Next Article in Journal
Integrated Evaluation of Sustainability and Quality of Italian Tomato Cultivars Grown Under Irrigated and Non-Irrigated Systems
Previous Article in Journal
A Neural Network with Multiscale Convolution and Feature Attention Based on an Electronic Nose for Rapid Detection of Common Bunt Disease in Wheat Plants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 4
10.3390/agriculture15040414
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology

by
Domenico Rizzo
1,
Claudia Gabriela Zubieta
1,
Michela Moriconi
1,2,
Marco Carli
1,2,
Andrea Marrucci
1,2,
Chiara Ranaldi
1,2,
Bruno Palmigiano
1,
Linda Bartolini
1,
Feliciana Pica
3,
Carmela Carbone
3,
Giuseppe Eros Massimino Cocuzza
4 and
Francesco Nugnes
3,*
1
Laboratory of Phytopathological Diagnostics and Molecular Biology, Plant Protection Service of Tuscany, Via Ciliegiole 99, 51100 Pistoia, Italy
2
Department of Agriculture, Food and Environment, University of Pisa, Via del Borghetto 80, 56124 Pisa, Italy
3
Institute for Sustainable Plant Protection (IPSP)—CNR, P.le Enrico Fermi 1, 80055 Portici, Italy
4
Department of Agriculture, Food and Environment, University of Catania, Santa Sofia 100, 95123 Catania, Italy
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(4), 414; https://doi.org/10.3390/agriculture15040414
Submission received: 30 November 2024 / Revised: 8 February 2025 / Accepted: 13 February 2025 / Published: 16 February 2025
(This article belongs to the Special Issue Sustainable Cutting-Edge Solutions for Pest Management)
Browse Figure
Versions Notes

Abstract

Aleurocanthus spiniferus (Quaintance) (Hemiptera: Aleyrodidae) has rapidly spread, mainly in the central and eastern Mediterranean coastal area, infesting various new host plants alongside known ones. This invasive species poses a significant threat to agricultural ecosystems, necessitating urgent action to monitor and control outbreaks in previously pest-free areas. While entomological and morphological recognitions are crucial for initial detection, challenges often arise in quickly identifying different developmental stages or genus-level distinctions, particularly in surveys conducted by personnel with limited entomological skills. Due to these challenges, a qPCR probe protocol was developed to enhance the diagnostic capacity of laboratories responsible for the territorial control of pests. This biomolecular tool integrates morphological surveys, enabling prompt and reliable proof of A. spiniferus presence in free areas, delimited territories, or during phytosanitary import inspections. The protocol’s high analytical specificity, inclusivity, and exclusivity ensure accurate identification of A. spiniferus, while its low limit of detection and high repeatability and reproducibility reinforce its utility as a standardized diagnostic method. By facilitating prompt and targeted control efforts, this innovative approach strengthens the resilience of agricultural systems against the widespread threat of A. spiniferus infestations.

1. Introduction

The genus Aleurocanthus (Hemiptera: Aleyrodidae) currently comprises 92 species [1], and of these just over 10 are associated with citrus or related plants [2]. Among these 10, only Aleurocanthus citriperdus Quaintance & Baker, Aleurocanthus spiniferus (Quaintance), and Aleurocanthus woglumi Ashby could cause significant economic damage to citrus [3].
While A. woglumi has extensively spread across the Americas and A. citriperdus has spread westward to the Indo-Pacific region, A. spiniferus, albeit also of oriental origin, has reached the Mediterranean basin [4]. Aleurocanthus spiniferus, commonly known as the Orange Spiny Whitefly, originally hails from China, as well as southern and southeastern Asian regions. Over the course of a century, A. spiniferus has spread to various regions, including other Asian territories, Africa, Australia, and the Pacific Islands. The invasion in Europe began in Italy in 2008, with its discovery in southern Apulia [5] marking the outset of an initial gradual northward expansion [6,7,8]. Initially, the spread of A. spiniferus appeared to be confined to the coastal Adriatic region of Croatia, Montenegro, Greece, and, recently, France [9,10,11,12,13]. However, starting from 2017 there have been findings of this pest in other mainland areas and islands of Italy [4,14,15,16] and Europe (Belgium, Netherlands, and Czech Republic) with imported plant material [14,17].
The Orange Spiny Whitefly is currently included in the EPPO list (A2) as a quarantine pest threatening Europe [18]. Aleurocanthus spiniferus poses a significant risk to citrus production [16]. The primary concern stems from its polyphagy and ability to self-propagate, making it an important hazard to citrus crops. However, apart from the main hosts (Citrus spp.), as it expanded its distribution range the Orange Spiny Whitefly has been found on different hosts and can infest fruits, vegetables, and ornamental plants belonging to different botanical families [6,15,19,20].
Plants infested by A. spiniferus show general weakness, attributable to sap loss or even to indirect damage caused by the production of honeydew. The abundant production of honeydew causes the development of sooty molds, resulting in a severe reduction in photosynthesis and respiration activities [21]. Thus, trees extensively infested exhibit an almost entirely blackened aspect, which renders the fruits unsuitable for the market (EFSA 2018). Aleurocanthus spiniferus infestations have also been found to adversely affect the physicochemical properties of citrus fruits [22]. The use of chemical methods to control A. spiniferus has proven ineffective [21], and inadequately timed treatments appear to be counterproductive, exacerbating the severity of infestations [23]. This could occur due to the potential development of resistant populations, as has already occurred with the congener Aleurocanthus woglumi Ashby [24], and the adverse effects on non-target insects, including potential natural predators of A. spiniferus [19,25,26,27].
In the infested zone, several species of natural antagonists have been observed. Particularly, the predators Delphastus catalinae Horn and Serangium montazerii Fürsch (Coleoptera: Coccinellidae) have been identified [15,25], and there are also frequent findings of parasitoids that may have a specific affinity or show some adaptability to A. spiniferus [19,26,27,28,29].
The recent discoveries of A. spiniferus in various locations across Italy and Europe underscore the unstoppable spread of this species. Given the increasing number of new outbreaks and the challenges in accurately distinguishing between different species using traditional entomological techniques, like genus-level identification keys, not all Aleurocanthus species can be reliably identified at the species level [4]. This issue is exacerbated by the finding of additional closely related species, such as Aleurocanthus camelliae Kanmiya & Kasai, which infests ornamental plants [30,31]. The methodologies used and developed thus far to differentiate the species rely on slide mounting and microscopic examination [30]. However, these methodologies encounter three notable challenges: they require proficient observers, they may not encompass all congeneric or similar species comprehensively, and they are time-consuming.
Given the substantial influx of alien species into Europe through legal and illegal plant material trade and the potential for invasiveness [32,33,34], there is an immediate necessity to develop rapid, reliable, sensitive, and accurate diagnostic tools. Such advancements would allow the interception of regulated and unregulated species, not only at points of entry but also within agricultural areas. By enhancing the identification of infestations, targeted control programs can be implemented to attenuate the propagation of potentially harmful species within the agricultural domain, thereby fortifying biodiversity preservation efforts. Biomolecular methods are particularly promising, but so far, with the exclusion of a protocol for DNA barcoding based on COI [35], not many diagnostic methods have been developed, and often the sequence data available are problematic. Many of the deposited sequences correspond to other genetic portions, are contaminated with no-target DNA (such parasitoids), and reveal multiple haplotypes, potentially indicating a species complex [36].
In this scenario, this study introduces a real-time PCR probe test using species-specific primers and probes for A. spiniferus. The development of this new test and the evaluation of its main performance characteristics could ensure the adequacy and eligibility of the test as a standardized method for routine diagnostics within the EPPO region, based on the criteria established in PM 7/98 [37].

2. Materials and Methods

2.1. Insect Sampling and Identification

Starting from 2020, several developmental stages of A. spiniferus were taken from different parts of Italy to test the effectiveness of the developed method on different A. spiniferus invasive populations (Table 1). The first identification of Aleurocanthus sp. was carried out based on morphological characters [30,36].
For the evaluation of the analytical specificity of the test (exclusivity), non-target species were used, including specimens (adults and pre-imaginal stages) of different species, collected in the field or obtained from the molecular insect collection available at the Phytopathological Laboratory of the Pistoia Phytosanitary Service (Tuscany, Italy), the University of Catania (CT) (Italy), and the Institute for Sustainable Plant Protection (IPSP—CNR) of Portici (NA) (Italy). When collected in the field, specimens were placed in 1.5 mL Eppendorf or 50 mL Falcon tubes, killed in 70% ethanol and carried to the laboratory in double-sealed plastic bags, and then frozen (−20 °C) and stored until use. The samples analyzed in this study, along with non-target samples, are reported in Table 1, and include adults, immature stages (nymphs and puparia), and leaf discs. Leaf discs were collected using a steel cylinder with an internal diameter of 1 cm, and the cylinder was flame-sterilized after each cut. To ensure a representative sample, each disc contained at least five distinguishable juvenile stages of A. spiniferus. The choice to include samples of leaves with colonies arises from the natural behavior of the Orange Spiny Whitefly, which usually creates copious overlapping colonies, because its colonies are usually covered by sooty mold, which could be a limiting factor in molecular analyses, especially if sooty mold layers cover any presence of other phytophagous insects.

2.2. DNA Extraction

DNA extractions on target and non-target samples were performed according to the extraction protocol as in [38] with some slight modifications including a preliminary digestion with Proteinase K and RNase A. Briefly, each stage of the insect or each leaf disc was grounded individually and homogenized in 2.0 mL microtubes with 3 mm tungsten beads and 600 µL of 2% CTAB extraction buffer [38] with a Mixer Mill MM 200 (Retsch, Torre Boldone, Italy) at low speed (20 oscillations) for 10 s. Each lysate was supplemented with 40 µL Proteinase K (20 mg/mL) (Promega, Madison, WI, USA) and 20 µL RNase A (4 mg/mL) (Promega, Madison, WI, USA) and incubated at 60 °C for 30 min. One volume of chloroform was added, thoroughly mixed, and then centrifuged at 20,000× g at 4 °C for 10 min. A total of 400 µL of the upper phase was discarded, and an equal volume of isopropanol was added for further centrifugation at 20,000× g at 4 °C for 10 min. The resulting pellet was washed with 500 µL of 70% ethanol before re-suspension in 100 µL of sterile, nuclease-free water. The quantification (ng/µL) and evaluation of the degree of contamination (A260/280 ratios) of the extracted DNAs were performed using the QIAxpert spectrophotometer (Qiagen, Hilden, Germany) as in [38]. For each stage of development (leaf discs included) the quantification and degree of contamination were averaged from each quantization made. Furthermore, to quantitatively assess the extracted DNA and its suitability for real-time PCR assays, the DNA samples were amplified by performing a probe-targeted real-time PCR as in [39] on the highly conserved 18S ribosomal DNA region using a CFX96 thermal cycler (Bio-Rad, Hercules, CA, USA) as in [40]. Additionally, 1 µL of the extracted DNA was amplified following the protocol described in [15,35] and subsequently sequenced to confirm the preliminary morphological identification. The obtained sequences were compared with the genetic databases GenBank, BOLD, and the EPPO Q-Bank (www.ncbi.nlm.nih.gov/genbank/; www.boldsystems.org; https://qbank.eppo.int/-last) (accessed on 2 February 2025).

2.3. Design of A. spiniferus Primers and Probes

The software OligoArchitectTM Primers and Probe Design Online (Sigma-Aldrich, St. Louis, MO, USA) was used to design the primer pairs and probe based on the conserved Cytochrome C Oxidase Subunit I region (Accession number MN662925) of the mitochondrial genome of A. spiniferus (Table 2). Primer and probe design considered primer melting temperatures, amplicon length, and the absence of secondary structures as in [40] and were synthesized by Eurofins Genomics (Ebersberg, Germany). To assess the specificity of the designed primers, an in silico run was performed with the BLAST® software (Basic Local Alignment Search Tool; 2.14 version, http://www.ncbi.nlm.nih.gov/blast) (accessed on 18 October 2024). To enhance specificity assessment in silico, the nucleotide sequences linked to the designed qPCR probe were aligned utilizing the MAFFT software Version 7 [41] integrated within the Geneious 10.2.6 software (Biomatters, Auckland, New Zealand) [42]. The results of the in-silico analyses revealed that the analyzed assays displayed no significant matches or extended sequences with non-target organisms in the database (Figure S1). The inclusivity involved comparing sequences associated with A. spiniferus from diverse host and geographical origins worldwide with the reference sequence (Figure S1), while exclusivity entailed testing as many non-target species as possible to underscore the specificity of the assay (Figure S2). Non-target species included congeneric species (Aleurocanthus arecae David & Manjunatha, Aleurocanthus bangalorensis Dubey & Sundararaj, A. camelliae, A. citriperdus, Aleurocanthus inceratus Silvestri, and A. woglumi) and other whitefly species.

2.4. Real-Time PCR Optimization

The primer annealing temperatures ideal for qPCR amplification were established through the assessment carried out in [38]. Starting from the suggestion provided by probe and primer design software, a temperature gradient ranging from 50 °C to 55 °C was tested (based on the tests carried out), and the primer and probe concentrations varied from 0.2 to 0.5 µM. Primer and probe concentrations were tested as in [43] and the QuantiNova Probe PCR Master Mix Kit (Qiagen, Hilden, Germany) (at 1 × concentration) was used in a 20 µL final reaction mix and real-time PCR amplification reactions were performed in a CFX96 thermal cycler (Bio-Rad, Hercules, CA, USA). In addition, for each reaction two samples containing 2 μL of nuclease-free water were tested as a No Template Control (NTC). Raw data were analyzed with CFX Maestro 2.3 software (Bio-Rad, Hercules, CA, USA) and samples were considered positive when the real-time PCR curves showed a clear inflection point (in addition to increasing kinetics) and Cq values < 35.

2.5. Performance Characteristics

With the ultimate aim of establishing the test as a standardized method, the following pertinent characteristics were determined:
-
Analytical specificity: comparing both the tested targets (inclusivity) and non-targets (exclusivity) in the same amplification reactions with a real-time PCR, tested using normalized genomic DNA from target and non-target organisms at a final concentration of 10 ng/µL.
-
Analytical sensitivity (limit of detection—LoD) was assessed using a 10-fold 1:5 serial dilution in triplicate of genomic DNA extracts from single adults. The evaluation range was between 5 ng/µL and 5.12 fg/µL. All dilution measurements were performed with QIAxpert (Qiagen Hilden, Germany). Mean Cq values and their standard deviations (SDs) were calculated for the target species.
-
For the repeatability test, the diagnostic protocols were tested on 8 adult samples of A. spiniferus in triplicate. The reproducibility test was carried out on the same samples by two different operators on different days as in [31,38]. DNA extracts were normalized to a concentration of 0.04 ng/µL (corresponding to the third serial dilution used in the analytical sensitivity test).

3. Results

3.1. DNA Extraction

The average DNA concentrations (ng/µL) resulting from the DNA extraction performed on different developmental stages and pools of A. spiniferus are reported in Table 3. The purity of the samples, expressed as absorbance ratios (A260/280), resulted on average in values higher than 1.8. The qPCR amplification, to test the amplifiability of the 18S ribosomal gene, shows average Cq values from 18.0 to 21.45, calculated across the samples belonging to each category (i.e., adults, juvenile stages, and leaf discs). The obtained sequences confirmed the morphological identification by showing a similarity of over 99% with other sequences of A. spiniferus deposited in the considered genetic databases.

3.2. TaqMan Probe Protocol Real-Time PCR Optimization

The optimization process yielded the following results: the ideal reaction mixture parameters for the TaqMan probe were achieved using 10 µL of the QuantiNova Probe PCR Master Mix (Qiagen, Hilden, Germany) with primer and probe concentrations of 0.4 µM and 0.2 µM, respectively. The experimental results confirmed that the optimal annealing temperature for consistent amplification was 53 °C. Consequently, the optimal thermal protocol established includes an initial denaturation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s and an annealing/extension step at 53 °C for 40 s.

3.3. Performance Characteristics

The performance evaluation of the developed test demonstrated its reliability and accuracy through various parameters. The results from the analytical specificity assay confirmed that the test was inclusive for A. spiniferus samples while remaining fully exclusive to non-target organisms (Table 1).
The LoD experimental determination of the limit of detection (LoD) established the sensitivity at 0.064 pg/µL with a corresponding mean Cq value of 37.4 ± 1.592 S.D. (Table 4). Beyond this threshold, the final two dilutions (0.0128 pg/µL and 5.12 fg/µL) consistently failed to produce amplification, underscoring the assay’s detection limits. The test exhibited strong linearity, with an R2 value of 0.997, and a 100% response rate across technical replicates (Figure 1).
Furthermore, repeatability and reproducibility tests demonstrated consistent results, with standard deviations not exceeding 0.5 (Table 5). The corresponding mean Cq values (±SD) for repeatability and reproducibility were 27.41 ± 0.294 and 27.36 ± 0.245, respectively.

4. Discussion

After the first record in 2008 in southeastern Italy [5], A. spiniferus has gradually spread throughout Europe [6,8,9,11,12,13,15], infesting several new host plants in addition to the already known ones [15,19]. This invasive species has considerable potential to severely reduce the production and development of some common species in Mediterranean orchards and gardens [44]. Like other alien pests, it is extremely important to promptly survey previously pest-free areas for new outbreaks or new findings. Therefore, morphological identification seems the most straightforward methodology to employ at the beginning. However, interpretative uncertainties frequently may arise regarding various developmental stages or at the genus level, especially during surveys carried out by personnel with highly specialized entomological skills. The biomolecular and genetic tool therefore assumes, like other pests [31,38,40], considerable importance in ascertaining and unambiguously defining whether or not the pests found belong to the invasive species A. spiniferus. The speed of execution and prompt analytical response may add to the initial morphological diagnosis, sometimes provisional, a definitive identification to thus record a new finding or delineate the boundaries of infested areas or new host plants. The here-developed and -validated qPCR probe protocol can, therefore, provide valuable support for the territorial monitoring and control activities of incoming plant material at entry points. The proposed protocol to extract DNA from these matrices (eggs, nymphs, puparia, and adults) shows good DNA quality extracts even considering “difficult” matrices, like single small insects such as whiteflies. One significant aspect involves the extraction of various stages of whiteflies from affected leaves or plant material to promptly identify the type of whitefly present. This approach enables immediate diagnosis of the occurrence of pests by considering all material found on the infested plant parts. In particular, it is considerably interesting that the method shows the ability to identify pooled samples, even with leaf discs. This would allow for the use of infested plant parts, with numerous overlapping populations of the target insect and, in the most significant cases, even with heterogeneous infestations (composed of multiple biological entities together), to still obtain a reliable result. The protocol described here gave results in line with those expected based on similar previous work on other quarantine or priority pests [31,38,40]. In particular, the here-developed assay showed optimal analytical specificity, resulting in a test that was completely inclusive for A. spiniferus while remaining exclusive to non-target organisms. It has been demonstrated, both in silico and in vivo, to accurately identify all the tested Orange Spiny Whitefly specimens from different localities and different host plants. Notably, the assay’s sensitivity with a limit of detection (LoD) of 0.32 pg/µL ensures its utility for detecting low-density populations in the field, which is critical for early interception of outbreaks. Furthermore, the assay’s high reproducibility (standard deviation < 0.5) makes it particularly reliable for use across laboratories and operators, reducing potential diagnostic inconsistencies. The presence of genetic variability within A. spiniferus has been previously reported, with some studies suggesting the existence of cryptic lineages or even a species complex [36]. This variability has been observed in sequences available in public databases, where certain accessions exhibit high genetic distances from the majority of deposited A. spiniferus sequences. While this could indicate taxonomic uncertainties or potential misidentifications, it also highlights the importance of continuous molecular surveillance. Our assay was designed to target the most conserved and representative regions of A. spiniferus, ensuring high specificity for the currently recognized species. In silico and experimental validations confirmed that the probe and primers effectively amplify all major haplotypes associated with A. spiniferus, reinforcing the robustness of the assay. However, as taxonomic revisions progress and additional genetic data become available, further refinements may be necessary to accommodate potential cryptic diversity within A. spiniferus. Despite these considerations, our diagnostic tool remains highly reliable for species-level identification and can support phytosanitary measures and surveillance programs with high accuracy. Additionally, although some of these samples exhibited various mitochondrial haplotypes [15], the developed technique yielded positive results, overcoming this potential issue. The results demonstrated 100% compliance in terms of repeatability and reproducibility with the expected outcomes. Furthermore, the results demonstrated a standard deviation not exceeding 0.5, indicating minimal intra-and inter-specific variability [45]. The qPCR probe protocol developed therefore increases the diagnostic capacity of laboratories responsible for the territorial control of invasive pests by guaranteeing a timeliness of execution and simultaneously a reliability of results. Hence, this biomolecular tool can co-exist with morphological investigations related to verifying the presence of A. spiniferus in free areas, delimited areas, or phytosanitary import controls. The protocol also adheres to EPPO PM 7/98 requirements [37], further validating its potential as a standardized method for diagnostic laboratories.

5. Conclusions

The new diagnostic protocol based on a real-time PCR with a TaqMan probe is a powerful tool for the early and accurate identification of Aleurocanthus spiniferus. It overcomes challenges in invasive species diagnostics, offering greater precision and reliability than traditional morphological methods. With its high specificity, sensitivity, and reproducibility, the protocol supports timely monitoring and targeted interventions at entry points and agricultural areas.
The protocol aligns with EPPO PM 7/98 standards [37], making it suitable as a standardized method for routine diagnostics. This ensures consistent results across laboratories and strengthens its role in managing invasive pests.
In addition to its diagnostic benefits, the protocol can integrate into pest management systems, boosting the resilience of European agriculture against invasive species. Future research could expand its use to other invasive species or adapt it for regions with limited resources.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agriculture15040414/s1. Figure S1: Inclusiveness of the qPCR probe assay. Sequences of Aleurocanthus spiniferus belonging to different populations and from different locations were retrieved from GenBank through alignments based on the in silico theoretical qPCR probe amplicon. Figure S2: Alignments resulting from the in silico theoretical probe amplicon and sequences of the related organisms present in GenBank. In the network congeneric species and other whitefly species were compared.

Author Contributions

Conceptualization, D.R., G.E.M.C. and F.N.; methodology, D.R., F.P., C.C., M.C., C.G.Z., M.M., A.M., C.R., B.P., L.B. and F.N.; software, D.R., F.P. and F.N.; validation, D.R., F.P. and F.N.; formal analysis, D.R., F.P., C.C., M.C., C.G.Z., M.M., A.M., C.R., B.P. and L.B.; investigation, D.R., G.E.M.C., F.P., C.C., M.C., C.G.Z., M.M., A.M., C.R., B.P., L.B. and F.N.; resources, D.R. and F.N.; data curation, D.R., F.P. and F.N.; writing—original draft preparation, D.R., F.P., C.C., G.E.M.C. and F.N.; writing—review and editing, D.R., G.E.M.C., F.P., C.C., M.C., C.G.Z., M.M., A.M., C.R., B.P., L.B. and F.N.; visualization, D.R., F.P. and F.N.; supervision, D.R. and F.N.; project administration, D.R. and F.N.; funding acquisition, F.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially supported by the Campania Region-funded URCoFi project (Unità Regionale di Coordinamento Fitosanitario—Strengthening of the supervision activities and control of pests).

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author Francesco Nugnes of the Institute for Sustainable Plant Protection (IPSP), National Research Council (CNR), and first author Domenico Rizzo of the Laboratory of Phytopathological Diagnostics and Molecular Biology, Plant Protection Service of Tuscany.

Acknowledgments

The authors would like to acknowledge the personnel of the Plant Protection Services of Tuscany for their support during the field work, in particular Paolo Farina. The authors are thankful to Giovanna Pavarin for providing samples and to Immacolata Nunziata and Salvatore Cristadoro of the IPSP-CNR for their precious technical help.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of this study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Ouvrard, D.; Martin, J.H. The Whiteflies—Taxonomic Checklist of the World’s Whiteflies (INSECTA: Hemiptera: Aleyrodidae). 2021. Available online: http://www.hemiptera-databases.org/whiteflies/ (accessed on 25 January 2024). [CrossRef]
  2. Nguyen, R.; Sailer, R.I.; Hamon, A.B. Catalog of Aleyrodidae on Citrus and Their Natural Enemies (Homoptera—Aleyrodidae); Occasional papers of the Florida State Collection of Arthropods. In Bureau of Entomology; Contribution No. 730; Florida Department of Agriculture & Consumer Services, Division of Plant Industry: Orlando, FL, USA, 1993; Volume 8. [Google Scholar]
  3. Dubey, A.K.; Ko, C.C. Sexual Dimorphism among Species of Aleurocanthus Quaintance & Baker (Hemiptera: Aleyrodidae) in Taiwan, with One New Species and an Identification Key. Zootaxa 2012, 23, 1–23. [Google Scholar] [CrossRef]
  4. EFSA—European Food Safety Authority. Pest categorization of Aleurocanthus spp. Scientific opinion: EFSA J. 2018, 16, 5436. [CrossRef]
  5. Porcelli, F. First Record of Aleurocanthus spiniferus (Homoptera: Aleyrodidae) in Apulia, Southern Italy. EPPO Bull. 2008, 38, 516–518. [Google Scholar] [CrossRef]
  6. Cioffi, M.; Cornara, D.; Corrado, I.; Jansen, M.G.M.; Porcelli, F. The status of Aleurocanthus spiniferus from its unwanted introduction in Italy to date. Bull. Insectology 2013, 66, 273–281. [Google Scholar]
  7. El Kenawy, A.; Cornara, D.; Corrado, I.; El-Heneidy, A.; Rapisarda, C.; Porcelli, F. Aleurocanthus spiniferus (Quaintance) (Hemiptera Aleyrodidae) is spreading throughout the Italian region Apulia. In Proceedings of the Fifth International Scientific Agricultural Symposium “Agrosym 2014”, Jahorina, Bosnia and Herzegovina, 23–26 October 2014; pp. 478–482. [Google Scholar]
  8. Nutricato, S.; D’onghia, A.M.; Fedele, A.; Filì, V.; Garonna, A.P.; Guario, A.; Guastamacchia, F.; Mazzeo, M.; Parisi, V.; Percoco, A.; et al. New quarantine whitefly recorded in Apulia. Inf. Agrar. 2009, 65, 57–59. (In Italian) [Google Scholar]
  9. Kapantaidaki, D.E.; Antonatos, S.; Kontodimas, D.; Milonas, P.; Papachristos, D.P. Presence of the Invasive Whitefly Aleurocanthus spiniferus (Hemiptera: Aleyrodidae) in Greece. EPPO Bull. 2019, 49, 127–131. [Google Scholar] [CrossRef]
  10. Markotić, V.; Bažok, R.; Masten Milek, T.; Šimala, M.; Pintar, M. Checklist of Phytophagous Insects on Citrus from the Sternorrhyncha (Hemiptera) Suborder in Mediterranean Basin and the Risk for Introduction and Harmfulness in Croatia. J. Central Eur. Agric. 2020, 21, 618–632. [Google Scholar] [CrossRef]
  11. Radonjić, S.; Hrnčić, S.; Malumphy, C. First record of Aleurocanthus spiniferus (Quaintance) (Homoptera: Aleyrodidae) in Montenegro. Redia 2014, 97, 141–145. [Google Scholar]
  12. Šimala, M.; Masten, M.T. First record of the orange spiny whitefly, Aleurocanthus spiniferus Quaintance, 1903 (Hemiptera: Aleyrodidae), in Croatia. In Proceedings of the Conference ‘Zbornik Predavanj in Referatov, 11, Slovenskega Posvetovanja o Varstvu Rastlin Z Mednarodno Udelezbo, Bled, Slovenia, 5–6 March 2013; Available online: https://www.cabidigitallibrary.org/doi/pdf/10.5555/20143268032 (accessed on 23 October 2024).
  13. Streito, J.-C.; Mendes, E.; Sanquer, E.; Strugarek, M.; Ouvrard, D.; Robin-Havret, V.; Poncet, L.; Lannou, C.; Rossi, J.-P. Incursion preparedness, citizen science and early detection of invasive insects: The case of Aleurocanthus spiniferus (Hemiptera, Aleyrodidae) in France. Insects 2023, 14, 916. [Google Scholar] [CrossRef]
  14. EPPO. EPPO Reporting Service no. 05. 2022. Available online: https://gd.eppo.int/reporting/Rse-2022-05 (accessed on 13 September 2024).
  15. Nugnes, F.; Laudonia, S.; Jesu, G.; Jansen, M.G.M.; Bernardo, U.; Porcelli, F. Aleurocanthus spiniferus (Hemiptera: Aleyrodidae) in Some European Countries: Diffusion, Hosts, Molecular Characterization, and Natural Enemies. Insects 2020, 11, 42. [Google Scholar] [CrossRef]
  16. Rapisarda, C.; Longo, S. First report from Sicily (Italy) of the orange spiny whitefly, Aleurocanthus spiniferus (Quaintance) (Hemiptera: Aleyrodidae), and its potential risk for the Italian citrus industry. EPPO Bull. 2021, 51, 329–332. [Google Scholar] [CrossRef]
  17. EPPO. EPPO Global Database. 2024. Available online: https://gd.eppo.int/taxon/ALECSN (accessed on 13 September 2024).
  18. EPPO. EPPO A2 List of Pests Recommended for Regulation as Quarantine Pests—Version 09. 2023. Available online: https://www.eppo.int/ACTIVITIES/plant_quarantine/A2_list (accessed on 13 September 2024).
  19. Bubici, G.; Prigigallo, M.I.; Garganese, F.; Nugnes, F.; Jansen, M.; Porcelli, F. First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs. Insects 2020, 11, 161. [Google Scholar] [CrossRef] [PubMed]
  20. CABI—PlantwisePlus Knowledge Bank. Aleurocanthus spiniferus (Orange Spiny Whitefly). 2022. Available online: https://www.cabidigitallibrary.org/doi/abs/10.1079/cabicompendium.4136 (accessed on 24 September 2024).
  21. Gyeltshen, J.; Hodges, A.; Hodges, G.S. Orange Spiny Whitefly, Aleurocanthus spiniferus (Quaintance) (Insecta: Hemiptera: Aleyrodidae). Available online: https://edis.ifas.ufl.edu/pdffiles/IN/IN61800.pdf (accessed on 28 October 2024).
  22. Paladin Soče, I.; Mračič Raič, I.; Juran, I.; Šimala, M.; Gotlin Culjak, T.; Skendrović Babojelić, M. Influence of the quarantine pest Aleurocanthus spiniferus (Quaintance, 1903) (Hemiptera: Aleyrodidae) on pomological and physicochemical properties of Citrus unshiu. Appl. Ecol. Environ. Res. 2022, 20, 5183–5196. [Google Scholar] [CrossRef]
  23. Zhang, Q.B. The reasons for rampage of citrus spiny white fly and its control. South China Fruits 2006, 2, 20–21. [Google Scholar]
  24. Lavra Vieira, D.; De Oliveira Barbosa, V.; Oliveira De Souza, W.C.; Goncąlves Da Silva, J.; Malaquias, J.B.; De Luna Batista, J. Potassium Silicate-Induced Resistance against Blackfly in Seedlings of Citrus Reticulata. Fruits 2016, 71, 49–55. [Google Scholar] [CrossRef]
  25. Massimino Cocuzza, G.E.; Jovičić, I.; Frisenna, F.; Tumminelli, R.; Siscaro, G. Discovery of Serangium montazerii Fürsch (Coleoptera, Coccinellidae) as a 1 Predator of Aleurocanthus spiniferus (Quaintance) (Hemiptera, Aleyrodidae) in Italy. EPPO Bull. 2023, 53, 376–386. [Google Scholar] [CrossRef]
  26. Nugnes, F.; Laudonia, S.; Garonna, A.P.; Bernardo, U.; El-Kenawy, A.; D’accolti, A.; Picciotti, U.; Porcelli, F. The Aleurocanthus spiniferus (OSW) in Europe: A becoming invasive threat to citrus also. In Proceedings of the 53rd Croatian & 13th International Symposium on Agriculture, Vodice, Croazia, 18–23 February 2018; pp. 18–38. [Google Scholar]
  27. Nugnes, F.; Bubici, G.; Garganese, F.; Laudonia, S.; Garonna, A.P.; Bernardo, U.; Jesu, G.; Porcelli, F. Aleurocanthus spiniferus, an alien invasive threat to Europe, associated bacterial community and natural enemies. In Proceedings of the XI European Congress of Entomology, Napoli, Italy, 2–6 July 2018; p. 38, ISBN 978-88-9092-621-1. [Google Scholar]
  28. Laudonia, S.; Melone, G.; Ascolese, R.; Nugnes, F. Eretmocerus iulii Laudonia et Melone sp. n.: Parasitoid associated with Aleurocanthus spiniferus. Bull. Insectology 2024. in print. [Google Scholar]
  29. Melone, G.; Ascolese, R.; Nugnes, F.; Porcelli, F.; Rapisarda, C.; Farina, A.; Picciotti, U.; Garganese, F.; Laudonia, S. An Eretmocerus Species, Parasitoid of Aleurocanthus spiniferus, Was Found in Europe: The Secret Savior of Threatened Plants. Sustainability 2024, 16, 2970. [Google Scholar] [CrossRef]
  30. Jansen, M.; Porcelli, F. Aleurocanthus camelliae (Hemiptera: Aleyrodidae), a Species Possibly New for the European Fauna of a Genus in Great Need of Revision. Tijdschr. voor Entomol. 2018, 161, 63–78. [Google Scholar] [CrossRef]
  31. Rizzo, D.; Suma, P.; Rossi, E.; Farina, P.; Da Lio, D.; Bartolini, L.; Salemi, C.; Farina, A.; Rapisarda, C. First Record of Aleurocanthus camelliae Kanmiya & Kasai, 2011 (Hemiptera, Aleyrodidae) from Italy, on Ornamental Camellia spp. Plants. EPPO Bull. 2021, 51, 333–339. [Google Scholar] [CrossRef]
  32. Capinha, C.; Essl, F.; Porto, M.; Seebens, H.; Esslc, F.; Portod, M.; Seebensg, H. The Worldwide Networks of Spread of Recorded Alien Species. Proc. Natl. Acad. Sci. USA 2023, 120, e2201911120. [Google Scholar] [CrossRef] [PubMed]
  33. Pace, R.; Ascolese, R.; Miele, F.; Russo, E.; Griffo, R.V.; Bernardo, U.; Nugnes, F. The Bugs in the Bags: The Risk Associated with the Introduction of Small Quantities of Fruit and Plants by Airline Passengers. Insects 2022, 13, 617. [Google Scholar] [CrossRef] [PubMed]
  34. Seebens, H.; Bacher, S.; Blackburn, T.M.; Capinha, C.; Dawson, W.; Dullinger, S.; Genovesi, P.; Hulme, P.E.; van Kleunen, M.; Kühn, I.; et al. Projecting the Continental Accumulation of Alien Species through to 2050. Glob. Chang. Biol. 2020, 27, 970–982. [Google Scholar] [CrossRef] [PubMed]
  35. Warbroek, T.; Cottyn, B.; Gottsberger, R. EPPO PM 7/129 (1) DNA barcoding as an identification tool for a number of regulated pests. EPPO Bull. 2021, 51, 100–143. [Google Scholar] [CrossRef]
  36. EPPO PM 7/007 (2) Aleurocanthus citriperdus, Aleurocanthus spiniferus and Aleurocanthus woglumi. EPPO Bull. 2022, 52, 346–361. [CrossRef]
  37. EPPO PM 7/98 (5) Specific requirements for laboratories preparing accreditation for a plant pest diagnostic activity. EPPO Bull. 2021, 51, 468–498. [CrossRef]
  38. Rizzo, D.; Moricca, S.; Bracalini, M.; Benigno, A.; Bernardo, U.; Luchi, N.; Da Lio, D.; Nugnes, F.; Cappellini, G.; Salemi, C.; et al. Rapid detection of Pityophthorus juglandis (Blackman) (Coleoptera, Curculionidae) with the loop-mediated isothermal amplification (lamp) method. Plants 2021, 10, 1048. [Google Scholar] [CrossRef] [PubMed]
  39. Ioos, R.; Fourrier, C.; Iancu, G.; Gordon, T.R. Sensitive detection of Fusarium circinatum in pine seed by combining an enrichment procedure with a real-time polymerase chain reaction using dual-labeled probe chemistry. Phytopathology 2009, 99, 582–590. [Google Scholar] [CrossRef] [PubMed]
  40. Rizzo, D.; Zubieta, C.G.; Sacchetti, P.; Marrucci, A.; Miele, F.; Ascolese, R.; Nugnes, F.; Bernardo, U. Diagnostic Tool for the Identification of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) Using Real-Time PCR. Insects 2024, 15, 44. [Google Scholar] [CrossRef] [PubMed]
  41. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
  42. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
  43. Rizzo, D.; Taddei, A.; Da Lio, D.; Nugnes, F.; Barra, E.; Stefani, L.; Bartolini, L.; Griffo, R.V.; Spigno, P.; Cozzolino, L.; et al. Identification of the red-necked longhorn beetle Aromia bungii (Faldermann, 1835) (Coleoptera: Cerambycidae) with real-time PCR on frass. Sustainability 2020, 12, 6041. [Google Scholar] [CrossRef]
  44. Van den Berg, M.A.; Greenland, J. Classical biological control of the spiny black fly, Aleurocanthus spiniferus (Hem.: Aleyrodidae), on citrus in Southern Africa. Entomophaga 1997, 42, 459–465. [Google Scholar] [CrossRef]
  45. Teter, S.; Steffen, L. Real-Time qPCR: Guidelines for a Comparison of Reagent Performance. 2017. Available online: https://ita.promega.com/resources/pubhub/applications-notes/an299-real-time-qpcr-guidelines-for-a-comparison-of-reagent-performance/ (accessed on 1 September 2024).
Agriculture 15 00414 g001
Figure 1. Amplification curves (A) and standard curves (B) relating to the qPCR probe assay using serial dilutions (1:5) of A. spiniferus DNA from 1 ng/µL to 0.32 pg/µL.
Figure 1. Amplification curves (A) and standard curves (B) relating to the qPCR probe assay using serial dilutions (1:5) of A. spiniferus DNA from 1 ng/µL to 0.32 pg/µL.
Agriculture 15 00414 g001
Table 1. Insect samples (target and non-target specimens) used in this study along with Cq values and standard deviations (SDs). Abbreviations: IPSP = Institute for Sustainable Plant Protection; PPS-T = Plant Protection Service, Tuscany; UC = University of Catania; N 1-2-3 = 1st, 2nd, and 3rd nymphal stage; P = puparia; A = adult; LC = leaf tag with colony.
Table 1. Insect samples (target and non-target specimens) used in this study along with Cq values and standard deviations (SDs). Abbreviations: IPSP = Institute for Sustainable Plant Protection; PPS-T = Plant Protection Service, Tuscany; UC = University of Catania; N 1-2-3 = 1st, 2nd, and 3rd nymphal stage; P = puparia; A = adult; LC = leaf tag with colony.
SpeciesCodeCoordinatesHost PlantStageSupplierCq ± SD
Aleurocanthus spiniferusA.S. AA 14240°52′ N; 14°29′ EVitis viniferaAIPSP20.23 ± 0.12
A.S. AA 143IPSP20.34 ± 0.28
A.S. AA 14440°52′ N;14°30′ EPrunus sp.N1IPSP23.02 ± 0.11
A.S. AA 145IPSP22.31 ± 0.27
A.S. AA 14640°50′ N; 14°31′ ECitrus reticulataN1IPSP25.65 ± 0.33
A.S. AA 14940°52′ N; 14°29′ ECitrus × paradisiN2IPSP20.14 ± 0.37
A.S. AA 15440°40′ N; 14°45′ EVitis sp.AIPSP20.21 ± 0.21
A.S. AA 155N3IPSP23.67 ± 0.34
A.S. AA 156Citrus sp.IPSP22.65 ± 0.21
A.S. AA 158Edera helixIPSP21.23 ± 0.26
A.S. AA 159AIPSP25.98 ± 0.18
A.S. AA 16040°44′ N; 14°38′ ERosa sp.PIPSP24.23 ± 0.15
A.S. AA 161AIPSP21.56 ± 0.07
A.S. AA 162AIPSP22.54 ± 0.08
A.S. AA 16440°52′ N; 14°29′ EV. viniferaAIPSP23.65 ± 0.13
A.S. AA 16640°52′ N; 14°30′ EPrunus sp.PIPSP23.45 ± 0.09
A.S. AA 168Citrus × limonIPSP23.76 ± 0.11
A.S. AA 17040°40′ N; 14°45′ EVitis sp.N2IPSP22.87 ± 0.14
A.S. AA 171Citrus sp.IPSP22.43 ± 0.16
A.S. AA 50440°42′ N; 14°42′ ECitrus sp.N3IPSP21.56 ± 0.18
A.S. AA 50940°50′ N; 14°31′ ECitrus sp.N2IPSP25.76 ± 0.13
A.S. AA 51045°04′ N; 11°47′ ECitrus sp.PIPSP21.23 ± 0.15
A.S. AA 511LCIPSP25,56 ± 0.43
MR411043°50′ N; 11°09′ ERosa sp.LCPPS-T26.71 ± 0.38
MR411143°51′ N; 11°05′ ECitrus sp.LCPPS-T25.21 ± 0.37
MR411244°03′ N; 10°03′ ECitrus sp.LCPPS-T24.21 ± 0.52
MR411343°46′ N; 11°17′ EPrunus sp.LCPPS-T25.34 ± 0.47
MR411442°24′ N; 11°12′ ECitrus sp.LCPPS-T24.46 ± 0.46
MR411543°13′ N; 10°35′ EV. viniferaLCPPS-T25.76± 0.54
A.S. 1_a37°13′ N; 14°32′ ECitrus sp.AUC21.34 ± 0.24
A.S. 1_bCitrus sp.N3UC23.75 ± 0.21
A.S. 240°35′ N; 17°05′ ECitrus sp.N2UC23.91 ± 0.45
A.S. 340°35′ N; 16°58′ ECitrus sp.N2UC22.41 ± 0.23
A.S. 441°25′ N; 12°57′ ECitrus sp.N3UC23.87 ± 0.14
Aleurocanthus camelliaeLabDB_308043°56′ N; 10°53′ ECamellia sasanquaAPPS-TN/A
MR 001683APPS-TN/A
MR 00168443°54′ N; 10°58′ EAPPS-TN/A
Planococcus citriMR 00168543°33′ N; 10°19′ ECitrus sp.APPS-TN/A
MR 00168643°09′ N; 10°36′ EAPPS-TN/A
MR 00168742°26′ N; 11°13′ ECitrus sp.APPS-TN/A
Dialeurodes citriLabDB_308643°43′ N; 10°21′ ECitrus sp.APPS-TN/A
Planococcus ficusLabDB_312643°51′ N; 10°15′ EVitis sp.APPS-TN/A
Ricania speculumIn017In015C244°16′ N; 9°27′ ELaurus nobilisAPPS-TN/A
Saissetia oleaeIn062In049C243°46′ N; 11°13′ EOlea europaeaAPPS-TN/A
In066In052C2APPS-TN/A
Table 2. Primers and probe of the real-time PCR developed in the present work.
Table 2. Primers and probe of the real-time PCR developed in the present work.
Primer/Probe NameLength (Bases)Sequence 5′–3′Nucleotide PositionProduct Size (bp)Reference
Sequence
Aspin_10F19GCCGTTATTCTGATTATGG10–29112MN662925
Aspin_121R22GACTCCATCACTAAATAGTAAA121–99
Aspin_81P26FAM—AACTTAACAGCCTGCCTATAGATGAA—BHQ181–55
Table 3. Average concentrations of DNA extraction and respective standard deviations, absorbance ratios (A260/280), and mean Cq values of 18S for the A. spiniferus assayed samples.
Table 3. Average concentrations of DNA extraction and respective standard deviations, absorbance ratios (A260/280), and mean Cq values of 18S for the A. spiniferus assayed samples.
Developmental StageDNA Concentration (ng/µL) ± SDA260/280 RatioCq (18S)Cq qPCR Probe
(Aleu. spiniferus)
Adults36.1 ± 4.531.92 ± 0.2318.01 ± 1.5622.15 ± 1.54
Juvenile stages28.2 ± 3.251.86 ± 0.2120.15 ± 2.1223.45 ± 2.35
Leaf Discs45.2 ± 2.321.98 ± 0.1821.45 ± 2.3624.56 ± 3.21
Table 4. Serial dilutions with their detection limits from adult DNA extract of A. spiniferus (specimen A.S. 1_a in Table 1). Cq values were considered negative when >35.
Table 4. Serial dilutions with their detection limits from adult DNA extract of A. spiniferus (specimen A.S. 1_a in Table 1). Cq values were considered negative when >35.
Concentration Technical Replicates Cq Mean ± S.D.
ABC
5 ng/μL 20.9220.6320.7920.78 ± 0.145
1 ng/μL 23.0722.9123.0823.02 ± 0.095
200 pg/µL 25.2825.1225.4125.27 ± 0.090
40 pg/µL 26.7126.7727.1326.87 ± 0.227
8 pg/µL 28.8529.3229.5729.25 ± 0.366
1.6 pg/µL 31.2730.9831.8731.37 ± 0.454
0.32 pg/µL 33.5835.7833.334.22 ± 1.358
0.064 pg/µL 35.7138.8737.6337.4 ± 1.592
0.0128 pg/µL N.A.N.A.N.A.-
5.12 fg/µL N.A.N.A.N.A.-
Table 5. Repeatability and reproducibility values with indication of replicates and corresponding Cq mean values at a concentration of 40 pg/µL on extracted DNA.
Table 5. Repeatability and reproducibility values with indication of replicates and corresponding Cq mean values at a concentration of 40 pg/µL on extracted DNA.
Repeatability
Test 12345678
A 27.1627.7927.9427.9227.2627.627.727.9
B 27.6427.4627.4327.2727.3527.4127.5627.13
C 27.5427.0827.2127.0526.9827.0327.2127.3
Cq Mean ± S.D.27.45 ± 0.25327.44 ± 0.26927.53 ± 0.15627.41 ± 0.15627.20 ± 0.26227.35 ± 0.26927.49 ± 0.24727.44 ± 0.120
Reproducibility
Test 12345678
A 27.5127.1927.127.0927.2227.0427.3127.33
B 27.7727.1627.1827.2427.5527.6327.1427.18
C 27.5227.1327.1227.5427.8627.5727.7627.4
Cq Mean ± S.D.27.6 ± 0.14727.16 ± 0.03027.13 ± 0.04227.29 ± 0.22927.54 ± 0.32027.41 ± 0.32527.40 ± 0.32027.30 ± 0.112
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rizzo, D.; Zubieta, C.G.; Moriconi, M.; Carli, M.; Marrucci, A.; Ranaldi, C.; Palmigiano, B.; Bartolini, L.; Pica, F.; Carbone, C.; et al. Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology. Agriculture 2025, 15, 414. https://doi.org/10.3390/agriculture15040414

AMA Style

Rizzo D, Zubieta CG, Moriconi M, Carli M, Marrucci A, Ranaldi C, Palmigiano B, Bartolini L, Pica F, Carbone C, et al. Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology. Agriculture. 2025; 15(4):414. https://doi.org/10.3390/agriculture15040414

Chicago/Turabian Style

Rizzo, Domenico, Claudia Gabriela Zubieta, Michela Moriconi, Marco Carli, Andrea Marrucci, Chiara Ranaldi, Bruno Palmigiano, Linda Bartolini, Feliciana Pica, Carmela Carbone, and et al. 2025. "Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology" Agriculture 15, no. 4: 414. https://doi.org/10.3390/agriculture15040414

APA Style

Rizzo, D., Zubieta, C. G., Moriconi, M., Carli, M., Marrucci, A., Ranaldi, C., Palmigiano, B., Bartolini, L., Pica, F., Carbone, C., Massimino Cocuzza, G. E., & Nugnes, F. (2025). Streamlining the Identification of the Orange Spiny Whitefly, Aleurocanthus spiniferus (Hemiptera: Aleyrodidae), with Real-Time PCR Probe Technology. Agriculture, 15(4), 414. https://doi.org/10.3390/agriculture15040414

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop