Fermented Bamboo Powder Affects Dwarf Yellow-Feathered Broiler Growth, Blood Biochemistry, Antioxidant Status, Intestinal Morphology, and Nutrient Transporter Gene Expression

Abstract

This study explores the effects of fermented bamboo powder (FBP) on the growth performance, antioxidant status, intestinal morphology, and expression of nutrient transporter genes in broiler chickens. Two groups were formed from 600 healthy 1-day-old chicks; each group included 30 chicks, repeated 10 times. The control group was fed a basal diet and supplemented the experimental group’s diet with 1.0 g/kg FBP during phase I (days 1–22) and 2.0 g/kg FBP during phase II (days 23–45). The findings revealed a significant enhancement in the growth performance for the group that received fermented bamboo powder in contrast to the control group (p < 0.05). The levels of triglycerides exhibited a significant reduction (p < 0.05), alongside a significant decrease in urea and creatinine levels (p < 0.05). The levels of malondialdehyde (MDA), a marker of oxidative stress, exhibited a significant reduction in the FBP group compared to the control group (p < 0.01). It was found that the antioxidant enzymes superoxide dismutase (SOD) and catalase (CAT) worked much better in the FBP group than in the control group (p < 0.01). On the other hand, fermented bamboo powder greatly increased the surface area that could absorb nutrients in the intestines (duodenum, jejunum, and ileum) by increasing the villus height, intestinal lumen depth, and villus area (p < 0.01). Compared to the control, FBP increased the expression levels of genes involved in the transport of nutrients from the intestinal regions (duodenum, jejunum, and ileum), including GLUT1, GLUT2, CAT1, CAT2, PEPT1, PEPT2, and LAT1. The upregulation of nutrient transporter genes further facilitated nutrient absorption, contributing to the observed improvements in growth and body weight. These findings endorse FBP as a viable feed additive in broiler diets to enhance health and performance.

1. Introduction

Bamboo, a perennial plant with a woody texture that is globally prevalent, is a member of the Bambuseae subfamily and the Gramineae family. As the leading producer, China contributes significantly to the global bamboo supply, offering large quantities at low costs [1]. Bamboo accounts for nearly 3% of the world’s forest area [2]. Renowned for its rapid growth and high production potential, bamboo stands out as a crucial renewable resource with a broad geographical distribution [3]. Bamboo composition is enriched with various physiologically active compounds, predominantly flavonoids, polysaccharides, and phenolic acids, which have significant effects on chickens [4,5]. Additionally, bamboo contains a substantial amount of insoluble dietary fiber (IDF), which can positively influence the gut health, nutrient utilization, and behavior in broilers [6,7]. Flavonoids in bamboo are known to mitigate intestinal inflammation and modulate immune activities within the gut [8]. Researchers recognize the ability of phenolic components in bamboo to reduce fatty liver risks, while also providing antioxidant and antibacterial benefits [9,10,11]. Because of the fermentation process, some substances may be more concentrated and bioavailable in fermented bamboo powder than in unfermented bamboo powder. This could help lactic acid bacteria grow and make the substrate more fermentable [12]. Furthermore, the fermentation process of bamboo can result in a significant increase in crude fiber and crude protein content, reaching up to 10.76% crude fiber and 15.20% crude protein, depending on the bamboo species and the specific fermentation conditions used [13]. Additionally, the fermented bamboo powder contained the following amounts of dry matter (89.80%), crude protein (2.28%), ether extract (0.18%), acid detergent fiber (47.36%), calcium (0.12%), total phosphorus (0.02%), and gross energy (16.85 MJ/kg) when it was provided to the animals [14,15].

The small intestinal epithelium forms a complex network of transporters required for nutrition absorption. This includes glucose transporters GLUT1 and GLUT2, cationic amino acid transporters CAT1 and CAT2, the neutral/cationic amino acid exchangers y + L amino acid transporter-1 and y + L amino acid transporter-2, and the peptide transporters PepT1 and PepT2, which are all important parts of the mechanisms that move amino acids around in cells [16,17].

Recent studies indicate that FBP stimulates gut odorant receptors, enhancing the intestinal health and growth performance in broilers [18]. Despite existing studies on fermented bamboo powder FBP usage in chickens and pigs, information on the mechanisms by which FBP affects these animals remains scarce. This study aims to fill in that gap by looking at how different levels of FBP supplementation affect broiler chickens’ growth, antioxidant status, nutrient transporter gene expression, and the morphology of their intestines.

2. Materials and Methods

2.1. Diets, Animals, and Experimental Design

The experimental protocols received approval from the Animal Care and Use Committee at Nanjing Agricultural University, Nanjing, China, under Permit Number: SYXK (Su) 2022–0031. The basal diet was purchased from Jiangsu Yancheng Xiling Agricultural Science and Technology Co., Ltd., Nanjing, China. The recommendations set forth by the NRC in 1994 regarding nutrition requirements delineate the nutrient needs for yellow chickens, as illustrated in

Table 1. Ingredient composition and calculation of the ingredients in the basal diet.

Item	Phase I, Days 1–22 1.0 g/kg	Phase II, Days 23–45 2.0 g/kg
Corn	406.6	297.3
Wheat	200	400
Soybean meal	223.1	57.3
Sunflower	30	50
Rapeseed meal	30	40
Palm kernel meal	0	20
Corn gluten meal	40	50
Rice husk oil	23.1	42.2
Calcium bisphosphate	14	10.3
Limestone	11.8	11.2
Liquid methionine (88%)	1.4	2.3
Premix	20	20
Total	1000	1000
Calculation of nutrients
Metabolizable energy (Kcal/kg)	2956	3008
Crude protein (g kg−1)	211.4	208.7
Crude fat (g kg−1)	40.48	44.1
Methionine (g kg−1)	4.86	7.64
Lysine (g kg−1)	10.97	13.65
Calcium (g kg−1)	9.89	9.62
Available phosphorus (g kg−1)	4.85	5.1

Composition of the components and the determined chemical analysis of the basal diet. The premix supplied the following per kilogram of the diet: 50% choline, 5150 IU; complex enzyme, 15,000 IU; L-lysine, 5500 IU; rice bran meal, 2400 IU; tributyrin, 38,000 IU; tryptophan, 61,000 IU; threonine, 9500 IU; salt, 560 IU; probiotics, 26,000 IU; organic mineral, 5500 IU; phytase, 20,000 IU.

, and served as a foundational guide for the formulation of the basal diet. FBP was acquired from Zhejiang Muyi Xiangzhu Biotechnology Co., Ltd., Fuyan County, Hangzhou City, China.

Table 2. Analyzed composition of the fermented bamboo powder (FBP).

Item	FBP Composition (%)
Moisture	11.21
Crude protein	17.07
Coarse fiber	17.66
Total Carbohydrate	28.89
Crude fat	3.48
Coarse ash content	9.21
Acid soluble protein	7.13
Acid washing lignin	3.41
Calcium (%)	0.12
Total phosphorus (%)	0.02

provides the ingredients of the FBP. The Research Institute of Global 3E, Kyoto, Japan, performed an analysis of the bioactive components present in the FBP, both prior to and after the fermentation, using HPLC-MS/MS technology, as shown in

Table 3. Analysis of the bioactive components in the fermented bamboo powder (FBP) pre- and post-fermentation.

Compound	Before Fermentation (mg/100 g)	After Fermentation (mg/100 g)
Ferulic Acid	5.2	7.6
p-Coumaric Acid	3.8	5.3
Caffeic Acid	2.9	4.2
Protocatechuic Acid	4.1	6.0
p-Hydroxybenzoic Acid	3.5	5.1
Catechin	6.0	8.6
Syringic Acid	2.7	4.0
Chlorogenic Acid	3.2	4.5
β-Sitosterol	0.8	1.1
Campesterol	0.6	0.9
Stigmasterol	0.5	0.8
Cholesterol	0.4	0.6
Ergosterol	0.3	0.5
Stigmastanol	0.2	0.4
Phytosterols	2.4	3.6
Tannins	1.5	2.2
Saponins	1.2	1.6
Flavonoids	4.0	5.4

.

A group of 600 dwarf yellow-feathered broiler (DYB) chicks, all 1 day old, with an average body weight of 52.16 ± 0.26 g, was used for this experiment, receiving standard vaccination protocols and unrestricted access to food and water for a duration of 45 days. The trial had the following two distinct stages: Phase I (days 1–22) and Phase II (days 23–45). We categorized the chicks into the following two major groups: the control group (CON) and the group receiving FBP supplementation. Each group had 10 replications, with each replicate comprising 30 chickens grown on ground bedding. The control group received the basal diet for the whole of the experiment. The FBP group received distinct FBP equivalents (1.0–2.0 g/kg) in each phase based on their nutritional needs.

2.2. Sampling and Data Collection

We recorded body weight (BW) readings on the following three separate days throughout the experiment: day 1, day 22, and day 45. Additionally, we recorded and subsequently calculated the feed consumption and average daily gain (ADG) per pen. The average daily feed intake (ADFI) per bird was calculated by dividing the total feed consumption for the enclosure for the trial period by the number of days in the period of study. The feed conversion ratio (FCR) was determined by analyzing the data on the feed intake and body weight for each pen. Blood samples were obtained and centrifuged at 3000 rpm for 10 min. We preserved the serum samples at a temperature of −20 °C. The slaughter performance was evaluated by calculating the eviscerated yield, the weights of the breast and thighs, and the other internal organ weights such as the heart, spleen, kidneys, and liver. We conducted hematoxylin and eosin (HE) staining and RNA extraction on the tissues sourced from the intestinal parts, including the duodenum, jejunum, and ileum.

2.3. HE Staining of Tissue Sections

The small intestine tissues (duodenum, jejunum, and ileum) were preserved in 75% ethanol at room temperature for further HE analysis. Intestinal tissues were sectioned into 3–4 mm slices and preserved in 10% neutral buffered formalin. The tissues were then dehydrated with an ascending graded series of ethanol, washed with xylene, and embedded in paraffin. The paraffin blocks were sectioned to a 5–7 μm thickness using a microtome, and then stained with HE staining (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) for the morphological examination. The sections were analyzed using a Nikon Eclipse E200 microscope (Nikon Instruments, Shanghai Co., Ltd., Shanghai, China). Using ImageJ software version 1.54d (USA), we conducted five measurements for the crypt depth (CD), villus height (VH), and villus area for the intestinal samples from distinct villi and crypts per slice from each broiler with following specified formula [19]:

villus area = 2π × (average villus width/2) × villus height.

2.4. Serum Biochemical Measurements and Antioxidant Enzymes

We assessed the total protein, glucose, cholesterol, triglycerides, high-density lipoprotein cholesterol (HDL), and low-density lipoprotein cholesterol (LDL) in the serum samples. This study used blood samples to assess the activity of antioxidant enzymes. The total superoxide dismutase (SOD) activity and the concentrations of malondialdehyde (MDA), glutathione peroxidase (GSH-PX), heme oxygenase HO-1, and catalase (CAT) were assessed using commercial kits provided by Nanjing Angle Gene Co., Ltd. in Nanjing, China.

2.5. RNA Extraction and Quantitative PCR

2.5.1. RNA Isolation and cDNA Synthesis

Samples of the small intestine (duodenum, jejunum, and ileum) were collected and kept in liquid nitrogen at −80 °C for analysis. The total RNA was extracted with the Total Animal Tissue/Cells RNA Extraction kit (TSP413, Qingke, Beijing, China) according to the manufacturer’s guidelines. We used agarose gel electrophoresis to assess the integrity and quality of the RNA. The RNA concentration was quantified with an Epoch microplate spectrophotometer, manufactured by Agilent Technologies, Inc., Beijing, China. The SynScript^® RT SuperMix for qPCR reverse transcription kit was used to reverse-transcribe the RNA sample to cDNA, and then it was stored at −20 °C for the analysis.

2.5.2. Q-PCR (Quantitative Real-Time Polymerase Chain Reaction)

Sequences of primers were used to amplify the genes, which are enumerated in

Table 4. Primer sequences were used for the RT-qPCR experiment.

Gene	Reverse Primer (5′-3′)	Amplicon Size (bp)	Accession No.
β-actin	F/GCCCTCTTCCAGCCATCTTT R/CAATGGAGGGTCCGGATTCA	107 bp	NM_205518.2
GLUT1	F/ATGGGCTTCCAGTACATTGC R/TTTGTCTCCGGCACCTTGA	110 bp	NM_205209.2
GLUT2	F/GTTCCTGGCTGGTCTGATGG R/TGGCGACCATGCTGACATAA	107 bp	NM_207178.2
CAT1	F/GCAAAGCGACTTTCCGGACT R/GCCTGTAAGAAACTCTGAGAAACC	132 bp	NM_001398060.1
CAT2	F/TTGCTACATTGGTGGTGTCCT R/TGAAACCAAGTGCCATCCAG	198 bp	XM_040699004.2
LAT1	F/TGCGTTACAAGAAGCCGGAG R/CGATCCCGCATTCCTTTGGT	129 bp	XM_046911929.1
PepT1	F/CCTTATCGTGGCTGGAGCAT R/TGGGCTTCAACCTCATTTGGA	144 bp	NM_204365.2
PepT2	F/TAGGTCATCCAACCTGCTCCT R/TGCCTGGAGGAGAAAGAACAC	109 bp	NM_001319028.3

β-actin, beta-actin; GLUT1, glucose transporter-1; GLUT2, glucose transporter-2; CAT1, cationic amino acid transporter-1; CAT2, cationic amino acid transporter-2; LAT1, L-type amino acid transporter-1; PepT1, peptide transporter-1; PepT2, peptide transporter-2. F, primer forward; R, primer reverse.

. The primer sequences underwent validation through the use of NCBI Primer-BLAST. The reverse-transcribed cDNA product underwent a threefold dilution and served as a template for the qPCR. We achieved amplification by using the ArtiCanCEO SYBR qPCR MixTSE401 (Qingke), adhering to the instructions of the manufacturers, and by utilizing ABI QuantStudio real-time PCR equipment from Thermo Fisher Scientific, Inc. The amplification procedure started with an initial denaturation phase at 95 °C for a duration of 5 min, followed by 40 cycles consisting of denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 20 s. The dissociation curves were examined to confirm that one peak was discerned for each specified melting temperature, illustrating that the PCR products were amplified with precision. We used duplicate samples for testing. The calculation of the relative gene expression levels (fold change) involved normalizing the Ct values of the target gene against β-actin as the housekeeping gene.

2.6. Statistical Analysis

The collected data underwent a rigorous statistical examination utilizing SPSS V.26 software for the analysis. An independent-samples t test was used to identify the significant differences among the means (p < 0.05). The data are presented as the mean accompanied by the standard error. Gene expression was assessed in triplicate and subsequently normalized against β-actin as a reference gene. The relative gene expression was evaluated using the 2^−ΔΔCt method.

3. Results

3.1. Growth Performance

The results regarding the overall growth performance elucidated the advantages of integrating FBP into broiler diets.

Table 5. The impact of FBP dietary supplementation on the performance measurements of dwarf yellow-feathered broilers (DYBs).

Parameters	CON	FBP	SEM	p-Value
Initial BW (g)	51.98	52.35	0.53	0.477
	days 1–22 (1% FBP)
BW (g)	424.83	466.88 ***	4.95	<0.001
BWG (g)	372.85	414.53 ***	7.23	<0.001
ADFI (g)	50.82	43.31	2.96	0.334
ADG (g)	17.75	19.73 ***	0.35	<0.001
FCR	2.86	2.19	0.34	0.086
Mortality rate %	1.33	1.17	0.54	0.766
	days 23–45 (2% FBP)
BW (g)	1154.33	1288.67 ***	21.52	<0.001
BWG (g)	729.50	821.79 ***	20.93	<0.001
ADFI (g)	78.18	73.73	4.03	0.332
ADG (g)	31.72	35.73 ***	0.91	<0.001
FCR	2.46	2.06 *	0.19	0.053
Mortality rate %	1.25	1.00	0.32	0.470
	days 1–45
BW (g)	1154.33	1288.67 ***	21.52	<0.001
BWG (g)	1102.35	1236.32 ***	26.05	<0.001
ADFI (g)	70.71	65.21	3.72	0.330
ADG (g)	25.05	28.10 ***	0.59	<0.001
FCR	2.82	2.28 *	0.22	0.054
Mortality rate %	2.58	2.08	0.23	0.069

CON, control group that received a basal diet; FBP, the FBP group which was given a base diet supplemented with increasing amounts of FBP; SEM, standard error of the means. The same row displays the mean of the variables. The symbols * and *** represent significant differences between the groups, with star symbols accompanying the means that are significantly distinct (p < 0.05 and p < 0.001).

presents a detailed overview of the impact of FBP dietary supplementation on the body weight of broiler chicks through two successive developmental phases, incorporating the following two additional amounts of FBP: 1.0 and 2.0 g/kg (p < 0.001). The initial body weight of the chicks in both the control and FBP groups was obviously comparable at the starting point of the experiment.

3.2. Carcass and Organ Weight

The eviscerated yield, as well as the weights and indices of both the breasts and thighs, significantly increased in the chickens fed an FBP diet, outperforming those in the control group (p = 0.05). However, we observed significant differences in the organ weights between the control and FBP groups (p > 0.05). Figure 1 shows that FBP incorporation to the basic diet consistently increased the weights of both the carcass and the organs. This indicates that the diet supplementation had an effect on body growth as a whole.

3.3. Intestinal Morphology

The findings indicated that the incorporation of FBP into the diet enhanced the structural characteristics of the gut (duodenum, jejunum, and ileum) on day 45 in comparison to the control group. The villi in the duodenum exhibited greater height in the FBP group compared to the control group. Furthermore, the FBP group showed deeper crypts in comparison to the control group. However, when comparing the control group to the FBP-treated group, the analysis showed no significant difference in the ratio of the villus height and crypt depth, nor in the area of the villi. FBP significantly enhanced both the crypt depth and villi height in the jejunum (p < 0.01). Nevertheless, the treated group showed no significant effect on the villi-to-crypt ratio or the villi area. The morphology of the ileum demonstrated significant changes due to the FBP treatment, particularly in the measurements of the villi height, crypt depth, and villi area. Conversely, the FBP treatment showed no significant effect on the development of ileum crypts.

Table 6. Effects of dietary FBP on the intestinal histology of DYBs.

Item	CON	FBP	SEM	p-Value
duodenum
VH (mm)	0.58	0.67 **	0.02	0.003
CD (mm)	0.10	0.17	0.04	0.096
VCR	6.63	4.81	1.08	0.153
VA (mm2)	1.66	1.92	0.21	0.263
jejunum
VH (mm)	0.46	0.59 **	0.03	0.007
CD (mm)	0.09	0.13 **	0.01	0.007
VCR	5.12	4.66	0.45	0.347
VA (mm2)	1.80	2.01	0.27	0.474
ileum
VH (mm)	0.60	0.74 *	0.05	0.038
CD (mm)	0.34	0.49 *	0.04	0.021
VCR	1.85	1.52	0.20	0.142
VA (mm2)	1.55	2.86 *	0.50	0.048

VH, villus height; CD, crypt depth; VCR, villus height/crypt depth ratio; VA, villus area; CON, chicken given a basal diet; FBP, a basal diet supplemented with fermented bamboo powder with different amounts; SEM: mean difference’s standard error. On the same row is presented the mean of the variables. Significant variations across the groups are shown by the symbols * and **; each of the star symbols follows significantly different means (p < 0.05 and p < 0.01).

and Figure 2 illustrate the findings previously discussed. In addition, FBP increased the height, depth, and surface area of the villi in the duodenum, jejunum, and ileum compared to the control group.

3.4. Serum Biochemical Index

Table 7. Effect of dietary supplementation with FBP on the serum biochemical indices in DYB chickens.

Parameters	Dietary Treatment		SEM	p-Value
	CON	FBP
TC (mmol/L)	3.38	2.78	0.54	0.323
TG (mmol/L)	0.80	0.57 *	0.07	0.025
GLU (mmol/L)	7.25	6.55	0.70	0.079
LDL (mmol/L)	1.14	0.81	0.32	0.406
HDL (mmol/L)	1.87	2.25	0.16	0.133
TP (g/L)	23.80	26.35	1.24	0.108
ALB (g/L)	13.40	14.57	1.06	0.385
GLB (g/L)	11.63	12.77	1.57	0.510
CREA (mmol/L)	10.73	8.47	3.14	0.511
UREA (mmol/L)	1.22	0.59 *	0.14	0.011
AST (U/L)	303.30	259.83	29.87	0.277
ALT (U/L)	3.33	2.30 *	0.31	0.028

TC, total cholesterol; TG, triglyceride; GLU, glucose; LDL, low-density lipoprotein cholesterol; HDL, high-density lipoprotein cholesterol; TP, total protein; ALB, albumin; GLB, globulin; AST, aspartate transaminase; ALT, alanine transaminase; the mean of the variables is shown in the same row with significance (p < 0.05). The standard error of the mean (SEM) and an asterisk (*) represent statistically significant differences between the groups.

shows the influence of FBP on the broiler chicken blood biochemical analysis. The findings showed that incorporating FBP in the diet enhanced the blood levels of low-density lipoprotein (LDL), cholesterol (Chol), and glucose (GLU). Furthermore, the inclusion of FBP resulted in higher concentrations of total protein (TP) and high-density lipoprotein (HDL) compared to the control group. On the other hand, the application of FBP significantly influenced the serum concentration levels of triglycerides (TGs) (p < 0.05). In contrast, FBP influenced the liver function by decreasing the serum aspartate transaminase (AST) and significantly decreasing alanine transaminase (ALT) (p < 0.05). The FBP significantly decreased the urea concentration (p < 0.05), but there was no significant effect on the creatinine concentration.

3.5. Antioxidant Status

The data presented in

Table 8. Impact of dietary FBP on the serum antioxidant index of DYB chickens.

Item	CON	FBP	SEM	p-Value
SOD (U/mL)	48.79	122.90 **	5.28	0.005
GSH-PX (U/mg)	119.64	136.63	7.31	0.146
CAT (nmol/mg prot)	40.73	116.38 **	3.84	0.003
MDA (nmol/mg prot)	2.29	0.49 **	0.19	0.011
HO-1 (pg/mL)	255.37	243.03	22.01	0.631

SOD, superoxide dismutase; GSH-PX, glutathione peroxidase; CAT, catalase; MDA, malondialdehyde; HO-1, heme oxygenase-1; CON, basal diet; FBP group, basal diet adding gradual levels of FBP. The mean of the variables is shown in the same row with significance (p < 0.05). The symbol ** indicates significant differences between the groups, while SEM stands for the standard error of the mean.

elucidate the influence of FBP on the serum antioxidant markers. The activities of CAT and SOD have been increased significantly in comparison to the control group (p < 0.01). We observed no notable differences in the GSH-PX content between the control and FBP groups. In comparison to the control group, the FBP group showed a significant decrease (p = 0.01) in MDA levels.

3.6. Impact of FBP on the Relative mRNA Expression Levels of Nutrition Transporter Genes in the Intestine

Figure 3 illustrates the examination of the mRNA expression levels for seven genes within the three major parts of the intestine, specifically, in the duodenum, jejunum, and ileum, after the addition of feed FBP. The FBP diet significantly enhanced the relative mRNA expression of CAT1, CAT2, PepT2, and LAT1 in the intestinal tract of the birds when contrasted with the CON diet group (p < 0.05). The FBP diet exhibited no discernible impact on the other genes examined, such as GLUT1, GLUT2, and PepT1, in comparison to the control group. Conversely, the FBP diet increased the relative mRNA expression level of GLUT in the jejunum.

4. Discussion

Previous investigations conducted on broilers have shown that incorporating insoluble fiber into their diet can significantly improve their growth results [20,21]. Multiple factors, including the type of fiber resources utilized [22,23], the quantity of fiber incorporated, the particle size of the fiber [24,25], and the specific feeding stage [26], affect the growth performance of broilers. Bamboo, a rapidly expanding perennial plant, is recognized for the valuable nutritional fiber content found in bamboo powder. Therefore, it is regarded as a notably unique feedstock in the animal production sector [27]. Nonetheless, additional research is necessary to investigate the potential benefits of FBP within the field of poultry farming. The current study demonstrates that the inclusion of diets supplemented with FBP has significantly increased the growth performance, particularly in regard to ADFI, throughout the various growth stages. Moreover, the incorporation of FBP into the diet showed a significant improvement in the FCR, in addition to a significant increase in the ADG and BWG during the growth stages of days 1–22 and 23–45. Furthermore, the FBP significantly increased both the carcass and organ indices. The observed enhancements corresponded to a 1% and 2% increase in the FBP levels in comparison to the basal diet. This finding is consistent with the findings of a recent investigation, which showed that incorporating 1% micronized bamboo powder into broiler diets improved their feed conversion ratio and enhanced their body weight gain. This suggests that FBP has beneficial effects on growth performance [28,29]. Researchers also conducted an additional study which identified no adverse impacts on growth performance measurements like the average daily feed intake (ADFI) and average daily gain (ADG) in growing-fattening pigs fed diets supplemented with FBP additions [15]. The results of this research indicate that FBP may function effectively as a feed component in chicken production.

Serum biochemical measures are commonly employed in nutritional assessments to evaluate the quality of test feedstuffs or additives, and to provide insights into the physiological and metabolic activity of animals [30]. The present investigation demonstrated that the inclusion of FBP had beneficial results on a lot of serum biochemical indicators. Triglycerides and cholesterol are distinct lipid molecules that move inside of the body as the constituents of lipoproteins. Coronary heart disease is a condition that arises from the accumulation of cholesterol on the walls of arteries, resulting in the formation of plaque and the subsequent constriction of the arteries. This narrowing leads to reduced blood flow to the heart. An excessive presence of triglycerides and cholesterol were linked to the development of coronary heart disease. Monocytes internalize the low-density lipoprotein (LDL) particles and attach to the endothelial cells lining the coronary artery. Subsequently, these monocytes undergo differentiation into macrophages and subsequently amass within the artery, leading to the formation of a “fatty streak” that ultimately progresses into an atherosclerotic lesion [31,32]. In the present investigation, it was observed that the levels of blood triglycerides exhibited a consistent and statistically significant increase in chickens that were fed the control diet, as compared to those that were provided with the FBP diet. Conversely, no notable differences were seen in terms of cholesterol and LDL concentrations. The reduction in serum metabolites observed in broilers receiving diets enriched with FBP has uncovered further health benefits linked to the incorporation of FBP as a dietary supplement in broiler chicken diets. These results are consistent with previous research that has addressed the beneficial impact of a bamboo leaf extract (BLE) diet on serum biochemical markers in broiler chickens [33], as well as the effects of a diet containing Fermented Bamboo Shoot Processing Waste (FPSBW) on serum triglycerides and cholesterol in pigs [12].

Nonetheless, the incorporation of FBP led to a greater rise in serum HDL levels; however, this difference did not achieve statistical significance. Thus, the incorporation of FBP might result in raised HDL and IgA levels, consequently enhancing the overall health of broiler chickens and offering protection against different diseases. Bamboo products’ high content of flavonoids, organic acids, phenolic compounds, and polysaccharides, all known to influence the lipid metabolism, contributes to their increased HDL concentrations [11,34].

Previous studies have revealed that incorporating bamboo shoot shell fiber into the diet enhanced the control of fat metabolism disorders in mice subjects [35]. This dietary intervention led to a decrease in cholesterol, triglyceride, and low-density lipoprotein cholesterol levels in serum, concurrently increasing the levels of high-density lipoprotein cholesterol. Conversely, we frequently regard serum total protein and urea nitrogen levels as indicators of protein synthesis and metabolism, factors linked to the growth performance of broiler chickens. The observed increases in serum total protein levels indicate an increased rate of protein synthesis and absorption. The presence of urea nitrogen in serum is a consequence of protein catabolism. Consequently, a reduction in serum urea nitrogen indicates an enhancement in the synthesis of proteins derived from amino acids [36]. We regard the level of serum urea nitrogen as a crucial factor in assessing the quality of dietary protein. The decrease in serum urea nitrogen levels signifies an enhancement in the protein quality of fermented feed, reflecting a more effective utilization of amino acids for the synthesis of tissue proteins. Nonetheless, the level of glucose in the serum acts as a dependable indicator of energy availability [37]. In contrast to the control group, the present study noted a significant reduction in serum urea and glucose levels in chickens that received the FBP. Nonetheless, there was no observable impact on the total protein concentration. This conclusion aligns with the findings presented in earlier studies [28].

The antioxidant parameters detected in serum function as indicators of the organism’s capacity for protection against antioxidants. Antioxidant enzymes, including glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), and catalase (CAT), function synergistically to efficiently eliminate free radicals and maintain cellular homeostasis. MDA is recognized as a byproduct of lipid peroxidation, functioning as an indicator of assessing the extent of oxidative stress. The findings of our investigation indicate that the incorporation of FBP into the diet significantly enhanced the activities of SOD and CAT in the serum, alongside an increase in GSH-Px activity, in contrast to the control group. Moreover, the FBP group showed a significant decrease in serum concentrations of MDA when contrasted with the control group. The flavonoids present in FBP likely contribute significantly to enhancing the efficacy of antioxidant enzymes and inhibiting the synthesis of compounds that interact with thiobarbituric acid. Previous research has shown that flavonoids have antioxidant properties in living organisms due to their ability to bind metal catalysts, activate antioxidant enzymes, inhibit oxidases, and transfer electrons to free radicals [38]. Moreover, additional research has shown that broiler diets supplemented with plant extracts, which are rich in flavonoids, polyphenols, and polysaccharides, including Ginkgo biloba leaf extract [39] and Artemisia annua extract, can enhance their ability to scavenge free radicals [40]. Conversely, the administration of BLE has been associated with enhancements in the oxidative status of broiler chickens [41]. The findings of our current investigation align with earlier studies indicating that dietary supplementation with FBP promotes the relative expression of genes associated with antioxidants, odorant receptors, growth, and immunity in yellow-feathered broiler chickens [42]. This suggests that incorporating FBP into the diet of broiler chickens contributes to an increased antioxidant capacity. This encourages additional research into the application of bamboo powder within the poultry sector.

The small intestine plays a crucial role in the absorption of nutrients. Researchers propose that elongated intestinal villi increase the intestine’s absorptive surface area, while shorter intestinal villi hinder nutrient absorption. The increase in the villus height is directly associated with enhanced nutrient digestion and absorption [43]. The incorporation of a diet enhanced with BLE has demonstrated a beneficial impact on the biogenesis of mitochondria within the small intestine of broiler chickens [44].

Our work demonstrated that the administration of FBP improved gut growth by increasing the surface area and height of the intestinal villi. The increase in the villus height and intestinal area observed in this study is attributable to the antimicrobial, antioxidant, and anti-inflammatory properties of bamboo, which enhance the proliferation of beneficial bacteria while diminishing pathogenic bacteria, thereby reducing inflammatory processes in the intestinal mucosa [15,45]. The enhancements in the gut structure and function enable the superior use of dietary components, such as proteins and minerals, hence enhancing the feed efficiency.

The process involves the incorporation of fiber through dietary supplementation and the utilization of corn with a coarse particle size. The expression of intestinal cationic amino acid transporter-1 (CAT1), duodenal aminopeptidase N (APN), jejunal alanine, serine, cysteine, threonine transporter-1 (ASCT1), and ileal peptide transporter-2 (PepT2), along with genes responsible for digestive enzymes, is notably increased in the digestive system of broiler chickens [46]. When fermented dried brewer grains (DBGs) were added to broiler feed, the relative expression of nutrient transporter genes was upregulated in the duodenum [47].

The current investigation revealed enhancements in broiler performance through the incorporation of dietary FBP, alongside a demonstrated upregulation of the relative expression of various nutrient transporter genes in the duodenum, jejunum, and ileum. For example, CAT1, a transporter facilitating the bidirectional transport of cationic amino acids in the duodenum, jejunum, and ileum, was found to be upregulated by FBP. Moreover, jejunal GLUT1, which facilitates glucose transport, along with PepT2, which plays a lesser role in the transport of di- and tri-peptides, exhibited upregulation due to FBP. Indeed, the enhanced nutrient transportation will not only facilitate improved nutrient absorption but also contribute significantly to the preservation of the immune response and intestinal barrier integrity. For some time, we have recognized that a lack of amino acids, such as alanine, cysteine, serine, threonine, arginine, and lysine, is detrimental to immune function, thereby increasing the vulnerability of animals to infectious diseases.

5. Conclusions

Overall, the incorporation of FBP to the diet has significantly impacted the growth performance. Additionally, it had positive effects on promoting serum biochemical and antioxidant indices. This study serves as a significant milestone in comprehending the potential of FBP as a dietary fiber source to enhance poultry production. Given the beneficial properties of this plant, we highly recommend the use of FBP as a supplement in poultry diets.