Next Article in Journal
Combining Agriculture and Tourism: Ways to Promote the Interconnections Between Environment, Development and Sustainability
Previous Article in Journal
Optimized Fermentation with Bacillus licheniformis on Flaxseed Cake Modulates Microbiota Toward Higher Propionate Production in Piglets
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 16
Issue 7
10.3390/agriculture16070758
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Beeswax-Based Tools for Queen Rearing Without Grafting Larvae for Apis mellifera

by
Gao Zhang
1,2,
Weiyu Yan
1,2,
Zhijiang Zeng
1,2 and
Xiaobo Wu
1,2,*
1
Honeybee Research Institute, Jiangxi Agricultural University, Nanchang 330045, China
2
Jiangxi Province Key Laboratory of Honeybee Biology and Beekeeping, Nanchang 330045, China
*
Author to whom correspondence should be addressed.
Agriculture 2026, 16(7), 758; https://doi.org/10.3390/agriculture16070758 (registering DOI)
Submission received: 12 February 2026 / Revised: 14 March 2026 / Accepted: 27 March 2026 / Published: 29 March 2026
(This article belongs to the Special Issue Physiology, Pathology, and Rearing of Bees)
Browse Figures
Versions Notes

Abstract

Queen bees form the core of honeybee colonies for reproduction, and their quality is the most critical factor affecting their reproductive and productive performance. In apicultural production, queen rearing requires beekeepers to perform manual larval grafting. This is strongly limited by the beekeepers’ eyesight and technical proficiency and has become a bottleneck restricting the development of modern apiculture. To overcome this long-standing technical challenge, we designed beeswax-based tools for queen rearing without grafting larvae for Apis mellifera. The tools consist of three core components: a single-sided hollow beeswax comb foundation, beeswax larval holders and beeswax queen cells with a hole at the bottom. The holders are paired with the hollows of the beeswax comb foundation and the hole of the beeswax queen cells. Following the construction of the comb by honeybees on the hollow foundation, the queen was confined to lay eggs on the single-sided comb. Subsequently, larval holders containing eggs or larvae were pulled out, assembled with beeswax queen cells, embedded in the buckles of queen-rearing frames, and placed into colonies for queen rearing. In order to verify the feasibility of the tools, a paired comparative experiment was conducted using Apis mellifera, with the tools as the treatment group and manual larval grafting as the control group. We evaluated multiple key indicators, including acceptance rate of queen cells, queen cell length at emergence, emergence rate, weight of newly emerged queen, morphological indices (thorax length/width, forewing width, hindwing length, head width), ovariole number and the relative mRNA expression of four queen development-related genes (Vg, Hex110, Hex70b, Jhamt). No significant differences were observed in queen cell acceptance rate and emergence rate between the two groups. However, compared with the control group, queens reared using the tools exhibited significantly greater queen cell length at emergence, higher emergence weight, superior morphological traits, more ovarioles and significantly upregulated expression of all four assayed genes. In conclusion, the tools can be used to rear high-quality Apis mellifera queens effectively with superior phenotypic and molecular traits compared to conventional grafting, which provides efficient and convenient queen-rearing tools for beekeepers.

1. Introduction

The queen bee is the only sexually mature female bee in a colony and is a key factor in its development and expansion [1]. Its quality directly affects colony strength, yield, and the quality of bee products. The natural lifespan of a queen is approximately 5–6 years. However, its capacity to lay eggs declines substantially with age. Therefore, modern apiculture requires the annual replacement of queen bees to ensure colony productivity [2]. Routine breeding and replacement of queens for European Apis mellifera lineages can significantly delay the progression of Africanization in regional honey bee populations, improve the acceptance rate of European lineage queens introduced into Africanized colonies, and provide a robust technical approach for the mitigation of colony Africanization [3,4]. China ranks among the world’s major beekeeping countries, with a total managed honey bee colony population of approximately 10 million. The majority of beekeepers operate small and medium-scale beekeeping operations, resulting in a substantial market demand for commercial honey bee queens [5]. Artificial queen rearing is a core technology in honeybee breeding. Its development has been continuously advancing, with efficiency improvements in queen quality. In 1889, the American beekeeper G. M. Doolittle elaborated on the queen-rearing technology for grafting larvae, which was rapidly promoted worldwide [6]. However, techniques for grafting larvae impose stringent requirements on the operator’s eyesight and operational proficiency. The manual transfer process is prone to causing mechanical damage to delicate larvae. This can lead to substantial fluctuations in the queen cell acceptance rate and hinder the stable large-scale production of high-quality queens. To break through this technical bottleneck, researchers have developed a series of innovative queen-rearing methods without grafting larvae and supporting systems for honey bees among which the widely used commercial systems such as the Jenter system and the Nicot system are the typical representatives worldwide [7,8,9,10,11]. Queens reared without grafting larvae are better than those reared using traditional grafting methods [10]. Nevertheless, the food-grade plastic material used in these tools has inherent drawbacks. Its odor and unnatural texture result in low natural acceptance by honeybee colonies [11]. The material of queen-rearing tools affects the colony acceptance rate, and the insufficient ecological compatibility of plastic tools has become a major barrier to the widespread application of queen-rearing technology [12]. In contrast, as a natural secretion of honeybees, beeswax has excellent ecological compatibility with colonies and superior performance in larval acceptance rate [13]. As a natural honeybee secretion, beeswax has extremely strong ecological adaptability to honeybee colonies [14]. Based on previous studies, in this study, we created a tool for queen rearing without grafting larvae made of beeswax and aimed to address the problem of honeybees being averse to plastic comb foundations and plastic queen cells. We intend to produce beeswax-based tools for queen rearing without grafting larvae using beeswax, which retains the core advantages of high efficiency and high quality of graft-free queen rearing and solves the application bottleneck of plastic materials. The findings provide a technical scheme that is compatible with the biological characteristics of honeybees for the large-scale rearing of high-quality queen bees.

2. Materials and Methods

2.1. Experimental Colonies

Five colonies of Apis mellifera ligustica with a strength of 10 full combs were selected and reared at the Honeybee Research Institute, Jiangxi Agricultural University. One colony was selected as the egg-laying colony for queen rearing, and the remaining four colonies served as nurturing colonies for queen rearing. All 4 nurse colonies used in the experiment were strictly standardized and homogenized before the trial: all colonies had consistent colony strength (equal number of worker bee frames, sealed brood, and open brood), same age of mated laying queens, sufficient pollen and honey reserves, no Varroa destructor infestation or other bee diseases, and were placed in the same experimental apiary with identical environmental conditions. The experiment was conducted between March and June 2025.

2.2. Structure and Main Accessories of the Beeswax-Based Tools for Queen Rearing Without Grafting Larvae

The beeswax-based tools for queen rearing without grafting larvae mainly comprised an egg-laying frame (Figure 1A,B), beeswax larva holders (Figure 1C), beeswax queen cells (Figure 1C), queen-rearing strips (Figure 1D), queen cell buckles (Figure 1D), and queen-rearing frames (Figure 1E). The egg-laying frame was assembled using a standard hive frame and a piece of beeswax single-sided comb foundation. The front side of the single-sided comb foundation was equipped with normal worker cell bases, with a total of 2755 cell bases. To match the natural egg-laying behavior of queen bees, hollow cells were arranged in the middle-lower portion of the comb foundation. Starting from the 9th row (counting top to bottom), one row of hollow cell bases was placed every other row of standard worker cell bases, while the bottom three rows remained as normal cell bases, yielding a total of 14 rows of perforated cell bases. Within each row, one hollow cell was positioned at intervals of two normal cell bases, extending symmetrically from the center to both sides, with 23 perforated cell bases per row. The entire comb foundation contained 322 hollow cells in total, accounting for 11.69% of all cell bases on the comb foundation (the number and distribution of hollow cell bases can be designed and adjusted as needed). The rear side of the egg-laying frame (Figure 1B) was flat and equipped with holes corresponding to the hollow cells. To prevent honey bees from building comb on the back of the frame and adhering to the larva holders, slots were designed on the rear side for inserting a baffle (Figure 1B). The baffle was perforated with ventilation holes to maintain stable and uniform humidity inside the egg-laying frame, but honeybees cannot pass through these holes. The beeswax larva holder (Figure 1C①) consisted of two interconnected small cylinders. The diameter of the small upper cylinder was consistent with the size of the holes in the hollow cells, enabling insertion of the upper cylinder of the beeswax larva holder into the holes of the hollow cells (Figure 1B). The beeswax queen cell was hollow (Figure 1C②), and the hole at the bottom of the queen cell was also matched to the diameter of the upper small cylinder of the beeswax larva holder. This allowed the upper cylinder of the larva holder to be inserted into the bottom hole of the beeswax queen cell (Figure 1C③). The diameter of the lower cylinder of the larva holder was smaller than that of the queen cell. The buckle was designed as a large cylinder (Figure 1D④) with a diameter slightly larger than the outer diameter of the queen cell. It can clamp and fix the beeswax queen cells to the inserted larva holder. A clasp was arranged on the outer side of the top of the buckle, which could be clipped into the queen-rearing strip (Figure 1D⑤).
During queen rearing, the procedure was performed as follows. Initially, beeswax larva holders were inserted into the back of the egg-laying frame, and the baffle was fitted into the prefabricated slots on the back of the frame. The egg-laying frame was then placed into a honeybee colony to allow worker bees to build the comb. After comb construction, the queen was confined to lay eggs on the comb. Once the eggs hatch, the larva holders carrying eggs or newly hatched larvae were removed and inserted into the hole of beeswax queen cells that had been placed in the colony for cleaning. Queen cells with larval holders were then fitted into buckles and clipped onto queen-rearing strips. The queen-rearing strips were attached to the queen-rearing frames, which were placed in the colony for queen rearing.

2.3. Queen Rearing

2.3.1. Comb Construction

The newly fabricated hollow beeswax comb foundation was assembled with a hive frame. Beeswax larva holders were inserted into the hollow cells from the back of the foundation. The surface of the comb foundation was coated with a sucrose solution before being placed in a strong colony for comb building. Stimulative feeding was conducted using a sucrose solution to promote wax secretion by worker bees, and the progress of comb construction was observed and recorded simultaneously.

2.3.2. Egg Laying

The mother queen was confined to laying eggs in the egg-laying frame for 6 h from 9:00 to 15:00. Subsequently, the egg-laying frame was transferred to an incubation colony for hatching. After the eggs hatched into 1-day-old larvae, graft-free and manual larva-grafted queen rearing were performed separately.

2.3.3. Preparation of Nurse Colonies

Strong colonies were selected as nursery colonies. Stimulative feeding was implemented daily during the early stages. The combs in the colony were adjusted to ensure that there were sufficient nursing bees to feed the queen bee larvae. The queen of the nurse colony was removed one day in advance to rear new queens in a queenless state.

2.3.4. Larval Transfer Methods

Once the eggs of the above laying frame hatched into 1-day-old larvae, the larva holders with larvae were extracted from the egg-laying frame, inserted into the beeswax queen cells, and clipped into the queen-rearing frame. In the manual larval grafting group, 1-day-old larvae from the same frame were carefully grafted from worker cells using a larva-grafting needle and transferred into the prepared queen cells at the same time for queen rearing as described by Büchler et al. [15], which were then clipped into the queen-rearing frame. Queen-rearing frames from both groups were placed in the same nursing colony. Meanwhile, bee bread was supplied as supplementary feeding at consistent time intervals and in equal quantities during queen rearing.

2.4. Determination of Queen Cell Acceptance Rate, Queen Cell Length, Queen Emergence Rate, and Newly Emerged Queen Weight

After 24 h of queen rearing, the acceptance rate of queen cells was calculated. On the sixth day of the capping stage, the length of each capped queen cell was measured and recorded using a vernier caliper. And the frames were placed into a constant temperature and humidity incubator (Model DHI, Aikai Instrument Equipment Co., Ltd., Shanghai, China; set at 34 °C, RH 80%). After the first queen emerged, queens were collected every 30 min. Newly emerged queens were immediately weighed using an analytical balance (Model ME204, Mettler-Toledo Instruments (Shanghai) Co., Ltd., Shanghai, China), and the data were recorded.
Queen cell acceptance rate = [number of accepted queen cells/number of grafted (or transferred) larvae] × 100%.
Queen emergence rate = (number of emerged queen cells/number of capped queens) × 100%.

2.5. Determination of Queen Morphological Indices

After weighing, the head and thorax of each queen were dissected, and the forewings and hindwings were completely separated. Referring to the method described by Ruttner [16], the morphological indices, including thorax length, thorax width, forewing length, forewing width, hindwing length, hindwing width, and head width, were measured and recorded.

2.6. Determination of the Number of Ovarian Tubules of Reared Queens

Following the methods reported by Gan et al. [17] and Chen et al. [18], the abdomen of each queen was cut along the midline. Excess tissues such as the digestive tract, midgut, and honey sac were removed. The left ovary was collected for gene expression analysis, and one ovary was designated as one sample. The remaining queen abdomen was placed into a 1.5 mL EP tube containing 1 mL of 4% paraformaldehyde fixative and soaked at 4 °C for 12 h. The right ovary was carefully removed using tweezers and placed in a plastic embedding cassette. The procedures of dehydration, embedding, sectioning, and staining were performed successively, followed by microscopic observation, photography, and counting.

2.7. Determination of Relative Expression Levels of Queen Development-Related Genes

2.7.1. RNA Extraction and cDNA Synthesis

TransZol Up (1 mL) (Cat. No. ET111; Beijing TransGen Biotech Co., Ltd., Beijing, China) was added to each tube. The samples were thoroughly homogenized using a homogenizer, and total ovarian RNA was extracted using an RNA Extraction Kit (Cat. No. ER501; Beijing TransGen Biotech Co., Ltd.). RNA concentration and purity were determined using a NanoDrop OneC spectrophotometer (NanoDrop OneC Thermo Fisher Scientific (China) Co., Ltd. Shanghai, China)). A 20 µL reaction system was established using a Reverse Transcription Kit (Cat. No. RR092A; Takara Biomedical Technology (Beijing) Co., Ltd., Beijing, China) for reverse transcription and cDNA synthesis.

2.7.2. Quantitative Real-Time PCR (qPCR) Assay

Four genes, namely, Vg, Hexamerin70b (Hex70b), Hexamerin 110 (Hex110), and Juvenile hormone acid methyltransferase (Jhamt), were selected for analysis [19,20,21]. Related gene IDs and sequences were retrieved from the NCBI database. Primer sequences were designed using primer design software, with β-actin as the reference gene. All the primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), and the primer sequences are listed in Table 1. A 10 µL qPCR reaction system was established. The amplification conditions were set as follows: pre-denaturation at 95 °C for 30 s (1 cycle); denaturation at 95 °C for 5 s, annealing at 60 °C for 34 s (40 cycles); and melting curve stage: 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s.

2.8. Data Processing

All the data were processed using SPSS 27.0 statistical software and expressed as “mean ± SD”. Data normality was checked with the Shapiro–Wilk test, and one-way ANOVA was used for comparisons among different groups. A value of p < 0.05 indicated a significant difference, while p > 0.05 indicated no significant difference. All the figures and tables were generated using GraphPad Prism 8.0 software. The relative expression levels of target genes were calculated using the 2−△△Ct method based on the quantitative real-time PCR data.

3. Results

3.1. Comparison of Two Methods on Larval Acceptance Rate, Queen Cell Length, and Queen Emergence Rate

As shown in Table 2, there were no significant differences in larval acceptance or queen emergence rates between the two groups (p > 0.05). In contrast, the queen cell length in the waxy queen rearing without grafting larvae group was significantly greater than that in the control group (p < 0.05).

3.2. Comparison of Two Methods on the Weight of Newly Emerged Queens

As shown in Figure 2, the weight of newly emerged queens in the waxy queen rearing without grafting larvae group (233.43 ± 10.92 mg) was significantly higher than that in the control group (224.24 ± 14.93 mg) (p < 0.05).

3.3. Comparison of Two Methods on the Queen Morphological Indices

As shown in Figure 3, queens reared in the waxy queen rearing without grafting larvae group exhibited significantly higher thorax length, thorax width, forewing width, hindwing length, and head width than those reared by the manual larval grafting method (p < 0.05). However, no significant differences in forewing length or hindwing width were observed between the two groups. (p > 0.05), respectively.

3.4. Comparison of Two Methods on the Relative Expression Levels of Queen Development–Related Genes

As shown in Figure 4, the relative expression levels of Vg, Hex110, Hex70b, and Jhamt in queens reared using the tools were significantly higher than those in the control group reared using the manual larva grafting method (p < 0.05).

3.5. Comparison of Two Methods on the Number of Ovarian Tubules of Reared Queens

As shown in Figure 5, the number of ovarian tubules of reared queens reared using the tools and the control group was 172.33 ± 10.84 and 149.50 ± 8.76, respectively, with a significant difference between the two groups (p < 0.05).

4. Discussion

Honeybee colony fitness and productivity are entirely dependent on queen quality [22], yet queen fecundity declines with age, making routine queen replacement essential in commercial apiculture. Since the establishment of the traditional manual larval grafting queen-rearing technology by Doolittle [6] has exhibited advantages for queen rearing, it has been constrained by bottlenecks, including high labor intensity, low efficiency, and stringent requirements for the operator’s eyesight and skills and the degradation of morphological indices and immune capacity in reared queens due to the physical damage and abnormal epigenetic modifications caused by the transfer process of artificial larvae [23]. The old method of queen rearing without grafting larvae eliminates the manual larva-picking step and substantially improves queen-rearing efficiency and queen quality. However, tools for queen rearing without grafting larvae are made of plastic materials. As substances exogenous to honeybee colonies, plastic tools show substantially lower acceptance rates by bees than traditional beeswax queen cell bases, and they also suffer from problems such as easy deformation and poor compatibility [24]. Based on the biological characteristics of honeybees and previous research, we designed beeswax-based tools for queen rearing without grafting larvae to solve the problems associated with plastic tools and to rear high-quality queens.
The beeswax-based tools on queen rearing without grafting larvae can rear queens efficiently, and there were no significant differences in larval acceptance rate and queen emergence rate between the two groups. This may be attributed to the two methods also using beeswax queen cells, meaning that the waxy queen is crucial for the rearing of queen bees. The morphological characteristics of queens are intuitive criteria for evaluating breeding quality, among which newly emerged weight, thoracic size, and ovariole number are particularly critical. Newly emerged weight is significantly positively correlated with the reproductive potential of queens [25,26,27]. Thorax length and width reflect the physical developmental status of queens and are closely related to their mating flight capability and stress resistance [28]. Indices, such as wing length, directly affect the mating flight ability of queens [29], indirectly influencing their reproductive performance. The number of ovarioles determines the upper limit of the egg-laying capacity [30]. Vg encodes a class of proteins synthesized by fat body cells that are involved in vitellogenin synthesis and regulate multiple physiological processes in honeybees, including reproduction, lifespan, and the social division of labor. Hex70b and Hex110 belong to the hexamerin storage protein family and play vital roles in ovarian development in queen bees. Jhamt is associated with caste differentiation in honeybees. Queens reared using the tools showed significantly higher values in queen cell length, newly emerged weight, morphological indices (thorax length, thorax width, forewing width, hindwing length, and head width), ovariole number, and the relative expression levels of development-related genes including Vg, Hex110, Hex70b, and Jhamt, compared with queens reared with the traditional manual larva grafting method. It is well established that the dimorphic caste differentiation of female honey bees (queen and worker castes) from genetically identical early-instar larvae is predominantly determined by two key environmental factors: the nutritional composition of larval diet and the spatial size of the brood cell. This developmental divergence is regulated by large-scale transcriptomic changes and differential DNA methylation modifications across the genome [31]. Notably, multiple independent studies have indicated that the conventional manual larval grafting technique, the most widely used queen rearing method in global apiculture, exerts a negative effect on the quality of the resulting queens, with significant reductions in core reproductive and morphological indicators [32]. The reason why the method of beeswax-based queen rearing without grafting larvae can rear high-quality queens more efficiently than the manual grafting method may be that queen larvae under the tools do not undergo the manual larva transfer process, thus avoiding mechanical damage caused by human operations. Larvae experience food deprivation during manual grafting; the larvae will undergo a period of nutrient deprivation [33]. Meanwhile, larvae in the waxy queen rearing without grafting larvae group can receive continuous feeding by worker bees from the time of hatching, obtaining more royal jelly during development [34,35]. This ensures that larvae have better nutrient acquisition and environmental conditions during development, resulting in significantly superior queen quality compared with the old method of manual grafting. These findings are consistent with those of Liu et al. [10] and Yu et al. [35]. This study has certain limitations. We only evaluated the morphological and gene expression indicators of newly emerged queens, without long-term tracking of their full-life reproductive performance including mating success, peak oviposition duration and lifetime fecundity, for which long-term field monitoring trials will be conducted in future research. Queens reared with eggs were of higher quality than those reared with grafted larvae [35]. We did not conduct experiments on queen rearing with eggs using these tools, which require further investigation.
Moreover, as the most widely recognized commercial graft-free queen rearing systems globally, the Jenter system and the Nicot system have evolved into mature, professional commercial methods with standardized protocols after decades of iterative optimization and practical validation. Extensively applied in large-scale Apis mellifera breeding across the world, these systems have demonstrated stable performance in queen cell acceptance rate and queen quality, which has been fully confirmed by previous studies and long-term apicultural practices. Meanwhile, our independently developed previous-generation plastic graft-free queen rearing tool has established a complete and replicable standardized technical workflow, which has been verified to effectively simplify grafting operations and minimize mechanical damage to bee larvae during the queen rearing process. However, this study has not conducted systematic comparative analyses on core indicators including application efficiency, queen rearing acceptance rate, operational convenience, and the quality of reared queens among our beeswax-based graft-free tool, the aforementioned commercial systems, and our previous plastic tool. Therefore, relevant comparative trials will be carried out in subsequent research to clarify the advantages, limitations, and applicable scenarios of this beeswax-based tool, thus providing a scientific basis for its technical optimization and standardized promotion. In the follow-up practical production verification, systematic comparative trials, and multi-site field tests, we will not only clarify the comprehensive application performance of the tool through systematic data comparison, but also implement targeted structural optimization and technical iterative upgrading to solve the problem of cumbersome operation, so as to achieve comprehensive improvement and full upgrading of the graft-free queen rearing tool.

5. Conclusions

In this study, natural beeswax was used as the base material to prepare the core components of the tools for queen rearing without grafting the larvae. By taking full advantage of the natural homology of beeswax with honeycombs in terms of the chemical composition and physical properties, this study resolved the acceptance barrier of plastic materials. The tools retain the core advantages of the technology for queen rearing without grafting larvae, namely, high efficiency and low larval damage, and substantially improve the acceptance rate and quality of reared queens. This achieved the optimization and upgrading of graft-free queen-rearing technology, providing a new approach for the large-scale rearing of high-quality Apis mellifera queens.

Author Contributions

Conceptualization, G.Z., Z.Z. and X.W.; methodology, G.Z., Z.Z. and X.W.; resources, X.W., W.Y. and Z.Z.; data curation, G.Z.; writing—original draft preparation, G.Z. and X.W.; writing—review and editing, G.Z., X.W. and Z.Z.; visualization, G.Z.; funding acquisition, X.W., W.Y. and Z.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Earmarked Fund for the China Agricultural Research System (CARS-44-KXJ15) and Jiangxi Agricultural Research System (JXARS-13).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yi, Y.; He, X.J.; Barron, A.B.; Liu, Y.B.; Wang, Z.L.; Yan, W.Y.; Zeng, Z.J. Transgenerational accumulation of methylome changes discovered in commercially reared honey bee (Apis mellifera) queens. Insect Biochem. Mol. Biol. 2020, 127, 103476. [Google Scholar] [CrossRef] [PubMed]
  2. Amiri, E.; Strand, M.K.; Rueppell, O.; Tarpy, D.R. Queen Quality and the Impact of Honey Bee Diseases on Queen Health: Potential for Interactions between Two Major Threats to Colony Health. Insects 2017, 8, 48. [Google Scholar] [CrossRef] [PubMed]
  3. DeGrandi-Hoffman, G.; Gilley, D.W.; Hooper, J. The influence of season and volatile compounds on the acceptance of introduced European honey bee (Apis mellifera) Queens into European and Africanized colonies. Apidologie 2007, 38, 230–237. [Google Scholar] [CrossRef]
  4. Danka, R.G.; Loper, G.M.; Villa, J.D.; Williams, J.L.; Sugden, E.A.; Collins, A.M.; Rinderer, T.E. Abating feral Africanized honey bees (Apis mellifera L) to enhance mating control of European queens. Apidologie 1994, 25, 520–529. [Google Scholar] [CrossRef]
  5. Zeng, M.; Zeng, Z.J. Investigation and analysis of rearing scale, output value and benefit of honey bee operations. Chin. J. Appl. Entomol. 2020, 57, 1139–1142. [Google Scholar] [CrossRef]
  6. Doolittle, G.M. Scientific Queen-Rearing as Practically Applied: Being a Method by Which the Best of Queen-Bees Are Reared in Perfect Accord with Nature’s Ways: For the Amateur and Veteran in Bee-Keeping; Thomas G. Newman & Son: Chicago, IL, USA, 1889. [Google Scholar]
  7. Laidlaw, H.H., Jr.; Page, R.E., Jr. Queen Rearing and Bee Breeding; Wicwas Press: Kalamazoo, MI, USA, 1997. [Google Scholar]
  8. Laidlaw, H.H., Jr. Production of queens and package bees. In The Hive and the Honey Bee; Graham, J.M., Ed.; Dadant & Sons: Hamilton, IL, USA, 1992; pp. 989–1042. [Google Scholar]
  9. Pan, Q.Z.; Wu, X.B.; Guan, C.; Zeng, Z.J. A new method of queen rearing without grafting larvae. Am. Bee J. 2013, 153, 1279–1280. Available online: https://www.researchgate.net/publication/259870689_A_New_Method_of_Queen_Rearing_without_Grafting_Larvae (accessed on 26 February 2026).
  10. Wakjira, K.; Negera, T.; Dabela, S.; Alemu, T. Comparing responses of local honeybees (Apis mellifera L.) to karl jenter and doolittle grafting queen rearing methods. Int. J. Anim. Sci. Technol. 2019, 3, 42–47. [Google Scholar] [CrossRef]
  11. Castellanos-Zacarias, C.; Dominguez-Rebolledo, A.; Zamora-Bustillos, R.; Vivas-Rodriguez, J.; Baeza-Rodriguez, J.; Ramon-Ugalde, J.; Loeza-Concha, H. Queen bee (Apis mellifera L.) production using grafting method and non-grafting system. Open Access Libr. J. 2025, 12, 10. [Google Scholar] [CrossRef]
  12. Lashari, M.A.; Ghramh, H.A.; Ahmed, A.M.; Mahmood, R.; Rafique, M.K.; Ahmad, S.; Al-Shehri, B.M.; Mohammed, M.E.A.; Khan, K.A. Aptness of diverse queen cup materials for larval graft acceptance and queen bee emergence in managed honey bee (Apis mellifera) colonies. J. King Saud Univ. Sci. 2022, 34, 102043. [Google Scholar] [CrossRef]
  13. Wu, X.B. Research progress on graft-free queen rearing methods for honey bees. Heilongjiang Anim. Sci. Vet. Med. 2018, 33–38. [Google Scholar] [CrossRef]
  14. Breed, M.D. Recognition pheromones of the honey bee. BioScience 1998, 48, 463–470. [Google Scholar] [CrossRef]
  15. Büchler, R.; Andonov, S.; Bernstein, R.; Bienefeld, K.; Costa, C.; Du, M.; Gabel, M.; Given, K.; Hatjina, F.; Harpur, B.A.; et al. Standard methods for rearing and selection of Apis mellifera queens 2.0. J. Apic. Res. 2025, 64, 555–611. [Google Scholar] [CrossRef]
  16. Ruttner, F. Biogeography and Taxonomy of Honeybees; Springer: Berlin/Heidelberg, Germany, 1988. [Google Scholar]
  17. Gan, H.Y.; Tian, L.Q.; Yan, W.Y. Preparation and staining technology of queen bee ovary sections. J. Bee 2012, 32, 9. [Google Scholar] [CrossRef]
  18. Chen, P.S.; Shen, C.H.; Bai, J.; Chen, H.; Ouyang, X.H. Exploration of observation methods for ovary tissues of Apis mellifera queens. Gansu Anim. Husb. Vet. Med. 2018, 48, 55–57. [Google Scholar] [CrossRef]
  19. Bitondi, M.M.; Nascimento, A.M.; Cunha, A.D.; Guidugli, K.R.; Nunes, F.M.; Simões, Z.L. Characterization and expression of the Hex 110 gene encoding a glutamine-rich hexamerin in the honey bee, Apis mellifera. Arch. Insect Biochem. Physiol. 2006, 63, 57–72. [Google Scholar] [CrossRef]
  20. Pang, Q.; Wang, Y.; Wang, K.; Zhang, W.W.; Ji, T. Differential Expression Analysis of hexamerin110 and hexamerin70b in Queen Bee Ovaries at Different Larval Grafting Ages. J. Environ. Entomol. 2017, 39, 62–67. [Google Scholar]
  21. Corona, M.; Velarde, R.A.; Remolina, S.; Moran-Lauter, A.; Wang, Y.; Hughes, K.A.; Robinson, G.E. Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity. Proc. Natl. Acad. Sci. USA 2007, 104, 7128–7133. [Google Scholar] [CrossRef]
  22. Hu, F.L.; Jin, S.H.; Zheng, H.Q. Establishment of multi-queen colonies of Apis mellifera and observation of queen egg-laying capacity. Acta Entomol. Sin. 2005, 48, 465–468. [Google Scholar] [CrossRef]
  23. Wang, L.M.; Xiao, J.H.; Zhang, F.; Han, X. Larval grafting for queen rearing affects miRNA expression in Apis mellifera queens. J. Environ. Entomol. 2024, 46, 866–872. [Google Scholar] [CrossRef]
  24. Abou-Shaara, H.; Mehrparvar, S.; Read, Q.D.; Chen, J.; Amiri, E. Impact of commercial plastic queen cell cups on rearing success and development of honey bee queens. J. Apic. Res. 2025, 64, 1074–1084. [Google Scholar] [CrossRef]
  25. Woyke, J. Correlations between the age at which honeybee brood is grafted, characteristics of the resultant queens, and results of insemination. J. Apic. Res. 1971, 10, 45–55. [Google Scholar] [CrossRef]
  26. Delaney, D.A.; Keller, J.J.; Caren, J.R.; Tarpy, D.R. The physical, insemination, and reproductive quality of honey bee queens (Apis mellifera L.). Apidologie 2011, 42, 1–13. [Google Scholar] [CrossRef]
  27. Tarpy, D.R.; Keller, J.J.; Caren, J.R.; Delaney, D.A. Assessing the mating ‘health’ of commercial honey bee queens. J. Econ. Entomol. 2012, 105, 20–25. [Google Scholar] [CrossRef] [PubMed]
  28. Facchini, E.; De Iorio, M.G.; Turri, F.; Pizzi, F.; Laurino, D.; Porporato, M.; Rizzi, R.; Pagnacco, G. Investigating genetic and phenotypic variability of queen bees: Morphological and reproductive traits. Animals 2021, 11, 3054. [Google Scholar] [CrossRef]
  29. Es’kov, E.K.; Es’kova, M.D. Factors influencing wing size and body weight variation in the western honeybee. Russ. J. Ecol. 2013, 44, 433–438. [Google Scholar] [CrossRef]
  30. Hatjina, F.; Bieńkowska, M.; Charistos, L.; Chlebo, R.; Costa, C.; Dražić, M.M.; Filipi, J.; Gregorc, A.; Ivanova, E.N.; Kezić, N.; et al. A review of methods used in some European countries for assessing the quality of honey bee queens through their physical characters and the performance of their colonies. J. Apic. Res. 2014, 53, 337–363. [Google Scholar] [CrossRef]
  31. Kucharski, R.; Maleszka, J.; Forêt, S.; Maleszka, R. Nutritional Control of Reproductive Status in Honeybees via DNA Methylation. Science 2008, 319, 1827–1830. [Google Scholar] [CrossRef]
  32. Rangel, J.; Keller, J.J.; Tarpy, D.R. The effects of honey bee (Apis mellifera L.) queen reproductive potential on colony growth. Insectes Sociaux 2013, 60, 65–73. [Google Scholar] [CrossRef]
  33. Wang, D.C.; He, Y.H. Experimental study on the superiority of naturally mated honey bee queens over artificially reared queens. J. Bee 2005, 25, 7–8. [Google Scholar] [CrossRef]
  34. Spivak, M.; Reuter, G.S. Successful Queen Rearing: Short Course; University of Minnesota Extension Service: St. Paul, MN, USA, 1994. [Google Scholar]
  35. Yu, L.; He, X.; Shi, X.; Yan, W.; Wu, X. Honey bee maternal effects improve worker performance and reproductive ability in offspring. Front. Cell Dev. Biol. 2023, 11, 1156923. [Google Scholar] [CrossRef]
Agriculture 16 00758 g001
Figure 1. Structure of beeswax-based tools on queen rearing without grafting larvae: (A) Front view of the egg-laying frame. (B) Back view of the egg-laying frame. (C) ①: Beeswax larva holder (bottom view, top view, and front view in sequence from left to right). (C) ②: Beeswax queen cell (bottom view, top view, and front view in sequence from left to right). (C) ③: Assembly view (bottom view, top view, and front view in sequence from left to right). (D) ④: Plastic queen cell buckle. (D) ⑤: Bamboo strip with clamping slots. (D) ⑥: Assembly view of the queen-rearing strip. (E) Queen-rearing frame.
Figure 1. Structure of beeswax-based tools on queen rearing without grafting larvae: (A) Front view of the egg-laying frame. (B) Back view of the egg-laying frame. (C) ①: Beeswax larva holder (bottom view, top view, and front view in sequence from left to right). (C) ②: Beeswax queen cell (bottom view, top view, and front view in sequence from left to right). (C) ③: Assembly view (bottom view, top view, and front view in sequence from left to right). (D) ④: Plastic queen cell buckle. (D) ⑤: Bamboo strip with clamping slots. (D) ⑥: Assembly view of the queen-rearing strip. (E) Queen-rearing frame.
Agriculture 16 00758 g001
Agriculture 16 00758 g002
Figure 2. Comparison of two methods on newly emerged queen weight (n = 36). Bars represent Mean ± SD. * Indicates that the difference between the two groups is significant (p < 0.05).
Figure 2. Comparison of two methods on newly emerged queen weight (n = 36). Bars represent Mean ± SD. * Indicates that the difference between the two groups is significant (p < 0.05).
Agriculture 16 00758 g002
Agriculture 16 00758 g003
Figure 3. Comparison of two methods on the queen morphological indices (n = 30). Bars represent Mean ± SD. Different lowercase letters represent significant differences between groups(p < 0.05); identical letters indicate no significant difference (p > 0.05).
Figure 3. Comparison of two methods on the queen morphological indices (n = 30). Bars represent Mean ± SD. Different lowercase letters represent significant differences between groups(p < 0.05); identical letters indicate no significant difference (p > 0.05).
Agriculture 16 00758 g003
Agriculture 16 00758 g004
Figure 4. Comparison of two methods on the relative expressions of queen development-related genes (Vg, Hex110, Hex70b, and Jhamt) (n = 12). Bars represent Mean ± SD. Different lowercase letters represent significant differences between groups(p < 0.05); identical letters indicate no significant difference (p > 0.05).
Figure 4. Comparison of two methods on the relative expressions of queen development-related genes (Vg, Hex110, Hex70b, and Jhamt) (n = 12). Bars represent Mean ± SD. Different lowercase letters represent significant differences between groups(p < 0.05); identical letters indicate no significant difference (p > 0.05).
Agriculture 16 00758 g004
Agriculture 16 00758 g005
Figure 5. Comparison of two methods on the number of ovarian tubules of queens(n = 12). Bars represent Mean ± SD. Different lowercase letters represent significant differences between groups (p < 0.05); identical letters indicate no significant difference (p > 0.05).
Figure 5. Comparison of two methods on the number of ovarian tubules of queens(n = 12). Bars represent Mean ± SD. Different lowercase letters represent significant differences between groups (p < 0.05); identical letters indicate no significant difference (p > 0.05).
Agriculture 16 00758 g005
Table 1. Primer sequences of each gene in quantitative real-time PCR.
Table 1. Primer sequences of each gene in quantitative real-time PCR.
Gene NameForward Primer Sequence (5’-3’)Reverse Primer Sequence (5’-3’)
VgCGTGTTCCAGAGGACGTTGAGGACTTCGTGGCTCTCCATC
Hex70bGGTGCTACGGTTCCACTTCAATCGATGGCGGTTGAGATCC
Hex110TGCCCAAGTTAATCTTGCTGGATATGCTTGTTGATCCTGTTGTCCT
JhamtTGAAAGCCAGCACGATACAATACCGTCCGCAACCTATGTCCAAACACTTC
β-actinGGCTCCCGAAGAACATCCTGCGAAACACCGTCACCC
Table 2. Comparison of two methods on larval acceptance rate, queen cell length, and queen emergence rate (n = 90).
Table 2. Comparison of two methods on larval acceptance rate, queen cell length, and queen emergence rate (n = 90).
Queen-Rearing MethodsLarval Acceptance RateQueen’s Emerging RateLength of the Queen Cell
Waxy queen rearing without grafting larvae84.72 ± 6.28 a98.15 ± 4.54 a30.07 ± 3.15 a
Queen rearing of manual larva grafting (control group) 86.11 ± 6.81 a91.67 ± 7.46 a27.47 ± 3.46 b
Data in the table are average ± SD. Data in the same column with different shoulder-script letters indicate significant differences (p < 0.05); the same letters indicate no significant difference (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, G.; Yan, W.; Zeng, Z.; Wu, X. Beeswax-Based Tools for Queen Rearing Without Grafting Larvae for Apis mellifera. Agriculture 2026, 16, 758. https://doi.org/10.3390/agriculture16070758

AMA Style

Zhang G, Yan W, Zeng Z, Wu X. Beeswax-Based Tools for Queen Rearing Without Grafting Larvae for Apis mellifera. Agriculture. 2026; 16(7):758. https://doi.org/10.3390/agriculture16070758

Chicago/Turabian Style

Zhang, Gao, Weiyu Yan, Zhijiang Zeng, and Xiaobo Wu. 2026. "Beeswax-Based Tools for Queen Rearing Without Grafting Larvae for Apis mellifera" Agriculture 16, no. 7: 758. https://doi.org/10.3390/agriculture16070758

APA Style

Zhang, G., Yan, W., Zeng, Z., & Wu, X. (2026). Beeswax-Based Tools for Queen Rearing Without Grafting Larvae for Apis mellifera. Agriculture, 16(7), 758. https://doi.org/10.3390/agriculture16070758

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop