.J. Consistency of individual variation in feeding behaviour and its relationship with performance traits in Nile tilapia Oreochromis niloticus. Appl. Anim. Behav. Sci. 2011, 133, 109–116. [Google Scholar] [CrossRef]
- Shi, J.; Zhuo, D.; Lu, M.; Wang, H.; Gu, H.; Liu, X.; Wang, Z. Partial immune responses in Sichuan bream (Sinibrama taeniatus) after starvation. Frontiers. Immunol. 2023, 14, 1098741. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhou, H.; Hou, L.; Xing, K.; Shu, H. Transcriptional profiling of skeletal muscle reveals starvation response and compensatory growth in Spinibarbus hollandi. BMC Genom. 2019, 20, 938. [Google Scholar] [CrossRef]
- Song, G.; Peng, S.; Sun, P.; Wang, J.; Yin, F.; Shi, Z. Effects of starvation, refeeding, and feeding frequency on growth and digestive enzyme activity of Oplegnathus fasciatus. J. Fish. Sci. China/Zhongguo Shuichan Kexue 2011, 18, 1269–1277. [Google Scholar] [CrossRef]
- Biswas, G.; Jena, J.; Singh, S.; Patmajhi, P.; Muduli, H. Effect of feeding frequency on growth, survival and feed utilization in mrigal, Cirrhinus mrigala, and rohu, Labeo rohita, during nursery rearing. Aquaculture 2006, 254, 211–218. [Google Scholar] [CrossRef]
- Fan, Q.; Cheng, P.; Liu, W. Effects of starvation and refeeding on activities of digestive enzymes in Culter alburnus Basilewsky juveniles. J. Fish. Sci. China 2008, 15, 439–445. [Google Scholar]
- Li, Q.; Tang, H.; Zheng, Y.; Zhang, W. Effect of starvation and refeeding on growth and digestive enzyme activity in Megalobroma pellegrini juveniles. J. Southwest Univ. (Nat. Sci. Ed.) 2013, 35, 39–44. [Google Scholar]
- Yang, Y.; Yu, W.; Duan, Y.; Lin, H.; Huang, Z.; Huang, X.; Li, T. Effects of Starvation and Refeeding on the Compensatory Growth of Juvenile Epinephelus coioides. Aquac. Res. 2024, 2024, 9986750. [Google Scholar] [CrossRef]
- Qi, R.; Liu, H.; Liu, S. Effects of different culture densities on the acoustic characteristics of micropterus salmoide feeding. Fishes 2023, 8, 126. [Google Scholar] [CrossRef]
- Qian, Z.; Xu, J.; Zhang, C.; Yu, Y.; Liu, H. Effect of different flow velocity on tail beat frequency and blood physiology of Plectropomus leopardus. South China Fish. Sci. 2023, 19, 89–97. [Google Scholar]
- Xu, J.; Liu, Y.; Pan, L.; Yang, J. Histopathological observation of visceral sarcoidosis in Alosa sapidissima. J. Shanghai Ocean Univ. 2021, 30, 247–257. [Google Scholar]
- Zhang, W.; Zhu, C.; Chi, H.; Liu, X.; Gong, H.; Xie, A.; Zheng, W.; Chen, J.; Zhang, N.; Wu, Y. Early immune response in large yellow croaker (Larimichthys crocea) after immunization with oral vaccine. Mol. Cell. Probes 2021, 56, 101708. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Hua, X.; Yu, N.; Xing, S.; Wang, J.; Zhou, H. Response of Lipid and Protein Metabolism of Grass Carp (Ctenopharyngodon idellus) to Starvation. J. Fish. China 2012, 36, 756–763. [Google Scholar] [CrossRef]
- Asaeda, T.; Priyadarshana, T.; Manatunge, J. Effects of satiation on feeding and swimming behaviour of planktivores. Hydrobiologia 2001, 443, 147–157. [Google Scholar] [CrossRef]
- Gill, A. The dynamics of prey choice in fish: The importance of prey size and satiation. J. Fish Biol. 2003, 63, 105–116. [Google Scholar] [CrossRef]
- Sass, G.; Motta, P. The effects of satiation on strike mode and prey capture kinematics in the largemouth bass, Micropterus salmoides. Environ. Biol. Fishes 2002, 65, 441–454. [Google Scholar] [CrossRef]
- Cao, X.; Liu, H.; Qin, R. Acoustic characteristics of feeding behavior of largemouth bass (Micropterus salmoides) on pelletedfeed in recirculating aquaculture systems. Trans. Chin. Soc. Agric. Eng. 2021, 37, 219–225. [Google Scholar]
- Chen, H.; Xie, Y.; Lin, G.; Lin, X.; Chen, W.; Wang, X. Feeding rhythm and tolerance of starvation during early development stage of devil stinger, Inimicus japonicus. J. Fish. Sci. Chin. 2009, 16, 340–347. [Google Scholar]
- Peng, Z.; Liu, M.; Luo, H.; Fu, R.; Zhang, F.; Mao, Z. Starvation and point of No return in striped knifejaw Oplegnathus fasciatus larvae. Fish. Sci. 2010, 29, 152–155. [Google Scholar]
- Blaxter, J.; Hempel, G. The influence of egg size on herring larvae (Clupea harengus L.). ICES J. Mar. Sci. 1963, 28, 211–240. [Google Scholar] [CrossRef]
- Fan, G.; Li, Y. Effects of starvation on metabolism of glucose in juvenile Silurus meridonalis. J. Chongqing Norm. Univ. 2011, 28, 22–27. [Google Scholar]
- Furné, M.; García-Gallego, M.; Hidalgo, M.C.; Morales, A.E.; Domezain, A.; Domezain, J.; Sanz, A. Effect of starvation and refeeding on digestive enzyme activities in sturgeon(Acipenser naccarii) and trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2008, 149, 420–425. [Google Scholar] [CrossRef]
- Liu, S. Exploration of factors influencing the histomorphology of fish liver. South. Agric. 2022, 16, 175–177. [Google Scholar]
- Gao, L.; Chen, L.; Zhao, X.; Zhuang, P. Starvation and compensatory growth of Acipenser schrenkii juveniles. Effect on digestiveorgans structure and digestive enzyme activity. J. Fish. Sci. China 2004, 11, 413–419. [Google Scholar]
- Bisal, G.; Bengtson, D. Discription of starving condition in summer flounder Paralichthys dentatus early history stage. Fishy Bull. 1995, 93, 217–230. [Google Scholar]
- Caruso, G.; Denaro, M.G.; Caruso, R.; Mancari, F.; Genovese, L.; Maricchiolo, G. Response to short term starvation of growth, haematological, biochemical and non-specific immune parameters in European sea bass (Dicentrarchus labrax) and blackspot sea bream (Pagellus bogaraveo). Mar. Environ. Res. 2011, 72, 46–52. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y. Bioenergetics mechanisms of compensatory growth in maricultured tilapia. Mar. Lacustrine 2001, 32, 233–239. [Google Scholar]
- Swain, B.; Samanta, M.; Basu, M.; Panda, P.; Sahoo, B.; Maiti, N.; Mishra, B.; Eknath, A. Molecular characterization, inductive expression and mechanism of interleukin-10gene induction in the Indian major carp, catla (Catla catla). Aquac. Res. 2012, 43, 897–907. [Google Scholar] [CrossRef]
- Grayfer, L.; Belosevic, M. Identification and molecular characterization of the interleukin-10 receptor 1 of the zebrafish(Danio rerio) and the goldfish (Carassius auratus L.). Dev. Comp. Immunol. 2012, 36, 408–417. [Google Scholar] [CrossRef] [PubMed]
Aquaculture Parameter | Range/Value |
---|---|
Water Temperature | 23~28 °C |
Dissolved Oxygen | 4.0~6.5 mg·L−1 |
pH Value | 7.8~8.5 |
Salinity | 28~32‰ |
Feed Attribute | Description |
---|---|
Feed Type | Hard Granular Floating Feed |
Manufacturer | Ningbo Tech-Bank Feed Technology Co., Ltd., Ningbo, China |
Primary Protein Sources | Imported white fish meal, soy-based proteins (dehulled soybean meal, soy protein concentrate, fermented soybean meal) |
Primary Fat Sources | Fish oil, soybean oil |
Crude Protein Content | 45.3% |
Crude Fat Content | 9.3% |
Protein Energy Ratio | 39.2 mg/KJ |
Crude Ash Content | 12.6% |
Calcium Content | 2.1% |
Phosphorus Content | 1.9% |
Lysine Content | 3.4% |
Particle Diameter | 4–6 mm |
Groups | Time/d | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17–32 | |
S0 | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ |
S2 | × | × | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ |
S4 | × | × | × | × | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ |
S8 | × | × | × | × | × | × | × | × | √ | √ | √ | √ | √ | √ | √ | √ | √ |
S16 | × | × | × | × | × | × | × | × | × | × | × | × | × | × | × | × | √ |
Cytokine | Primer | Sequence (5′ to 3′) |
---|---|---|
β-actin | Forward | GACCTGACAGACTACCTCATG |
Reverse | AGTTGAAGGTGGTCTCGTGGA | |
IL-1β | Forward | ATGCAACGTGACCGAGATGT |
Reverse | ATTGTGCGTGGATGATGGGT | |
IL-10 | Forward | TCGGTCTCTCCTCCTATGCG |
Reverse | ACTTGTTGACGCACACTGGA | |
TNF-α | Forward | CACCCCTAAATCCCACGGTC |
Reverse | GGTAAGGTGGGGTCGGAATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Liu, H.; Zhang, C.; Zhu, C.; Liu, H. Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea). J. Mar. Sci. Eng. 2025, 13, 90. https://doi.org/10.3390/jmse13010090
Wang X, Liu H, Zhang C, Zhu C, Liu H. Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea). Journal of Marine Science and Engineering. 2025; 13(1):90. https://doi.org/10.3390/jmse13010090
Chicago/Turabian StyleWang, Xiaomeng, Huang Liu, Chenglin Zhang, Chen Zhu, and Huiyi Liu. 2025. "Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea)" Journal of Marine Science and Engineering 13, no. 1: 90. https://doi.org/10.3390/jmse13010090
APA StyleWang, X., Liu, H., Zhang, C., Zhu, C., & Liu, H. (2025). Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea). Journal of Marine Science and Engineering, 13(1), 90. https://doi.org/10.3390/jmse13010090