Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Sampling and Identification
2.2. DNA Extraction
2.3. Design of A. spiniferus Primers and Probes
2.4. Real-Time PCR Optimization
2.5. Performance Characteristics
- -
- Analytical specificity: comparing both the tested targets (inclusivity) and non-targets (exclusivity) in the same amplification reactions with a real-time PCR, tested using normalized genomic DNA from target and non-target organisms at a final concentration of 10 ng/µL.
- -
- Analytical sensitivity (limit of detection—LoD) was assessed using a 10-fold 1:5 serial dilution in triplicate of genomic DNA extracts from single adults. The evaluation range was between 5 ng/µL and 5.12 fg/µL. All dilution measurements were performed with QIAxpert (Qiagen Hilden, Germany). Mean Cq values and their standard deviations (SDs) were calculated for the target species.
- -
- For the repeatability test, the diagnostic protocols were tested on 8 adult samples of A. spiniferus in triplicate. The reproducibility test was carried out on the same samples by two different operators on different days as in [31,38]. DNA extracts were normalized to a concentration of 0.04 ng/µL (corresponding to the third serial dilution used in the analytical sensitivity test).
3. Results
3.1. DNA Extraction
3.2. TaqMan Probe Protocol Real-Time PCR Optimization
3.3. Performance Characteristics
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ouvrard, D.; Martin, J.H. The Whiteflies—Taxonomic Checklist of the World’s Whiteflies (INSECTA: Hemiptera: Aleyrodidae). 2021. Available online: http://www.hemiptera-databases.org/whiteflies/ (accessed on 25 January 2024). [CrossRef]
- Nguyen, R.; Sailer, R.I.; Hamon, A.B. Catalog of Aleyrodidae on Citrus and Their Natural Enemies (Homoptera—Aleyrodidae); Occasional papers of the Florida State Collection of Arthropods. In Bureau of Entomology; Contribution No. 730; Florida Department of Agriculture & Consumer Services, Division of Plant Industry: Orlando, FL, USA, 1993; Volume 8. [Google Scholar]
- Dubey, A.K.; Ko, C.C. Sexual Dimorphism among Species of Aleurocanthus Quaintance & Baker (Hemiptera: Aleyrodidae) in Taiwan, with One New Species and an Identification Key. Zootaxa 2012, 23, 1–23. [Google Scholar] [CrossRef]
- EFSA—European Food Safety Authority. Pest categorization of Aleurocanthus spp. Scientific opinion: EFSA J. 2018, 16, 5436. [CrossRef]
- Porcelli, F. First Record of Aleurocanthus spiniferus (Homoptera: Aleyrodidae) in Apulia, Southern Italy. EPPO Bull. 2008, 38, 516–518. [Google Scholar] [CrossRef]
- Cioffi, M.; Cornara, D.; Corrado, I.; Jansen, M.G.M.; Porcelli, F. The status of Aleurocanthus spiniferus from its unwanted introduction in Italy to date. Bull. Insectology 2013, 66, 273–281. [Google Scholar]
- El Kenawy, A.; Cornara, D.; Corrado, I.; El-Heneidy, A.; Rapisarda, C.; Porcelli, F. Aleurocanthus spiniferus (Quaintance) (Hemiptera Aleyrodidae) is spreading throughout the Italian region Apulia. In Proceedings of the Fifth International Scientific Agricultural Symposium “Agrosym 2014”, Jahorina, Bosnia and Herzegovina, 23–26 October 2014; pp. 478–482. [Google Scholar]
- Nutricato, S.; D’onghia, A.M.; Fedele, A.; Filì, V.; Garonna, A.P.; Guario, A.; Guastamacchia, F.; Mazzeo, M.; Parisi, V.; Percoco, A.; et al. New quarantine whitefly recorded in Apulia. Inf. Agrar. 2009, 65, 57–59. (In Italian) [Google Scholar]
- Kapantaidaki, D.E.; Antonatos, S.; Kontodimas, D.; Milonas, P.; Papachristos, D.P. Presence of the Invasive Whitefly Aleurocanthus spiniferus (Hemiptera: Aleyrodidae) in Greece. EPPO Bull. 2019, 49, 127–131. [Google Scholar] [CrossRef]
- Markotić, V.; Bažok, R.; Masten Milek, T.; Šimala, M.; Pintar, M. Checklist of Phytophagous Insects on Citrus from the Sternorrhyncha (Hemiptera) Suborder in Mediterranean Basin and the Risk for Introduction and Harmfulness in Croatia. J. Central Eur. Agric. 2020, 21, 618–632. [Google Scholar] [CrossRef]
- Radonjić, S.; Hrnčić, S.; Malumphy, C. First record of Aleurocanthus spiniferus (Quaintance) (Homoptera: Aleyrodidae) in Montenegro. Redia 2014, 97, 141–145. [Google Scholar]
- Šimala, M.; Masten, M.T. First record of the orange spiny whitefly, Aleurocanthus spiniferus Quaintance, 1903 (Hemiptera: Aleyrodidae), in Croatia. In Proceedings of the Conference ‘Zbornik Predavanj in Referatov, 11, Slovenskega Posvetovanja o Varstvu Rastlin Z Mednarodno Udelezbo, Bled, Slovenia, 5–6 March 2013; Available online: https://www.cabidigitallibrary.org/doi/pdf/10.5555/20143268032 (accessed on 23 October 2024).
- Streito, J.-C.; Mendes, E.; Sanquer, E.; Strugarek, M.; Ouvrard, D.; Robin-Havret, V.; Poncet, L.; Lannou, C.; Rossi, J.-P. Incursion preparedness, citizen science and early detection of invasive insects: The case of Aleurocanthus spiniferus (Hemiptera, Aleyrodidae) in France. Insects 2023, 14, 916. [Google Scholar] [CrossRef]
- EPPO. EPPO Reporting Service no. 05. 2022. Available online: https://gd.eppo.int/reporting/Rse-2022-05 (accessed on 13 September 2024).
- Nugnes, F.; Laudonia, S.; Jesu, G.; Jansen, M.G.M.; Bernardo, U.; Porcelli, F. Aleurocanthus spiniferus (Hemiptera: Aleyrodidae) in Some European Countries: Diffusion, Hosts, Molecular Characterization, and Natural Enemies. Insects 2020, 11, 42. [Google Scholar] [CrossRef]
- Rapisarda, C.; Longo, S. First report from Sicily (Italy) of the orange spiny whitefly, Aleurocanthus spiniferus (Quaintance) (Hemiptera: Aleyrodidae), and its potential risk for the Italian citrus industry. EPPO Bull. 2021, 51, 329–332. [Google Scholar] [CrossRef]
- EPPO. EPPO Global Database. 2024. Available online: https://gd.eppo.int/taxon/ALECSN (accessed on 13 September 2024).
- EPPO. EPPO A2 List of Pests Recommended for Regulation as Quarantine Pests—Version 09. 2023. Available online: https://www.eppo.int/ACTIVITIES/plant_quarantine/A2_list (accessed on 13 September 2024).
- Bubici, G.; Prigigallo, M.I.; Garganese, F.; Nugnes, F.; Jansen, M.; Porcelli, F. First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs. Insects 2020, 11, 161. [Google Scholar] [CrossRef] [PubMed]
- CABI—PlantwisePlus Knowledge Bank. Aleurocanthus spiniferus (Orange Spiny Whitefly). 2022. Available online: https://www.cabidigitallibrary.org/doi/abs/10.1079/cabicompendium.4136 (accessed on 24 September 2024).
- Gyeltshen, J.; Hodges, A.; Hodges, G.S. Orange Spiny Whitefly, Aleurocanthus spiniferus (Quaintance) (Insecta: Hemiptera: Aleyrodidae). Available online: https://edis.ifas.ufl.edu/pdffiles/IN/IN61800.pdf (accessed on 28 October 2024).
- Paladin Soče, I.; Mračič Raič, I.; Juran, I.; Šimala, M.; Gotlin Culjak, T.; Skendrović Babojelić, M. Influence of the quarantine pest Aleurocanthus spiniferus (Quaintance, 1903) (Hemiptera: Aleyrodidae) on pomological and physicochemical properties of Citrus unshiu. Appl. Ecol. Environ. Res. 2022, 20, 5183–5196. [Google Scholar] [CrossRef]
- Zhang, Q.B. The reasons for rampage of citrus spiny white fly and its control. South China Fruits 2006, 2, 20–21. [Google Scholar]
- Lavra Vieira, D.; De Oliveira Barbosa, V.; Oliveira De Souza, W.C.; Goncąlves Da Silva, J.; Malaquias, J.B.; De Luna Batista, J. Potassium Silicate-Induced Resistance against Blackfly in Seedlings of Citrus Reticulata. Fruits 2016, 71, 49–55. [Google Scholar] [CrossRef]
- Massimino Cocuzza, G.E.; Jovičić, I.; Frisenna, F.; Tumminelli, R.; Siscaro, G. Discovery of Serangium montazerii Fürsch (Coleoptera, Coccinellidae) as a 1 Predator of Aleurocanthus spiniferus (Quaintance) (Hemiptera, Aleyrodidae) in Italy. EPPO Bull. 2023, 53, 376–386. [Google Scholar] [CrossRef]
- Nugnes, F.; Laudonia, S.; Garonna, A.P.; Bernardo, U.; El-Kenawy, A.; D’accolti, A.; Picciotti, U.; Porcelli, F. The Aleurocanthus spiniferus (OSW) in Europe: A becoming invasive threat to citrus also. In Proceedings of the 53rd Croatian & 13th International Symposium on Agriculture, Vodice, Croazia, 18–23 February 2018; pp. 18–38. [Google Scholar]
- Nugnes, F.; Bubici, G.; Garganese, F.; Laudonia, S.; Garonna, A.P.; Bernardo, U.; Jesu, G.; Porcelli, F. Aleurocanthus spiniferus, an alien invasive threat to Europe, associated bacterial community and natural enemies. In Proceedings of the XI European Congress of Entomology, Napoli, Italy, 2–6 July 2018; p. 38, ISBN 978-88-9092-621-1. [Google Scholar]
- Laudonia, S.; Melone, G.; Ascolese, R.; Nugnes, F. Eretmocerus iulii Laudonia et Melone sp. n.: Parasitoid associated with Aleurocanthus spiniferus. Bull. Insectology 2024. in print. [Google Scholar]
- Melone, G.; Ascolese, R.; Nugnes, F.; Porcelli, F.; Rapisarda, C.; Farina, A.; Picciotti, U.; Garganese, F.; Laudonia, S. An Eretmocerus Species, Parasitoid of Aleurocanthus spiniferus, Was Found in Europe: The Secret Savior of Threatened Plants. Sustainability 2024, 16, 2970. [Google Scholar] [CrossRef]
- Jansen, M.; Porcelli, F. Aleurocanthus camelliae (Hemiptera: Aleyrodidae), a Species Possibly New for the European Fauna of a Genus in Great Need of Revision. Tijdschr. voor Entomol. 2018, 161, 63–78. [Google Scholar] [CrossRef]
- Rizzo, D.; Suma, P.; Rossi, E.; Farina, P.; Da Lio, D.; Bartolini, L.; Salemi, C.; Farina, A.; Rapisarda, C. First Record of Aleurocanthus camelliae Kanmiya & Kasai, 2011 (Hemiptera, Aleyrodidae) from Italy, on Ornamental Camellia spp. Plants. EPPO Bull. 2021, 51, 333–339. [Google Scholar] [CrossRef]
- Capinha, C.; Essl, F.; Porto, M.; Seebens, H.; Esslc, F.; Portod, M.; Seebensg, H. The Worldwide Networks of Spread of Recorded Alien Species. Proc. Natl. Acad. Sci. USA 2023, 120, e2201911120. [Google Scholar] [CrossRef] [PubMed]
- Pace, R.; Ascolese, R.; Miele, F.; Russo, E.; Griffo, R.V.; Bernardo, U.; Nugnes, F. The Bugs in the Bags: The Risk Associated with the Introduction of Small Quantities of Fruit and Plants by Airline Passengers. Insects 2022, 13, 617. [Google Scholar] [CrossRef] [PubMed]
- Seebens, H.; Bacher, S.; Blackburn, T.M.; Capinha, C.; Dawson, W.; Dullinger, S.; Genovesi, P.; Hulme, P.E.; van Kleunen, M.; Kühn, I.; et al. Projecting the Continental Accumulation of Alien Species through to 2050. Glob. Chang. Biol. 2020, 27, 970–982. [Google Scholar] [CrossRef] [PubMed]
- Warbroek, T.; Cottyn, B.; Gottsberger, R. EPPO PM 7/129 (1) DNA barcoding as an identification tool for a number of regulated pests. EPPO Bull. 2021, 51, 100–143. [Google Scholar] [CrossRef]
- EPPO PM 7/007 (2) Aleurocanthus citriperdus, Aleurocanthus spiniferus and Aleurocanthus woglumi. EPPO Bull. 2022, 52, 346–361. [CrossRef]
- EPPO PM 7/98 (5) Specific requirements for laboratories preparing accreditation for a plant pest diagnostic activity. EPPO Bull. 2021, 51, 468–498. [CrossRef]
- Rizzo, D.; Moricca, S.; Bracalini, M.; Benigno, A.; Bernardo, U.; Luchi, N.; Da Lio, D.; Nugnes, F.; Cappellini, G.; Salemi, C.; et al. Rapid detection of Pityophthorus juglandis (Blackman) (Coleoptera, Curculionidae) with the loop-mediated isothermal amplification (lamp) method. Plants 2021, 10, 1048. [Google Scholar] [CrossRef] [PubMed]
- Ioos, R.; Fourrier, C.; Iancu, G.; Gordon, T.R. Sensitive detection of Fusarium circinatum in pine seed by combining an enrichment procedure with a real-time polymerase chain reaction using dual-labeled probe chemistry. Phytopathology 2009, 99, 582–590. [Google Scholar] [CrossRef] [PubMed]
- Rizzo, D.; Zubieta, C.G.; Sacchetti, P.; Marrucci, A.; Miele, F.; Ascolese, R.; Nugnes, F.; Bernardo, U. Diagnostic Tool for the Identification of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) Using Real-Time PCR. Insects 2024, 15, 44. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
- Rizzo, D.; Taddei, A.; Da Lio, D.; Nugnes, F.; Barra, E.; Stefani, L.; Bartolini, L.; Griffo, R.V.; Spigno, P.; Cozzolino, L.; et al. Identification of the red-necked longhorn beetle Aromia bungii (Faldermann, 1835) (Coleoptera: Cerambycidae) with real-time PCR on frass. Sustainability 2020, 12, 6041. [Google Scholar] [CrossRef]
- Van den Berg, M.A.; Greenland, J. Classical biological control of the spiny black fly, Aleurocanthus spiniferus (Hem.: Aleyrodidae), on citrus in Southern Africa. Entomophaga 1997, 42, 459–465. [Google Scholar] [CrossRef]
- Teter, S.; Steffen, L. Real-Time qPCR: Guidelines for a Comparison of Reagent Performance. 2017. Available online: https://ita.promega.com/resources/pubhub/applications-notes/an299-real-time-qpcr-guidelines-for-a-comparison-of-reagent-performance/ (accessed on 1 September 2024).
Species | Code | Coordinates | Host Plant | Stage | Supplier | Cq ± SD |
---|---|---|---|---|---|---|
Aleurocanthus spiniferus | A.S. AA 142 | 40°52′ N; 14°29′ E | Vitis vinifera | A | IPSP | 20.23 ± 0.12 |
A.S. AA 143 | IPSP | 20.34 ± 0.28 | ||||
A.S. AA 144 | 40°52′ N;14°30′ E | Prunus sp. | N1 | IPSP | 23.02 ± 0.11 | |
A.S. AA 145 | IPSP | 22.31 ± 0.27 | ||||
A.S. AA 146 | 40°50′ N; 14°31′ E | Citrus reticulata | N1 | IPSP | 25.65 ± 0.33 | |
A.S. AA 149 | 40°52′ N; 14°29′ E | Citrus × paradisi | N2 | IPSP | 20.14 ± 0.37 | |
A.S. AA 154 | 40°40′ N; 14°45′ E | Vitis sp. | A | IPSP | 20.21 ± 0.21 | |
A.S. AA 155 | N3 | IPSP | 23.67 ± 0.34 | |||
A.S. AA 156 | Citrus sp. | IPSP | 22.65 ± 0.21 | |||
A.S. AA 158 | Edera helix | IPSP | 21.23 ± 0.26 | |||
A.S. AA 159 | A | IPSP | 25.98 ± 0.18 | |||
A.S. AA 160 | 40°44′ N; 14°38′ E | Rosa sp. | P | IPSP | 24.23 ± 0.15 | |
A.S. AA 161 | A | IPSP | 21.56 ± 0.07 | |||
A.S. AA 162 | A | IPSP | 22.54 ± 0.08 | |||
A.S. AA 164 | 40°52′ N; 14°29′ E | V. vinifera | A | IPSP | 23.65 ± 0.13 | |
A.S. AA 166 | 40°52′ N; 14°30′ E | Prunus sp. | P | IPSP | 23.45 ± 0.09 | |
A.S. AA 168 | Citrus × limon | IPSP | 23.76 ± 0.11 | |||
A.S. AA 170 | 40°40′ N; 14°45′ E | Vitis sp. | N2 | IPSP | 22.87 ± 0.14 | |
A.S. AA 171 | Citrus sp. | IPSP | 22.43 ± 0.16 | |||
A.S. AA 504 | 40°42′ N; 14°42′ E | Citrus sp. | N3 | IPSP | 21.56 ± 0.18 | |
A.S. AA 509 | 40°50′ N; 14°31′ E | Citrus sp. | N2 | IPSP | 25.76 ± 0.13 | |
A.S. AA 510 | 45°04′ N; 11°47′ E | Citrus sp. | P | IPSP | 21.23 ± 0.15 | |
A.S. AA 511 | LC | IPSP | 25,56 ± 0.43 | |||
MR4110 | 43°50′ N; 11°09′ E | Rosa sp. | LC | PPS-T | 26.71 ± 0.38 | |
MR4111 | 43°51′ N; 11°05′ E | Citrus sp. | LC | PPS-T | 25.21 ± 0.37 | |
MR4112 | 44°03′ N; 10°03′ E | Citrus sp. | LC | PPS-T | 24.21 ± 0.52 | |
MR4113 | 43°46′ N; 11°17′ E | Prunus sp. | LC | PPS-T | 25.34 ± 0.47 | |
MR4114 | 42°24′ N; 11°12′ E | Citrus sp. | LC | PPS-T | 24.46 ± 0.46 | |
MR4115 | 43°13′ N; 10°35′ E | V. vinifera | LC | PPS-T | 25.76± 0.54 | |
A.S. 1_a | 37°13′ N; 14°32′ E | Citrus sp. | A | UC | 21.34 ± 0.24 | |
A.S. 1_b | Citrus sp. | N3 | UC | 23.75 ± 0.21 | ||
A.S. 2 | 40°35′ N; 17°05′ E | Citrus sp. | N2 | UC | 23.91 ± 0.45 | |
A.S. 3 | 40°35′ N; 16°58′ E | Citrus sp. | N2 | UC | 22.41 ± 0.23 | |
A.S. 4 | 41°25′ N; 12°57′ E | Citrus sp. | N3 | UC | 23.87 ± 0.14 | |
Aleurocanthus camelliae | LabDB_3080 | 43°56′ N; 10°53′ E | Camellia sasanqua | A | PPS-T | N/A |
MR 001683 | A | PPS-T | N/A | |||
MR 001684 | 43°54′ N; 10°58′ E | A | PPS-T | N/A | ||
Planococcus citri | MR 001685 | 43°33′ N; 10°19′ E | Citrus sp. | A | PPS-T | N/A |
MR 001686 | 43°09′ N; 10°36′ E | A | PPS-T | N/A | ||
MR 001687 | 42°26′ N; 11°13′ E | Citrus sp. | A | PPS-T | N/A | |
Dialeurodes citri | LabDB_3086 | 43°43′ N; 10°21′ E | Citrus sp. | A | PPS-T | N/A |
Planococcus ficus | LabDB_3126 | 43°51′ N; 10°15′ E | Vitis sp. | A | PPS-T | N/A |
Ricania speculum | In017In015C2 | 44°16′ N; 9°27′ E | Laurus nobilis | A | PPS-T | N/A |
Saissetia oleae | In062In049C2 | 43°46′ N; 11°13′ E | Olea europaea | A | PPS-T | N/A |
In066In052C2 | A | PPS-T | N/A |
Primer/Probe Name | Length (Bases) | Sequence 5′–3′ | Nucleotide Position | Product Size (bp) | Reference Sequence |
---|---|---|---|---|---|
Aspin_10F | 19 | GCCGTTATTCTGATTATGG | 10–29 | 112 | MN662925 |
Aspin_121R | 22 | GACTCCATCACTAAATAGTAAA | 121–99 | ||
Aspin_81P | 26 | FAM—AACTTAACAGCCTGCCTATAGATGAA—BHQ1 | 81–55 |
Developmental Stage | DNA Concentration (ng/µL) ± SD | A260/280 Ratio | Cq (18S) | Cq qPCR Probe (Aleu. spiniferus) |
---|---|---|---|---|
Adults | 36.1 ± 4.53 | 1.92 ± 0.23 | 18.01 ± 1.56 | 22.15 ± 1.54 |
Juvenile stages | 28.2 ± 3.25 | 1.86 ± 0.21 | 20.15 ± 2.12 | 23.45 ± 2.35 |
Leaf Discs | 45.2 ± 2.32 | 1.98 ± 0.18 | 21.45 ± 2.36 | 24.56 ± 3.21 |
Concentration | Technical Replicates | Cq Mean ± S.D. | ||
---|---|---|---|---|
A | B | C | ||
5 ng/μL | 20.92 | 20.63 | 20.79 | 20.78 ± 0.145 |
1 ng/μL | 23.07 | 22.91 | 23.08 | 23.02 ± 0.095 |
200 pg/µL | 25.28 | 25.12 | 25.41 | 25.27 ± 0.090 |
40 pg/µL | 26.71 | 26.77 | 27.13 | 26.87 ± 0.227 |
8 pg/µL | 28.85 | 29.32 | 29.57 | 29.25 ± 0.366 |
1.6 pg/µL | 31.27 | 30.98 | 31.87 | 31.37 ± 0.454 |
0.32 pg/µL | 33.58 | 35.78 | 33.3 | 34.22 ± 1.358 |
0.064 pg/µL | 35.71 | 38.87 | 37.63 | 37.4 ± 1.592 |
0.0128 pg/µL | N.A. | N.A. | N.A. | - |
5.12 fg/µL | N.A. | N.A. | N.A. | - |
Repeatability | ||||||||
Test | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
A | 27.16 | 27.79 | 27.94 | 27.92 | 27.26 | 27.6 | 27.7 | 27.9 |
B | 27.64 | 27.46 | 27.43 | 27.27 | 27.35 | 27.41 | 27.56 | 27.13 |
C | 27.54 | 27.08 | 27.21 | 27.05 | 26.98 | 27.03 | 27.21 | 27.3 |
Cq Mean ± S.D. | 27.45 ± 0.253 | 27.44 ± 0.269 | 27.53 ± 0.156 | 27.41 ± 0.156 | 27.20 ± 0.262 | 27.35 ± 0.269 | 27.49 ± 0.247 | 27.44 ± 0.120 |
Reproducibility | ||||||||
Test | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
A | 27.51 | 27.19 | 27.1 | 27.09 | 27.22 | 27.04 | 27.31 | 27.33 |
B | 27.77 | 27.16 | 27.18 | 27.24 | 27.55 | 27.63 | 27.14 | 27.18 |
C | 27.52 | 27.13 | 27.12 | 27.54 | 27.86 | 27.57 | 27.76 | 27.4 |
Cq Mean ± S.D. | 27.6 ± 0.147 | 27.16 ± 0.030 | 27.13 ± 0.042 | 27.29 ± 0.229 | 27.54 ± 0.320 | 27.41 ± 0.325 | 27.40 ± 0.320 | 27.30 ± 0.112 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rizzo, D.; Zubieta, C.G.; Moriconi, M.; Carli, M.; Marrucci, A.; Ranaldi, C.; Palmigiano, B.; Bartolini, L.; Pica, F.; Carbone, C.; et al. Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology. Agriculture 2025, 15, 414. https://doi.org/10.3390/agriculture15040414
Rizzo D, Zubieta CG, Moriconi M, Carli M, Marrucci A, Ranaldi C, Palmigiano B, Bartolini L, Pica F, Carbone C, et al. Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology. Agriculture. 2025; 15(4):414. https://doi.org/10.3390/agriculture15040414
Chicago/Turabian StyleRizzo, Domenico, Claudia Gabriela Zubieta, Michela Moriconi, Marco Carli, Andrea Marrucci, Chiara Ranaldi, Bruno Palmigiano, Linda Bartolini, Feliciana Pica, Carmela Carbone, and et al. 2025. "Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology" Agriculture 15, no. 4: 414. https://doi.org/10.3390/agriculture15040414
APA StyleRizzo, D., Zubieta, C. G., Moriconi, M., Carli, M., Marrucci, A., Ranaldi, C., Palmigiano, B., Bartolini, L., Pica, F., Carbone, C., Massimino Cocuzza, G. E., & Nugnes, F. (2025). Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology. Agriculture, 15(4), 414. https://doi.org/10.3390/agriculture15040414