Next Article in Journal
Advanced Control for Shipboard Cranes with Asymmetric Output Constraints
Next Article in Special Issue
Field Experiments to Analyze the Canopy Drying Performance of Sea Anchors Used for Fishing Operations
Previous Article in Journal
Navigating the Dynamics: Modeling of Wave Propagation at Taiping Bay Port for Enhanced Design and Management
Previous Article in Special Issue
Effects of Stocking Density on Fatty Acid and Amino Acid Composition in Muscle, Serum Cortisol, Stress and Immune Response in Large Yellow Croaker (Larimichthys crocea)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea)

1
Fishery Machinery and Instrument Research Institute, Chinese Academy of Fishery Sciences, Shanghai 200092, China
2
College of Fisheries and Life Sciences, Shanghai Ocean University, Shanghai 201306, China
3
College of Marine Science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
J. Mar. Sci. Eng. 2025, 13(1), 90; https://doi.org/10.3390/jmse13010090
Submission received: 6 December 2024 / Revised: 24 December 2024 / Accepted: 25 December 2024 / Published: 6 January 2025

Abstract

:
In recent years, significant progress has been made in China in the field of deep-sea large yellow croaker (Larimichthys crocea) farming. Compared with the traditional inshore aquaculture model, deep-sea culture of large yellow croaker enjoys a wider growing space with better water quality, thus enhancing fish quality. However, deep-sea aquaculture also faces challenges such as typhoons and strong currents, which often lead to prolonged starvation in fish. Therefore, in order to further promote the technological advancement of large yellow croaker in the field of deep-sea aquaculture, this experiment aimed to investigate the effects of varying starvation durations on the feeding rhythm and physiological state of large yellow croaker. With an initial body mass of 122.62 ± 11.08 g and a body length of (17.9 ± 1.04) cm as the samples, the experiment was divided into five groups, which were starved for 0 d (S0), 2 d (S2), 4 d (S4), 8 d (S8), and 16 d (S16) before resumption of feeding. The results were as follows: under starvation stress for 8 consecutive days, the total duration of feeding gradually decreased in large yellow croaker, but increased at starvation up to 16 days. Each replicate group had 50 large yellow croakers as test subjects, for a total of 750 large yellow croakers. Analyzing the linear regression equations of S0 with S2, S4, S8, and S16 groups, it was found that the trend of rate of change in feeding duration was consistent with the total duration of feeding, i.e., it decreased during 8 days and increased at 16 days. It indicated that the rate of feeding of large yellow croaker was accelerated within 8 days of starvation, while the rate of feeding was slowed down at 16 days of starvation. Furthermore, the blood glucose concentration of large yellow croaker decreased significantly after 8 days of starvation, while it rebounded significantly in the S16 group. Meanwhile, large areas of fatty degeneration were observed in the liver on the 8th day of starvation, followed by extensive hepatocyte necrosis on the 16th day. After resumption of feeding, there was some recovery within 4 days, but hepatocytes were still extensively edematous in the S8 and S16 groups. Meanwhile, the expression of inflammatory factor genes such as IL-1β, IL-10 and TNF-α in the liver increased with the prolongation of starvation time, in which both S8 and S16 groups in the liver were significantly different from the S0 group, and after resumption of feeding, the IL-1β and TNF-α genes of the S8 and S16 groups were significantly different from those of the normal feeding group (p < 0.05), while there was no differentiation for the IL-10 gene. Therefore, based on the results of this study, it is recommended to limit the duration of starvation in the large yellow croaker to no more than 8 days.

1. Introduction

In order to further enhance the competitiveness of the industry, China is actively expanding the field of deep-sea aquaculture and accelerating the construction of an efficient and sustainable deep-sea aquaculture fishery system [1]. At the same time, the development of deep-water aquaculture cage technology and advanced aquaculture vessels has emerged as a pivotal strategic direction for facilitating the optimization and transformation of China’s modern fishing industry structure, aiming to steer towards high-quality, green, and sustainable growth of the fishing economy [2]. According to relevant studies, through the adoption of more advanced aquaculture technology and equipment, deep-sea aquaculture has been able to expand its operational range to deeper waters and areas with better current exchange. Deep-sea aquaculture has revolutionized large yellow croaker culture, alleviating pressure on offshore aquaculture and enhancing product quality and market competitiveness [3]. The introduction of deep-sea aquaculture has brought about significant changes in the culture of large yellow croaker (Larimichthys crocea). This model has not only effectively alleviated the pressure on offshore aquaculture, but also significantly improved the quality and market competitiveness of high-quality marine aquaculture products, including large yellow croaker. Zou [4] and colleagues found that large yellow croakers from deep-sea enclosures had significantly higher nutrient contents than near-shore net pen-cultured ones. Deep-sea aquaculture of the large yellow croaker provides a wider and better water quality growing environment for these fish. In the waters where large yellow croaker are farmed in the deep sea, the dissolved oxygen content is typically maintained above 5.0 milligrams per liter, the pH value usually ranges between 7.8 and 8.4, and the ammonia nitrogen concentration generally does not exceed 0.2 milligrams per liter. These conditions are ideal for the growth and survival of the large yellow croaker. At the same time, regarding the large yellow croaker, a key species of deep-sea aquaculture, the continuous refinement of its aquaculture technology also promotes the progress of the entire deep-sea aquaculture industry [5].
The large yellow croaker (Larimichthys crocea) belongs to the Perciformes order, Sciaenidae family, and Larimichthys genus. It is commonly known as the drum fish or the singing fish and is widely distributed in the southern Yellow Sea, the East China Sea, and the waters from Fujian to the east of the Pearl River estuary, and from the west of the Pearl River estuary to within 60-m of the isobath of the Qiongzhou Strait [6]. As a member of the family Sciaenidae, the large yellow croaker is not only known for its rich nutritional value and important economic value, but also for its unique vocal ability, which plays a critical role in its daily life [7]. This vocal behavior is closely related to various activities, including but not limited to reproduction, territorial division, foraging, and swimming. For instance, the large yellow croaker produces distinct acoustic signals depending on its activities, such as foraging, breeding, recognizing fellow species, or experiencing fear [8]. In recent years, relevant studies have been conducted around the ecological characteristics [9], artificial breeding [10], culture mode [11], and nutritional feeding [12] of the large yellow croaker. In addition, in both natural and captive environments, the large yellow croaker may experience starvation stress, which can significantly affect its growth and development, regularity of feeding behavior, and metabolic and physiological regulatory mechanisms. The adaptation and tolerance of fish to hunger vary according to their feeding type and life stage, resulting in different digestion rates. During the overwintering period, prolonged hunger will inhibit the growth and the expression of immune-related genes in large yellow croakers [13]. Starvation leads to weakened digestion and immunity, liver damage, and reduced muscle nutrition in Mandarin fish (Siniperca chuatsi) [14]; in Atlantic salmon (Salmo salar), liver, protein, lipid, and steroid metabolism are affected by starvation [15]; after starvation, Sichuan bream (Sinibrama taeniatus) show a significant decrease in biological indices; an increase in the proportion of platelets, neutrophils and monocytes; and a decrease in the proportion of lymphocytes [16]. However, intermittent fasting triggers compensatory growth, which increases the growth rate of the large yellow croaker [17]. Striped knifejaw (Oplegnathus fasciatus) juveniles show fully compensatory growth when fed after 3 days of starvation [18]. Biswas et al. found that the basic growth requirements of Roho labeo (Labeo rohita) could be met by feeding them once a day [19].
Therefore, the central focus of this study is to thoroughly investigate the feeding rhythm of the large yellow croaker in response to hunger stress, optimizing feeding strategies according to the duration of hunger to elevate feed conversion rates and minimize waste. Furthermore, by monitoring variations in blood glucose levels, alterations in the microstructure of liver tissue, and changes in the concentration of inflammatory factors within the liver, we aim to evaluate the prolonged health impacts of hunger on farmed fish, providing a novel perspective and pathway for fish welfare protection. Ultimately, this research endeavors to facilitate the establishment of efficient automated monitoring systems in deep-sea aquaculture, thereby advancing both farming efficiency and quality.

2. Materials and Methods

2.1. Test Objects and Devices

The test site was the Fish Behavior Observation Platform on the Pilot Base of the Institute of Fishery Machinery and Instrumentation, Rudong County, Nantong City, Jiangsu Province, China. The large yellow croakers used in the experiment were purchased from Ningbo Xiangshan Harbor Aquatic Co. (Ningbo, China). After 2 weeks of domestication, the large yellow croakers were kept in a circular tank with a diameter of 2 m, a height of 1.15 m, and a water depth of 0.8 m. The water temperature was 23–28 °C, the dissolved oxygen was maintained at 4.0–6.5 mg·L−1, the pH ranged from 7.8 to 8.5, the total ammonia nitrogen was controlled below 0.3 mg/L, and the salinity ranged from 28 to 32 ‰, with a circulating water treatment system composed of oxygenation equipment, circulating water pumps, and filtration tanks. The aquaculture tank was equipped with a circulating water treatment system consisting of an oxygenation device (Lanhuan Technology Engineering Co., Ltd., Nanjing, China), a water pump (Jiangsu Yamei Pump Industry Group, Jingjiang, China) and a filtration tank (Dezhou JUNO Rubber & Plastic Products Co., Ltd., Dezhou, China). In this experiment, we specifically used the audio–visual synchronization method to record the feeding process of the large yellow croakers each time, and the video recording equipment was a DJI Osmo Action 3 sports camera (field of view: 155°, aperture: f/2.8, electronic shutter speed: 1/8000 s to the frame rate limiting shutter; normal video recording: 1080 p (16:9): 1920 × 1080@100/120/200/240 fps; video format: MP4 (H.264/HEVC)); the recording equipment was mainly an AquaSound hydrophone measurement system (hydrophone model: AQH-020 (Aqua Sound Inc., Kobe, Japan); frequency range: 20 Hz to 20 kHz, preamplifier model: Aquafeeler IV; gain control: 20 to 70 dB, Institute of Informatics, Kyoto University, Kyoto, Japan) and the Roland QUAD-CAPTURE external sound card (Model: UA-55, Taiwan Roland Enterprise Co., Ltd. Taiwan, China). In this study, the sampling frequency of the recordings was set to 96 kHz, the sampling precision was 16 bit, and the sampling channel was a single channel with a gain of 50 dB. During the experiments, a motion camera was placed above the breeding pool in order to capture the feeding and behavioral activities of the large yellow croakers, and a hydrophone was placed in the breeding pool to receive the sound signals generated by the large yellow croakers during the feeding process. The hydrophone was connected to both the sound card and the preamplifier, and then this assembly was connected to a computer in order to analyze the hydrophone’s sound signals on the computer. The captured audio data were saved in wav format on the computer, while the video was saved in MP4 format on a memory card. In the subsequent processing, the audio track recorded by the camera was replaced with the audio from the hydrophone to synchronize the audio and image (Figure 1).

2.2. Test Grouping

The experiment was conducted with a total of five groups, each with three replicates. Each replicate group consisted of 50 large yellow croakers as the test subjects, totaling 750 fish. The initial body mass was 122.62 ± 11.08 g, and the body length was 17.9 ± 1.04 cm. As shown in Table 1, the control group labeled S0 was continuously fed throughout the entire experimental period. The large yellow croaker was fed manually once every morning at 9 am and once every evening at 7 pm, with the amount of feed for each large yellow croaker being 3% to 4% of its body weight (Table 2). The fish in the other four groups underwent different durations of starvation: specifically, those starved for 2 days were labeled S2, those starved for 4 days were labeled S4, those starved for 8 days were labeled S8, and those starved for 16 days were labeled S16. After the starvation treatment, the groups of fish were started on different days of resumption of feeding: the S2 group for 30 days, the S4 group for 28 days, the S8 group for 24 days, and the S16 group for 16 days. The overall period of the entire test was 32 days, as shown in Table 1. The feeding method was as follows (Table 3). The feeding method was similar to that of Fan [20], Li [21], and Yang [22].

2.3. Acoustic Signal Processing

The sound files were first played back and listened to using Audition 2020 audio processing software. During the data collection process, there were various states of sound signals, which could be divided into effective sound segments and ineffective sound segments. The sound synchronization collection method could match the sound signals generated during feeding with the various behaviors of the large yellow croakers during feeding in the video. Then, with the assistance of the video, the feeding waveform was determined and marked, and the effective sound segment was cut and saved. The sound signals collected contained noise, and if used directly, the accuracy of the audio would be reduced. Therefore, noise reduction processing was needed before analysis. The large yellow croaker aquaculture environment was a workshop, so the background noise was constant, after which, noise reduction was performed using the noise reduction function in Audition 2020 audio processing software. After noise reduction was completed, these ingestion sound segments could be further analyzed and processed using Matlab version 2019a as well as Praat software (X64) in order to extract the desired sound features and information. We mainly used the acoustic signal processing method of Qi et al. [23].
The total duration of feeding was the total duration of the group of large yellow croakers from the beginning of feeding to the end of feeding, in minutes.
The duration of the feeding sequence was the time from the opening of the mouth to the cessation of chewing for the nth (n = 1, 2, 3 …) feeding of a single large yellow croaker, measured in seconds.
The rate of change in feeding duration refers to the trend exhibited by the time required for a single large yellow croaker to complete each feeding event (i.e., the duration of a single feeding) as it varied with the sequence of feedings during continuous feeding behavior. By plotting the sequence of feedings (e.g., n = 1, 2, 3, …) on the x-axis and the duration of each feeding on the y-axis, and performing a least squares fitting, if a linear relationship is observed, the slope of this line can quantitatively represent this rate of change, reflecting the dynamic characteristic of how the feeding duration increases with the sequence of feedings in feeding behavior.

2.4. Sample Collection and Measurement

Samples were taken before the experiment, after the starvation treatment, and at the end of the whole experiment, respectively, with 15 fish randomly taken from each parallel group, for a total of 45 fish in each group. After being anesthetized with eugenol at a concentration of 20 mg·L−1, the body length was measured and weighed. Blood was collected from the tail vein of each large yellow croaker using a disposable syringe (2 mL) and injected into a centrifuge tube. After standing at room temperature for 2–3 h, the serum was centrifuged at 4500 r·min−1 for 15 min at 4 °C, and the supernatant was collected and stored at −20 °C for future use. Using the glucose assay kit (glucose oxidase method) from the Nanjing Jiancheng Bioengineering Institute to measure blood glucose in serum, this kit employs glucose oxidase for quantitative analysis of glucose in samples. When glucose in the sample comes into contact with glucose oxidase, a specific chemical reaction occurs, where glucose is oxidized to gluconic acid, and hydrogen peroxide (H2O2) is generated concurrently. Subsequently, under the catalysis of horseradish peroxidase, the hydrogen peroxide further decomposes and releases oxygen. During this process, colorless 4-aminoantipyrine and phenol are oxidized and coupled to form a red quinone imine compound. The intensity of the color of this compound is directly proportional to the concentration of glucose in the sample, thus allowing for indirect determination of glucose content by measuring its color intensity. The testing procedure follows the kit instructions’ proportions: calibration/serum samples and working solution are thoroughly mixed and incubated at 37 °C for 10 min. Using a spectrophotometer with a wavelength of 505 nm and a colorimetric cup optical diameter of 1.0 cm, the absorbance (A) value of each tube is determined, adjusting the “zero” point with a blank tube. The result is calculated using the following formula: glucose (mmol/L) = absorbance of the sample tube (A)/ absorbance of the standard tube (A) × calibrant concentration. We mainly used the glucose oxidase method of Qian et al. [24].

2.5. Tissue Sectioning and Observation

Liver tissue samples from the large yellow croakers were collected in triplicate, thoroughly washed with PBS to remove blood and excess water, and then preserved in 4% paraformaldehyde fixative. A suitable amount of tissue was excised, dehydrated with ethanol, and embedded in paraffin. Using a tissue slicer, 5 μm-thick wax sections were cut, dewaxed, and stained with hematoxylin-eosin (BASO BA4025) [25]. The stained sections were then resin-sealed (National Drug 10004160). The prepared slides were examined and photographed under a light microscope (Leica DM4 B, Leica Microsystems Trading Co., Shanghai, China).

2.6. RT-qPCR Analysis

Total RNA was extracted from liver tissue using the RNAsimple Total RNA Kit (Tengen Biochemical Technology Co., Beijing, China). The specific steps for the extraction were as follows: the intestinal tissue, which had been stored in a −80 °C refrigerator, was removed and ground. Buffer RLS lysis buffer was then added and vortexed to mix. The lysis buffer was allowed to stand at room temperature, followed by centrifugation to collect the supernatant. Next, 70% ethanol was added, mixed well, and transferred to the RNA extraction column. The column was centrifuged, and the filtrate was discarded. It was then washed sequentially with Buffer RWA and RWB. After treatment with DNase I reaction solution, it was washed again. The empty column was centrifuged, and the RNA was eluted with RNase Free Water. The extracted RNA was stored at −80 °C. The extracted total RNA of the tissue was checked for RNA integrity using 1% agarose gel electrophoresis. The concentration of RNA was determined using a nucleic acid analyzer. The extracted tissue total RNA was checked for RNA integrity by 1% agarose gel electrophoresis. The RNA concentration was determined by a nucleic acid analyzer. The total tissue RNA was then reverse-transcribed into cDNA using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix, which removes residual genomic DNA from the RNA template. β-actin was used as the internal reference, and the solely challenged group was used as the control. RT-qPCR cycling conditions were as follows: 95 °C for 30 s, 95 °C for 5 s, and 60 °C for 34 s (40 cycles). The relative expression levels of cytokines were calculated according to the following formula: relative expression level = 2−ΔΔCt. The cytokine primers used for RT-qPCR assay are summarized in Table 4. In this study, we selected the β-actin gene reported by Zhang et al. in 2021 as the internal reference gene. This gene exhibits stable expression in the liver cells of the large yellow croaker and is suitable for real-time fluorescent quantitative PCR analysis in this study [26].

2.7. Statistical Analysis

The sound files were analyzed using Praat software (X64) and then tested by one-way ANOVA in SPSS17 software. p < 0.05 was considered significant, and Duncan’s method was used for multiple comparisons between groups if the difference was significant. The slices were analyzed using KFBIO Slide Viewer software (KF-PRO-020) and processed with Adobe Illustrator 2022 software.

3. Results

3.1. Influence of the Duration of Starvation on the Duration of Feeding in the Large Yellow Croaker

Once the feed was dispensed, the large yellow croakers swiftly swam up from the lower depths of the culture tank to the upper layer to ingest it. The feeding rate of the large yellow croaker varies according to its hunger state and was assessed by measuring the total duration of its feeding activity. As shown in Figure 2, during the 8-day starvation period, the total feeding duration of the large yellow croakers decreased progressively with increasing starvation time upon resumption of feeding. Initially, the decline was gradual on day 2 of starvation. By day 4, the decrease was most pronounced. Subsequently, at day 8 of starvation, the rate of decline was moderate compared to day 4. However, when starvation was extended to 16 days, upon resumption of feeding, the total feeding duration exhibited an upward trend.

3.2. Effect of the Duration of Starvation on the Feeding Rate of the Large Yellow Croaker

To analyze the length of the feeding sequence of the large yellow croakers, a linear regression equation was fitted independently for each hunger group, with the x-axis representing the nth feeding (n = 1, 2, …, 6) and the y-axis depicting the duration of feeding (Figure 3a). By comparing the linear regression equations of the S0 group with those of the S2, S4, S8, and S16 groups of large yellow croakers, it is evident that the ingestion duration of the large yellow croaker tends to increase as the ingestion frequency rises, showing a positive linear correlation between these two variables.
Further analysis of the rate of change in feeding duration (Figure 3b) reveals that this rate consistently decreased over the 8-day starvation period. The decrement in the rate of change signifies an acceleration in the feeding rate of the large yellow croakers. Specifically, at the start of the starvation period (day 2), the decrease was relatively gradual. However, by the midpoint of the starvation period (day 4), the increase in the rate of feeding became the steepest, marking the maximum acceleration. Subsequently, as starvation continued to day 8, this increasing trend slowed down compared to day 4, indicating that the feeding rate peaked on the 4th day of starvation. After 16 days of starvation, the rate of change in feeding duration decreased again, suggesting a deceleration in the feeding rate of the large yellow croaker.

3.3. Effect of Duration of Starvation on Blood Glucose Concentration in Serum of the LARGE Yellow Croaker

The analysis of Figure 4 reveals that the serum glucose levels of the large yellow croakers were significantly impacted by the duration of starvation, dropping to their lowest point after 8 days. Notably, there were statistically significant differences (p < 0.05) observed between the starved large yellow croaker group and the S0 group. Additionally, significant differences (p < 0.05) were also identified between the S8 group and the S0, S2, S4, and S16 groups.

3.4. Effect of Intermittent Fasting on the Histological Morphology of the Liver of Large Yellow Croakers

Figure 5 displays the changes in liver tissue structure of large yellow croakers under different starvation treatments. In the S0 group, the liver structure of the large yellow croakers is clear, with orderly arranged hepatic plates and centrally located hepatocyte nuclei, accompanied by hemosiderin deposition (□). As the starvation period was extended, changes occurred in the liver: In the S2 group, the boundaries of hepatocytes became blurred, with the appearance of vacuolar degeneration (←), and there was a distribution of red blood cells surrounding them (○). In the S4 group, the boundaries of hepatocytes became even more blurred, the hepatocyte stroma enlarged, and the hepatocytes underwent vacuolar degeneration (←), with red blood cells nearby (○). In the S8 group, the liver exhibited fatty degeneration and vacuolation (←). In the S16 group, hepatocyte necrosis (↗) occurred, with boundaries disappearing and cell disruption. After refeeding following starvation, in the S2 group, the fatty degeneration and vacuolation (←) decreased compared to during starvation, with a distribution of red blood cells (○). In the S4 group, vacuolation (←) still existed, but the phenomena of fatty degeneration and vacuolation (←) were alleviated compared to during starvation. In the S8 group, the interstitial spaces between liver lobules enlarged, and the boundaries of hepatocytes were clear, with cellular edema (↓). In the S16 group, hepatocytes also exhibited edema (↓).

3.5. Effect of Starvation Duration on the Expression Level of Hepatic Inflammatory Factor-Related Genes in the Large Yellow Croaker

Figure 6 displays the expression levels of inflammatory factor-related genes in the livers of large yellow croaker from various starvation groups. As the starvation duration increased, the expression levels of IL-1β, IL-10, and TNF-α genes in the livers of large yellow croakers exhibited an upward trend, peaking in the S16 group. Notably, the expression levels of IL-1β, IL-10, and TNF-α genes in both the S8 and S16 groups were significantly different from those in the S0 group (p < 0.05). Following the resumption of feeding, the inflammatory factors in all groups showed signs of recovery compared to their starvation levels. Specifically, the expression levels of IL-1β and TNF-α genes in both the S8 and S16 groups were significantly different (p < 0.05) from those in the normal feeding group. However, there were no significant differences (p > 0.05) in the expression levels of TNF-α genes between any of the groups.

4. Discussion

In nature, due to the uneven distribution of food resources over time and space as well as rapid environmental changes, fish often face food shortages at certain stages of their life cycles, thereby experiencing starvation stress [27]. Some scholars [28,29,30] have discovered that inadequate food supply or starvation intensifies fish searching activities, shortening the duration spent in prey search, while increasing the reaction distance and attack speed. Consequently, the time dedicated to capturing and swallowing prey decreases. Against this backdrop, the current study conducted monitoring on the feeding duration of the large yellow croaker and observed the subsequent phenomena: over a period of 8 days of starvation, the total feeding duration of large yellow croakers exhibited a trend of shortening. When feeding resumed, the large yellow croakers in the S2, S4, and S8 groups exhibited more intense feeding behavior initially, significantly shortening their overall feeding time. Further analysis of the feeding behavior data of the large yellow croakers in the S2, S4, and S8 groups revealed that the rate of change in feeding duration and the duration itself reached their lowest points in the S8 group. This finding aligns with the results of Cao [31] and others, as well as Chen and colleagues [32], who discovered that hunger stimulation enhances the foraging speed of larvae and shortens the feeding duration. However, once hunger exceeds the tolerance limit of fish, their feeding and survival abilities decline [33]. Blaxter [34] found that after larvae reach the critical hunger point, although they can still survive, most are unable to recover their normal feeding ability. The results of this experiment also support this conclusion. The total feeding duration of the large yellow croakers in the S16 group increased, and the rate of change in feeding duration also rose, indicating a decrease in their feeding speed.
Furthermore, starvation not only limits the feeding rate of the large yellow croaker but also has long-term detrimental effects on the organism, impacting its growth performance and overall health [13]. Blood glucose concentration and hepatic glycogen stores serve as crucial indicators for assessing glucose metabolism activity, tissue cell efficiency, and endocrine system function in animals. They also provide a significant reflection of liver functional status [35]. During the initial stages of starvation, the large yellow croaker mobilizes and utilizes its energy reserves, including hepatic and muscular glycogen. As the duration of fasting increases (after fasting for 8 days), these reserves are gradually depleted, leading to a continuous decline in blood glucose levels. With further prolongation of starvation, organs such as the liver begin to convert stored substances like fats and proteins into glucose to replenish serum glucose levels. This aligns with the findings of FURNé M [36] and others. Meanwhile, during starvation, the liver of the large yellow croaker undergoes other changes besides converting stored substances into glucose. In this study, fatty degeneration was observed in the large yellow croaker after 8 days of starvation, and hepatocyte necrosis occurred after 16 days. Following the resumption of feeding, a certain degree of recovery was noted within 4 days of starvation. However, hepatocyte edema was observed in the S8 and S16 groups. These findings are similar to those reported by Liu [37], Gao [38], BISAL [39], Caruso [40], and others. According to existing research, when the duration of starvation is relatively short, many fish species exhibit compensatory growth, enabling the recovery of liver tissue to reach or even surpass the levels of normal fish [41]. Further analysis of the liver of large yellow croakers revealed that the relative content of the pro-inflammatory cytokines IL-1β and TNF-α genes gradually increased with prolonged starvation. Under normal physiological conditions, the expression of IL-1β and TNF-α genes is tightly regulated to maintain immune homeostasis in the organism [42]. After subjecting grass carp (Ctenopharyngodon idellus) to starvation, Li [21] found that the expression of pro-inflammatory genes such as IL8 and TNF-α was activated, which may indicate an inflammatory response induced by starvation. There were significant differences between the starvation group after 8 days and the normally fed group. Following refeeding, the relative content of the IL-1β gene in the liver of all starvation groups showed some recovery, but significant differences still remained compared to the normally fed group after 8 days of starvation. The trend in the relative content of the immune regulatory factor IL-10 gene was also consistent with that of TNF-α and IL-1β genes. This is because IL-10 inhibits the function of monocytes/macrophages by blocking the expression of pro-inflammatory cytokines (including TNF-α and IL-1β), thereby ameliorating acute inflammatory responses. Cytokines also promote tissue repair and prevent auto-damage caused by hyperreactive immune responses [43]. After refeeding, the relative content of IL-10 in all starvation groups increased to some extent, but there were no significant differences compared to the normally fed group. This may be one of the reasons for the damage observed in liver tissue sections.
In summary, the phenomenon of a decrease in total feeding duration and the rate of change in feeding duration in large yellow croakers after being hungry for 8 days, followed by an increase in these indicators after 16 days of hunger, can be attributed to a certain degree of impairment in their bodily functions after 8 days of starvation. Moreover, the impact of hunger duration on large yellow croakers exhibits a high degree of consistency in terms of feeding acoustic characteristics and physiological trends. This discovery implies that in commercial aquaculture, feeding plans should be optimized to avoid prolonged hunger. By utilizing acoustic monitoring methods and continuously refining research methodologies, farmers can ensure that large yellow croakers are maintained in optimal growth environments, thereby improving their growth performance and aquaculture efficiency.

5. Conclusions

This study initially reveals the compensatory behaviors and physiological responses of large yellow croaker under starvation conditions, recommending that hunger stress should not exceed 8 days to prevent physiological damage. This discovery aids in optimizing feeding systems by reasonably controlling feeding amounts and frequencies, thereby enhancing the growth performance and farming efficiency of large yellow croaker while reducing disease risks. In addition, this achievement also provides a scientific basis for improving and enabling intelligent management of deep-sea aquaculture facilities, which will help drive technological innovation and industrial upgrading in aquaculture. Our findings offer valuable supplementary information for the subsequent development of automated monitoring systems in deep-sea and offshore aquaculture, systems that integrate feeding behavior with the physiological status of fish. However, the study has limitations, as it did not comprehensively explore the effects on the immune system, reproduction, and behavior, and the conclusions may be constrained by various factors. Future research needs to broaden its perspective, deepen the investigation of hunger stress, and consider individual differences and environmental factors.

Author Contributions

Methodology, X.W. and H.L. (Huang Liu); Validation, X.W. and C.Z. (Chen Zhu).; writing—original draft preparation, X.W. and H.L. (Huiyi Liu); writing—review and editing, H.L. (Huang Liu) and C.Z. (Chenglin Zhang), All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Marine S&T Fund of Shandong Province for Qingdao Marine Science and Technology Center (No. 2022QNLM030001).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting The reported results can be provided to The reader upon reasonable request.

Conflicts of Interest

The research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Lin, M. Developing Large-Scale Deep Sea Aquaculture: Problems, Modes and Realization Ways. Manag. World 2022, 38, 39–60. [Google Scholar]
  2. Xu, H.; Cui, M.; Liu, H. Techno-economic analysis of deep-sea aquaculture in China. Ship Eng. 2024, 46, 28–39. [Google Scholar]
  3. Hou, J.; Zhou, W.; Wang, L. Spatial analysis of the aquaculture potential of China’s deep ocean. Resour. Sci. 2020, 42, 1325–1337. [Google Scholar]
  4. Chen, Z.; Li, S.; Xu, L.; Zhou, Y.; Wang, S.; Liu, Y.; Jiang, Y.; Lin, W. Analysis and Comparison of Muscle Quality in Deep Sea Aquaculture of Larimichthys croceas. Fujian Agric. Sci. Technol. 2024, 55, 25–32. [Google Scholar]
  5. Chen, Y.; Huang, W.; Shan, X.; Chen, J.; Weng, H.; Yang, T.; Wang, H. Growth characteristics of cage-cultured large yellow croaker (Larimichthys crocea). Aquac. Rep. 2020, 16, 100242. [Google Scholar] [CrossRef]
  6. Liu, F.; Lv, X.; Liu, Y.; Lou, B.; Chen, R. Effects of fasting on digestive enzyme activities of juvenile yellow croaker (Larimichthys crocea). J. Ocean Univ. China (Nat. Sci. Ed.) 2018, 48, 16–22. [Google Scholar]
  7. Ren, X.; Gao, D.; Yao, Y.; Yang, F.; Liu, J.; Xie, F. Studies on vocalization and signaling characteristics of the large yellow croaker (Rhinopithecus roxellana). J. Dalian Coll. Fish. 2007, 22, 123–128. [Google Scholar]
  8. Parmentier, E.; Lagardère, J.-P.; Braquegnier, J.-B.; Vandewalle, P.; Fine, M.L. Sound production mechanism in carapid fish: First example with a slow sonic muscle. J. Exp. Biol. 2006, 209, 2952–2960. [Google Scholar] [CrossRef] [PubMed]
  9. Yu, Y.; Huang, W.; Cui, M. Effects of stocking densities on growth performance, nutrient composition serum biochemical, digestion and energy metabolism of large yellow croaker(Larimichthys crocea). Fish. Mod. 2023, 50, 64–71. [Google Scholar]
  10. Chang, Y.; Wang, W.; Xu, W.; Li, M.; Xue, L.; Liang, L. Genetic differentiation between F2 and F3 cultured populations in large yellow croaker Pseudosciaena crocea. Oceanol. Limnol. Sin. 2009, 40, 414–422. [Google Scholar]
  11. Weng, L.; Zhang, L.; Liu, J.; Xiao, W.; Wang, Q.; Zou, L. Label-free Quantitative Differential Proteomic Analysis of Large Yellow Croaker Cultured under Different Aquaculture Modes. Food Sci. 2023, 44, 137–142. [Google Scholar]
  12. Ai, Q.; Wang, Y.; Zhang, J.; Liu, J.; Mai, K. Effects of Scallop Peptide in Micro-Diets on Growth Performance, Digestive Enzyme Activity and Antioxidant Capacity of Large Yellow Croaker (Larimichthys crocea) Larvae. Period. Ocean. Univ. China 2024, 54, 95–100. [Google Scholar]
  13. Qiu, H.; Huang, L.; Yin, H.; Wang, H.; Tao, C.; Wang, P. Multi-omics integrated analysis reveals the physiological response of large yellow croaker (Larimichthys crocea) to starvation and refeeding during overwintering. Aquac. Rep. 2024, 38, 102301. [Google Scholar] [CrossRef]
  14. Xu, H.; Zhang, H.; Wang, G.; Liu, T.; Li, H.; Liu, C.; Li, H.; Qu, X.; Xue, Y.; Luo, L. Comparison of physiological status of short-term starvation and feeding of mandarin fish (Siniperca chuatsi) at low temperature in winter. Aquac. Fish. 2022, 46, 1572–1581. [Google Scholar]
  15. Martin, S.A.; Douglas, A.; Houlihan, D.F.; Secombes, C.J. Consistency of individual variation in feeding behaviour and its relationship with performance traits in Nile tilapia Oreochromis niloticus. Appl. Anim. Behav. Sci. 2011, 133, 109–116. [Google Scholar] [CrossRef]
  16. Shi, J.; Zhuo, D.; Lu, M.; Wang, H.; Gu, H.; Liu, X.; Wang, Z. Partial immune responses in Sichuan bream (Sinibrama taeniatus) after starvation. Frontiers. Immunol. 2023, 14, 1098741. [Google Scholar] [CrossRef] [PubMed]
  17. Yang, Y.; Zhou, H.; Hou, L.; Xing, K.; Shu, H. Transcriptional profiling of skeletal muscle reveals starvation response and compensatory growth in Spinibarbus hollandi. BMC Genom. 2019, 20, 938. [Google Scholar] [CrossRef]
  18. Song, G.; Peng, S.; Sun, P.; Wang, J.; Yin, F.; Shi, Z. Effects of starvation, refeeding, and feeding frequency on growth and digestive enzyme activity of Oplegnathus fasciatus. J. Fish. Sci. China/Zhongguo Shuichan Kexue 2011, 18, 1269–1277. [Google Scholar] [CrossRef]
  19. Biswas, G.; Jena, J.; Singh, S.; Patmajhi, P.; Muduli, H. Effect of feeding frequency on growth, survival and feed utilization in mrigal, Cirrhinus mrigala, and rohu, Labeo rohita, during nursery rearing. Aquaculture 2006, 254, 211–218. [Google Scholar] [CrossRef]
  20. Fan, Q.; Cheng, P.; Liu, W. Effects of starvation and refeeding on activities of digestive enzymes in Culter alburnus Basilewsky juveniles. J. Fish. Sci. China 2008, 15, 439–445. [Google Scholar]
  21. Li, Q.; Tang, H.; Zheng, Y.; Zhang, W. Effect of starvation and refeeding on growth and digestive enzyme activity in Megalobroma pellegrini juveniles. J. Southwest Univ. (Nat. Sci. Ed.) 2013, 35, 39–44. [Google Scholar]
  22. Yang, Y.; Yu, W.; Duan, Y.; Lin, H.; Huang, Z.; Huang, X.; Li, T. Effects of Starvation and Refeeding on the Compensatory Growth of Juvenile Epinephelus coioides. Aquac. Res. 2024, 2024, 9986750. [Google Scholar] [CrossRef]
  23. Qi, R.; Liu, H.; Liu, S. Effects of different culture densities on the acoustic characteristics of micropterus salmoide feeding. Fishes 2023, 8, 126. [Google Scholar] [CrossRef]
  24. Qian, Z.; Xu, J.; Zhang, C.; Yu, Y.; Liu, H. Effect of different flow velocity on tail beat frequency and blood physiology of Plectropomus leopardus. South China Fish. Sci. 2023, 19, 89–97. [Google Scholar]
  25. Xu, J.; Liu, Y.; Pan, L.; Yang, J. Histopathological observation of visceral sarcoidosis in Alosa sapidissima. J. Shanghai Ocean Univ. 2021, 30, 247–257. [Google Scholar]
  26. Zhang, W.; Zhu, C.; Chi, H.; Liu, X.; Gong, H.; Xie, A.; Zheng, W.; Chen, J.; Zhang, N.; Wu, Y. Early immune response in large yellow croaker (Larimichthys crocea) after immunization with oral vaccine. Mol. Cell. Probes 2021, 56, 101708. [Google Scholar] [CrossRef] [PubMed]
  27. Zhu, Z.; Hua, X.; Yu, N.; Xing, S.; Wang, J.; Zhou, H. Response of Lipid and Protein Metabolism of Grass Carp (Ctenopharyngodon idellus) to Starvation. J. Fish. China 2012, 36, 756–763. [Google Scholar] [CrossRef]
  28. Asaeda, T.; Priyadarshana, T.; Manatunge, J. Effects of satiation on feeding and swimming behaviour of planktivores. Hydrobiologia 2001, 443, 147–157. [Google Scholar] [CrossRef]
  29. Gill, A. The dynamics of prey choice in fish: The importance of prey size and satiation. J. Fish Biol. 2003, 63, 105–116. [Google Scholar] [CrossRef]
  30. Sass, G.; Motta, P. The effects of satiation on strike mode and prey capture kinematics in the largemouth bass, Micropterus salmoides. Environ. Biol. Fishes 2002, 65, 441–454. [Google Scholar] [CrossRef]
  31. Cao, X.; Liu, H.; Qin, R. Acoustic characteristics of feeding behavior of largemouth bass (Micropterus salmoides) on pelletedfeed in recirculating aquaculture systems. Trans. Chin. Soc. Agric. Eng. 2021, 37, 219–225. [Google Scholar]
  32. Chen, H.; Xie, Y.; Lin, G.; Lin, X.; Chen, W.; Wang, X. Feeding rhythm and tolerance of starvation during early development stage of devil stinger, Inimicus japonicus. J. Fish. Sci. Chin. 2009, 16, 340–347. [Google Scholar]
  33. Peng, Z.; Liu, M.; Luo, H.; Fu, R.; Zhang, F.; Mao, Z. Starvation and point of No return in striped knifejaw Oplegnathus fasciatus larvae. Fish. Sci. 2010, 29, 152–155. [Google Scholar]
  34. Blaxter, J.; Hempel, G. The influence of egg size on herring larvae (Clupea harengus L.). ICES J. Mar. Sci. 1963, 28, 211–240. [Google Scholar] [CrossRef]
  35. Fan, G.; Li, Y. Effects of starvation on metabolism of glucose in juvenile Silurus meridonalis. J. Chongqing Norm. Univ. 2011, 28, 22–27. [Google Scholar]
  36. Furné, M.; García-Gallego, M.; Hidalgo, M.C.; Morales, A.E.; Domezain, A.; Domezain, J.; Sanz, A. Effect of starvation and refeeding on digestive enzyme activities in sturgeon(Acipenser naccarii) and trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2008, 149, 420–425. [Google Scholar] [CrossRef]
  37. Liu, S. Exploration of factors influencing the histomorphology of fish liver. South. Agric. 2022, 16, 175–177. [Google Scholar]
  38. Gao, L.; Chen, L.; Zhao, X.; Zhuang, P. Starvation and compensatory growth of Acipenser schrenkii juveniles. Effect on digestiveorgans structure and digestive enzyme activity. J. Fish. Sci. China 2004, 11, 413–419. [Google Scholar]
  39. Bisal, G.; Bengtson, D. Discription of starving condition in summer flounder Paralichthys dentatus early history stage. Fishy Bull. 1995, 93, 217–230. [Google Scholar]
  40. Caruso, G.; Denaro, M.G.; Caruso, R.; Mancari, F.; Genovese, L.; Maricchiolo, G. Response to short term starvation of growth, haematological, biochemical and non-specific immune parameters in European sea bass (Dicentrarchus labrax) and blackspot sea bream (Pagellus bogaraveo). Mar. Environ. Res. 2011, 72, 46–52. [Google Scholar] [CrossRef] [PubMed]
  41. Wang, Y. Bioenergetics mechanisms of compensatory growth in maricultured tilapia. Mar. Lacustrine 2001, 32, 233–239. [Google Scholar]
  42. Swain, B.; Samanta, M.; Basu, M.; Panda, P.; Sahoo, B.; Maiti, N.; Mishra, B.; Eknath, A. Molecular characterization, inductive expression and mechanism of interleukin-10gene induction in the Indian major carp, catla (Catla catla). Aquac. Res. 2012, 43, 897–907. [Google Scholar] [CrossRef]
  43. Grayfer, L.; Belosevic, M. Identification and molecular characterization of the interleukin-10 receptor 1 of the zebrafish(Danio rerio) and the goldfish (Carassius auratus L.). Dev. Comp. Immunol. 2012, 36, 408–417. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Schematic diagram of audio and video information collection system.
Figure 1. Schematic diagram of audio and video information collection system.
Jmse 13 00090 g001
Figure 2. Characterization of the total duration of feeding in the large yellow croaker.
Figure 2. Characterization of the total duration of feeding in the large yellow croaker.
Jmse 13 00090 g002
Figure 3. Characterization of the feeding rate of large yellow croakers. (a) Duration of the feeding sequence of large yellow croaker in different hunger groups; (b) Rates of change in feeding duration of large yellow croaker in different hunger groups.
Figure 3. Characterization of the feeding rate of large yellow croakers. (a) Duration of the feeding sequence of large yellow croaker in different hunger groups; (b) Rates of change in feeding duration of large yellow croaker in different hunger groups.
Jmse 13 00090 g003
Figure 4. Changes in blood glucose concentration in serum of large yellow croaker. Note: Different capital letters in the graphs indicate significant differences between different starvation groups (p < 0.05).
Figure 4. Changes in blood glucose concentration in serum of large yellow croaker. Note: Different capital letters in the graphs indicate significant differences between different starvation groups (p < 0.05).
Jmse 13 00090 g004
Figure 5. Changes in the liver morphologic structure of large yellow croakers during intermittent fasting (top layer is fasting treatment, bottom layer is starvation re-feeding treatment). □ indicates hemosiderin deposition; ○ indicates the distribution of red blood cells; ← indicates vacuolation; ↓ indicates cellular edema; ↗ indicates cell necrosis. (Sections selected for liver histology were stained differently due to HE staining from different batches, so there were staining differences in the experiments due to differences in staining solutions).
Figure 5. Changes in the liver morphologic structure of large yellow croakers during intermittent fasting (top layer is fasting treatment, bottom layer is starvation re-feeding treatment). □ indicates hemosiderin deposition; ○ indicates the distribution of red blood cells; ← indicates vacuolation; ↓ indicates cellular edema; ↗ indicates cell necrosis. (Sections selected for liver histology were stained differently due to HE staining from different batches, so there were staining differences in the experiments due to differences in staining solutions).
Jmse 13 00090 g005
Figure 6. Effects of intermittent fasting on the expression levels of liver inflammatory factor-related genes in large yellow croakers. Note: Different capital letters in the graphs indicate significant differences between different starvation groups, and different lower case letters indicate significant differences between different starvation re-feeding groups (p < 0.05).
Figure 6. Effects of intermittent fasting on the expression levels of liver inflammatory factor-related genes in large yellow croakers. Note: Different capital letters in the graphs indicate significant differences between different starvation groups, and different lower case letters indicate significant differences between different starvation re-feeding groups (p < 0.05).
Jmse 13 00090 g006
Table 1. Cultural environment parameters for large yellow croakers.
Table 1. Cultural environment parameters for large yellow croakers.
Aquaculture ParameterRange/Value
Water Temperature23~28 °C
Dissolved Oxygen4.0~6.5 mg·L−1
pH Value7.8~8.5
Salinity28~32‰
Table 2. Feed Attributes of Large Yellow Croaker.
Table 2. Feed Attributes of Large Yellow Croaker.
Feed AttributeDescription
Feed TypeHard Granular Floating Feed
ManufacturerNingbo Tech-Bank Feed Technology Co., Ltd., Ningbo, China
Primary Protein SourcesImported white fish meal, soy-based proteins (dehulled soybean meal, soy protein concentrate, fermented soybean meal)
Primary Fat SourcesFish oil, soybean oil
Crude Protein Content45.3%
Crude Fat Content9.3%
Protein Energy Ratio39.2 mg/KJ
Crude Ash Content12.6%
Calcium Content2.1%
Phosphorus Content1.9%
Lysine Content3.4%
Particle Diameter4–6 mm
Table 3. Groups of large yellow croakers.
Table 3. Groups of large yellow croakers.
GroupsTime/d
1234567891011121314151617–32
S0
S2××
S4××××
S8××××××××
S16××××××××××××××××
Note: √: feeding; ×: fasting.
Table 4. The primers used for RT-qPCR assay.
Table 4. The primers used for RT-qPCR assay.
CytokinePrimerSequence (5′ to 3′)
β-actinForwardGACCTGACAGACTACCTCATG
ReverseAGTTGAAGGTGGTCTCGTGGA
IL-1βForwardATGCAACGTGACCGAGATGT
ReverseATTGTGCGTGGATGATGGGT
IL-10ForwardTCGGTCTCTCCTCCTATGCG
ReverseACTTGTTGACGCACACTGGA
TNF-αForwardCACCCCTAAATCCCACGGTC
ReverseGGTAAGGTGGGGTCGGAATG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, X.; Liu, H.; Zhang, C.; Zhu, C.; Liu, H. Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea). J. Mar. Sci. Eng. 2025, 13, 90. https://doi.org/10.3390/jmse13010090

AMA Style

Wang X, Liu H, Zhang C, Zhu C, Liu H. Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea). Journal of Marine Science and Engineering. 2025; 13(1):90. https://doi.org/10.3390/jmse13010090

Chicago/Turabian Style

Wang, Xiaomeng, Huang Liu, Chenglin Zhang, Chen Zhu, and Huiyi Liu. 2025. "Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea)" Journal of Marine Science and Engineering 13, no. 1: 90. https://doi.org/10.3390/jmse13010090

APA Style

Wang, X., Liu, H., Zhang, C., Zhu, C., & Liu, H. (2025). Mechanisms of the Effect of Starvation Duration on the Regulation of Feeding Rhythm and Metabolic Physiology of Cultured Large Yellow Croaker (Larimichthys crocea). Journal of Marine Science and Engineering, 13(1), 90. https://doi.org/10.3390/jmse13010090

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop