Molecular Identification, Pathogenicity, and Fungicide Sensitivity of Sclerotinia spp. Isolates Associated with Sclerotinia Stem Rot in Rapeseed in Germany

Abstract

(1) Background: Sclerotinia sclerotiorum is the main causal agent of Sclerotinia stem rot in rapeseed, while the related species S. subarctica has also been reported. However, its prevalence and impact in Germany remain unclear. Understanding the pathogenicity and fungicide sensitivity of Sclerotinia spp. is important for effective and sustainable disease management. (2) Methods: Isolates were collected from symptomatic rapeseed plants across Germany. Molecular identification was performed via ITS rRNA sequencing. Pathogenicity was assessed by stem inoculation of five rapeseed cultivars at the flowering stage. Fungicide sensitivity was tested in vitro against seven active substances, including azoles, boscalid, azoxystrobin, and fludioxonil. (3) Results: All isolates were identified as S. sclerotiorum; S. subarctica was not detected. Of the tested isolates, 23 showed low aggressiveness (relative lesion length < 15% of total plant length), 29 were moderately aggressive (15–20%), and 10 were highly aggressive (>20%). Azole fungicides were highly effective (EC₅₀ < 1.6 μg a.s. mL⁻¹), while reduced sensitivity was observed for boscalid, azoxystrobin, and fludioxonil (EC₅₀ > 4.0). (4) Conclusions: This study provides insight into the molecular identity, pathogenicity, and fungicide sensitivity of Sclerotinia isolates. The observed variability in aggressiveness and mycelial growth to fungicide emphasize the need for integrated management strategies to ensure Sclerotinia stem rot control.

1. Introduction

Sclerotinia stem rot, primarily caused by the necrotrophic fungus Sclerotinia sclerotiorum, represents a significant disease affecting rapeseed (Brassica napus), a major arable crop in Germany, cultivated over more than one million hectares annually [1,2]. The disease is characterized by white, fluffy mycelial growth on stems, followed development of hard, black sclerotia. These sclerotia enable the pathogen to persist in the soil for many years, facilitating recurrent infections by producing apothecia and subsequently ascospores, which serve as the primary inoculum [3,4,5,6,7]. Sclerotinia stem rot can inflict considerable damage on rapeseed crops, including stem breakage, premature ripening, and reduced seed yield and quality. Severe infestations can lead to significant economic losses due to the decreased marketability of affected crops [4,8,9,10].

Due to the economic significance of winter rapeseed, effective disease management is essential. Crop rotation is often constrained by the pathogen’s wide host range and the long-term survival of sclerotia in the soil. Agronomic measures, including the choice of cultivar, irrigation management, and optimal plant density, can help reduce disease severity. Nonetheless, the most reliable control method continues to be the timely application of fungicides during flowering [1,5,11]. A single application of fungicides in the spring during the plant flowering stages (BBCH 60–69 after Meier et al. [12]) is considered the most effective strategy for controlling Sclerotinia stem rot. Over the past decade in Germany, various groups of fungicides, including pyridine-carboxamide (succinate-dehydrogenase inhibitors; SDHIs), triazole (de-methylation inhibitors; DMIs), and strobilurin (quinone outside inhibitors; QoIs), have been extensively used to manage Sclerotinia stem rot disease. However, widespread control failures have been reported in some years (personal communication with agricultural chambers in Germany). All these fungicide groups are associated with a risk of developing resistance and are classified as medium to high-risk for resistance evolution by the FRAC (Fungicide Resistance Action Committee) [13]. Resistance to the SDHI fungicide boscalid has been documented in field isolates of Alternaria alternata [14] and Botrytis cinerea [15]. Additional studies suggest that sensitivity to boscalid may have decreased in field isolates of S. sclerotiorum [16,17,18]. Conversely, Hu et al. [19] assessed the baseline sensitivity of S. sclerotiorum to boscalid by measuring the effective concentration required to inhibit mycelial growth by 50% (EC₅₀-value) for different isolates over various years. They found no shift in boscalid sensitivity in S. sclerotiorum isolates between 2008 and 2014. Furthermore, evaluations of S. sclerotiorum sensitivity to DMIs (e.g., tebuconazole and prothioconazole) and QoIs (e.g., azoxystrobin and pyraclostrobin) revealed that all studied isolates were sensitive to these fungicides, with no resistant isolates detected in fungal populations from different countries [20,21]. Notably, a recent study in Germany assessed the efficacy of several fungicides, including azoxystrobin, boscalid, fludioxonil, prothioconazole, and tebuconazole, on the baseline sensitivity of 68 S. sclerotiorum isolates, in vitro. The results demonstrated that boscalid and fludioxonil exhibited the highest fungicidal activity against Sclerotinia spp. isolates, with mean EC₅₀ values of 1.23 and 1.60 μg a.s. mL⁻¹, respectively. The most significant variability in EC₅₀ values between isolates was observed with prothioconazole and azoxystrobin [1].

Although the incidence of fungicide resistance, population structure, and virulence of S. sclerotiorum populations have been well studied, there are fewer reports on related species such as S. subarctica. The species S. subarctica (also referred to as Sclerotinia sp. 1) closely resembles S. sclerotiorum in culture. It was initially identified on wild hosts in Norway, followed by its discovery on potatoes [22]. The challenge in differentiating S. subarctica from S. sclerotiorum is significant, as their symptoms on plants are similar, and they appear very similar in culture, although S. subarctica generally produces larger sclerotia [23]. Identification of S. subarctica as a new species was thus based on three nucleotide substitutions in the ITS region and the lack of a 304-base group I intron in the large subunit of the ribosomal RNA gene [22,24]. Subsequently, S. subarctica was discovered in the United Kingdom on meadow buttercup (Ranunculus acris), with pathogenicity confirmed on rapeseed [23]. More recently, the pathogen has been reported in turnip (B. rapa subsp. oleifera) in Norway [25]. Although the biology and epidemiology of S. subarctica remain poorly understood, one hypothesis is that it is more endemic to cooler climatic regions than to warmer ones [26]. To date, no studies have been conducted in Germany on the incidence and diversity of S. subarctica in rapeseed cultivations.

Between 2020 and 2022, a comprehensive national survey was carried out in major rapeseed-growing regions of Germany to assess the prevalence of Sclerotinia stem rot [10]. Infected plants containing sclerotia were collected from commercial fields across several federal states, including Baden–Württemberg, Bavaria, Hesse, Lower Saxony, Mecklenburg–Vorpommern, North Rhine–Westphalia, Saxony–Anhalt, Saxony, Schleswig–Holstein, and Thuringia. The incidence of Sclerotinia stem rot in these fields ranged from 2% to 42% [10]. From the collected material, 62 isolates of Sclerotinia spp. were obtained and purified [10]. Subsequent analyses of these isolates revealed significant variability in colony coloration, sclerotial number and formation pattern, mycelial growth index, and mycelial compatibility grouping, as well as differential levels of aggressiveness when tested on several rapeseed cultivars at the cotyledon stage [10].

The objectives of the present study were (i) to determine whether S. subarctica could be detected among isolates previously collected from rapeseed fields in Germany, or whether all isolates belonged to S. sclerotiorum, (ii) to evaluate the pathogenicity and aggressiveness of Sclerotinia spp. on different rapeseed cultivars at the flowering stage, and (iii) to assess the sensitivity of Sclerotinia spp. isolates to the most commonly used commercial fungicides for the control of Sclerotinia stem rot in rapeseed cultivation.

2. Materials and Methods

2.1. DNA Extraction and Molecular Identification of S. sclerotiorum and S. subarctica

Sclerotia of each of the 62 Sclerotinia spp. isolates, collected previously in the study mentioned above, were crushed in a Mixer Mill MM 400 at high speed for 3 min (Retsch GmbH, Haan, Germany). DNA extraction of the isolates was performed with the InnuPREP Plant DNA Kit (IST Innuscreen GmbH, Berlin, Germany) using Lysis Solution SLS following the manufacturer’s Protocol 1. The concentration and quality of the DNA were determined on a Biochrom NanoVue Plus spectral photometer (Biochrome, Cambridge, UK). To identify Sclerotinia spp. isolates, a PCR reaction was performed on a Biometra thermocycler (Analytik Jena GmbH + Co. KG, Jena, Germany). The PCR mastermix consists of Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific™, Braunschweig, Germany), the primer pair ITS2AF (TCGTAACAAGGTTTCCGTAGG) and ITS2AR (CGCCGTTACTGAGGTAATCC) by Clarkson et al. [24] and the DNA template to amplify the rRNA ITS region. The PCR program was as follows: initial denaturation step at 98 °C for 10 s, followed by 35 cycles of 98 °C for 1 s, 60 °C for 5 s, 72 °C for 15 s, and a final extension step at 72 °C for 1 min. The PCR products were loaded on a 1.2% TAE agarose gel and run at 80 V for 50 min. The size of the products was estimated using a 100 bp ladder (Carl Roth GmbH, Karlsruhe, Germany) loaded on the gel. All PCR products were purified with the innuPREP PCRpure Kit (IST Innuscreen GmbH, Berlin, Germany) and sent for Sanger sequencing analysis (Microsynth SEQLab, Göttingen, Germany). The obtained sequences were processed with CLC Main Workbench 23 (Qiagen, Hilden, Germany) and blasted against the NCBI database [27]. Phylogenetic tree analysis was performed with MEGA11 using Maximum Likelihood with the Bootsrap method (1000 bootstrap) and the Kimura 2-parameter model (Molecular Evolutionary Genetics Analysis version 11) [28].

2.2. Pathogenicity and Aggressiveness Test

Five winter rapeseed (Brassica napus) cultivars were included in this study: cv. Avatar and cv. Kicker (Norddeutsche Pflanzenzucht Hans-Georg Lembke KG (NPZ), Holtsee, Germany), cv. Bender and cv. Crocodile (Deutsche Saatveredelung AG (DSV), Lippstadt, Germany), and cv. PT 303 (Corteva Agriscience Germany GmbH, Munich, Germany). These cultivars were selected based on the breeders’ expectations of varying susceptibility or tolerance to Sclerotinia stem rot. Seeds were sown in multi-pot plates containing 84 mini-pots each (Herku-Plast-Kubern GmbH, Ering am Inn, Germany), filled with a standardized mixture of CP soil (FloraSelf^®, Bornheim, Germany) and sand at a 5:1 ratio. Plants were grown under controlled greenhouse conditions at 20/18 °C (day/night), 70% relative humidity, with a 16/8-h photoperiod and light intensity of 150 µmol m⁻² s⁻¹. When the plants reached the growth stage BBCH 10 (fully expanded cotyledons), the multi-pot plates were transferred to a cold room at 4 °C for plant vernalization for six weeks. During this period, the plants were irrigated as needed. After vernalization, the seedlings were transplanted into pots (13 × 13 cm) containing a mixture of potting soil and sand (5:1; FloraSelf^®, Bornheim, Germany). The plants were then grown under the previously mentioned greenhouse conditions.

All 62 Sclerotinia spp. isolates collected between 2020 and 2022 were used for pathogenicity and aggressiveness testing. To prepare new cultures of each isolate, sterile sclerotia were placed on potato dextrose agar (PDA; Carl Roth GmbH, Karlsruhe, Germany) and incubated at 20 °C in the dark for four to five days. Three mycelial plugs (0.5 cm in diameter) were subsequently transferred from the colony margins of each isolate into 150 mL Erlenmeyer flasks containing 50 g of twice-autoclaved oat grains, which had been hydrated with distilled water for 24 h. Finally, the inoculated Erlenmeyer flasks were incubated at 20 °C in the dark for three days with daily shaking to ensure equal distribution of the inoculum.

Stem inoculation was carried out at the growth stage of approximately BBCH 61–65 (beginning to mid-flowering stages) by securing a Sclerotinia-infested oat seed in the middle of the stem with the aid of Parafilm^® tape, ensuring the seed remained in place for successful inoculation (Figure 1). Ten plants per cultivar and isolate were used as replicates. A completely randomized design with two chambers per combination of cultivar and isolate or control was used, and the experiment was conducted twice.

Disease assessment was carried out 9 days post-inoculation (dpi) by measuring stem lesion length from the upper edge of the lesion down to the bottom of the lesion with a ruler (Figure 1). The relative values and mean values of the replicates were calculated according to the following formula:

Relative stem lesion length (%) = (Stem lesion length)/(Length of the plant) × 100

Subsequently, isolates were categorized into three aggressiveness groups based on their relative lesion lengths: low (<15%), moderate (15–20%), and high (>20%).

2.3. Fungicide Sensitivity Evaluation

Mycelium Growth Inhibition Test

The sixty-two isolates representing the Sclerotinia spp. population were tested for mycelial growth on potato dextrose agar (PDA; Carl Roth GmbH, Karlsruhe, Germany) amended with various fungicides containing different active substances (

Table 1. Fungicides used in sensitivity assays of Sclerotinia population.

Commercial Product	Active Substance (a.s.)	a.s. Content	Mode of Action a	Formulation b	Manufacturer	Location
Amistar	azoxystrobin	250 gL−1	QoI	SC	Syngenta Agro	Maintal, Germany
Cantus	boscalid	500 g kg−1	SDHI	WDG	BASF SE	Ludwigshafen, Germany
Caramba	metconazole	60 g L−1	DMI	EC	BASF SE	Ludwigshafen Germany
Geoxe	fludioxonil	500 g kg−1	Inhibitor of MAP	WDG	Syngenta Agro	Maintal, Germany
Orius	tebuconazole	250 g L−1	DMI	EC	Nufarm Deutschland	Köln, Germany
Proline	prothioconazole	250 g L−1	DMI	EC	Bayer Crop Science	Monheim, Ger-many
Revystar	mefentrifluconazole	100 g L−1	DMI	EC	BASF SE	Ludwigshafen, Germany

^a QoI: Quinone outside inhibitors; SDHI: succinate–dehydrogenase inhibitors; DMI: de-methylation inhibitors. ^b SC: suspension concentrate; WDG: water dispersible granule; EC: emulsion concentrate.

). Final fungicide concentrations of zero (control), 0.01, 0.05, 0.1, 0.5, 1.0, 5.0, 10.0, and 50 μg a.s. (active substance) mL⁻¹ in 25 mL PDA per plate were used. Commercial fungicide products (Table 1) were suspended in sterile distilled water to obtain stock suspensions (10,000 mg mL⁻¹), and the appropriate volume was added to PDA (50 to 55 °C) after sterilization. Mycelial plugs were then cut with a 5 mm diameter cork-borer (Carl Friedrich Usbeck KG, Radevormwald, Germany) from the margins of three-day-old colonies of each isolate and placed mycelium-side down at the centers of fungicide-amended PDA plates. The Petri dishes were incubated in darkness at 20 °C. Four plates per combination of isolate–fungicide concentration were prepared, and the experiment was repeated once. Treatments were laid out in a completely randomized design, with experiments as blocks, fungicides and doses as the independent variables, and isolates as replications. Colony diameters (excluding the diameter of the inoculation plug) were measured in two directions at 90° to one another at 3 dpi. The mean growth values were calculated and converted into mycelial growth inhibition percentages relative to the control treatment using Abbott’s formula:

Mycelial growth inhibition (%) = (C − T)/C × 100

where C and T represent mycelial growth diameter (mm) in control (C) and treated (T) Petri dishes, respectively.

The effective fungicide concentration to inhibit mycelial growth by 50% (EC₅₀, μg mL⁻¹) was further calculated using linear regression of colony diameter on log-transformed fungicide concentration, based on the mean colony diameter for all replicates at each concentration. To determine the EC₅₀ values, dose–response curves were constructed by plotting mycelial growth inhibition percentages against log-transformed fungicide concentrations. A four-parameter logistic equation was then fitted to the data using nonlinear regression analysis in R studio (version 4.4.3) [29]. Values were plotted with https://app.biorender.com (accessed on 15 July 2025).

2.4. Statistical Analysis

Comparisons among various Sclerotinia spp. isolates and winter rapeseed cultivars were conducted by using analysis of variance (ANOVA) with Fisher’s least significant difference (LSD) test, deemed significant at a threshold of p ≤ 0.05 using Statistica version 9.1 (Stat Soft, Inc., Tulsa, OK, USA). Data were analyzed following the one and two-way ANOVA with isolate and cultivar as independent variables. Fungicide sensitivity values were tested using the Shapiro–Wilk normality test. If normality was not met, the Kruskal–Wallis test with Dunn’s multiple comparisons test was applied.

3. Results

3.1. Molecular Identification and Characterization of Sclerotinia spp. Isolates

The BLASTn analysis (2.16) of the amplicons of the ITS regions of the rDNA showed that all tested isolates were S. sclerotiorum, while no S. subarctica (previously called Sclerotinia sp. 1 [22,26]) was identified among the unknown isolates. Sclerotia from one known S. subarctica isolate were used as a positive control and could be verified by sequence analysis. Based on the ITS sequences, a phylogenetic tree was calculated with reference isolates from S. sclerotiorum and S. subarctica. Stromatina raputum served as an outgroup sequence (Figure 2).

3.2. Pathogenicity and Aggressiveness Assessment Results

All examined Sclerotinia spp. isolates demonstrated virulence against the evaluated rapeseed cultivars, consistently inducing typical grayish lesions on the stems within 9 dpi. However, significant differences in aggressiveness among the isolates (p ≤ 0.05) were observed across the cultivars (

Table 2. Two-way analysis of variance evaluating the impact of independent variables on Sclerotinia stem lesions across all Sclerotinia spp. isolates and rapeseed cultivars.

Independent Variables	d.f.	F-Value	p
Isolate	61	15.63	0.001 *
Cultivar	4	38.21	0.002 *
Isolate × Cultivar	244	12.34	0.041 *

d.f.: degrees of freedom; F: value for comparison with the critical value for significance; p: the level of significance (p-value); (*) denotes statistical significance at the 0.05 level (p ≤ 0.05).

and Supplementary Figure S1). Moreover, there were significant variations in relative lesion length among the different rapeseed cultivars (Figure 3). The results from the two-way ANOVA, where Sclerotinia spp. isolate and rapeseed cultivar were treated as the main effects, and are presented in Table 2. The analysis revealed that the isolate, the cultivar, and their interaction had significant effects (p ≤ 0.05), as determined by an F-test.

The assessment based on relative lesion length revealed significant variability in aggressiveness among the S. sclerotiorum isolates. Of the isolates evaluated, 23 exhibited low aggressiveness, with relative stem lesion lengths below 15% (ranging from 8.1% to 14.9%). Twenty-nine isolates demonstrated moderate aggressiveness, with relative stem lesions between 15% and 20%. Ten isolates were classified as highly aggressive, displaying relative stem lesions ranging from 20% to 25% (

Table 3. Disease severity observed in Brassica napus cultivars inoculated with various Sclerotinia sclerotiorum isolates.

Isolate No.	Relative Stem Lesion Length (%) ± SD
	Winter Rapeseed Cultivars
	Avatar	Bender	Crocodile	Kicker	PT303	Mean
Scl 001/20	16.5 ± 3.6	13.6 ± 8.3	13.6 ± 8.9	13.8 ± 5.4	15.5 ± 3.6	14.6 ± 5.9	bcd
Scl 002/20	19.4 ± 3.1	17.1 ± 3.7	10.3 ± 0.4	11.0 ± 2.7	13.7 ± 3.8	14.3 ± 2.8	bc
Scl 003/20	4.0 ± 2.4	4.2 ± 0.7	14.1 ± 1.8	12.9 ± 0.8	5.3 ± 2.2	8.1 ± 1.5	a
Scl 004/20	9.9 ± 5.3	13.0 ± 7.7	9.1 ± 4.3	16.1 ± 3.1	9.6 ± 2.9	11.5 ± 6.4	abc
Scl 005/20	21.9 ± 4.1	14.8 ± 4.8	17.4 ± 2.04	17.4 ± 5.9	17.2 ± 7.5	17.8 ± 4.6	ef
Scl 006/20	17.4 ±8.8	15.9 ± 5.7	19.5 ± 2.3	23.4 ± 7.7	16.7 ± 8.8	18.6 ± 6.7	fg
Scl 007/20	10.1 ± 7.4	8.2 ± 6.8	9.3 ± 5.5	10.1 ± 8.1	8.7 ± 5.9	9.3 ± 6.7	ab
Scl 008/20	18.3 ± 8.4	17.3 ± 8.6	21.9 ± 6.5	17.5 ± 5.4	14.9 ± 2.8	18.0 ± 6.3	f
Scl 009/20	28.0 ± 8.2	15.7 ± 9.9	12.6 ± 2.3	9.5 ± 5.4	8.6 ± 7.2	14.9 ± 6.6	bcd
Scl 010/20	28.3 ± 2.0	21.5 ± 5.5	9.6 ± 2.9	15.9 ± 5.5	13.1 ± 1.0	17.7 ± 3.4	ef
Scl 011/20	14.0 ± 7.7	19.6 ± 9.7	11.4 ± 3.7	12.5 ± 8.4	16.6 ± 8.8	14.8 ± 7.7	bcd
Scl 012/20	16.9 ± 1.4	16.5 ± 1.4	15.9 ± 2.8	15.8 ± 1.1	6.0 ± 1.6	14.2 ± 1.7	bc
Scl 013/20	14.0 ± 6.8	20.2 ± 3.2	13.4 ± 4.0	18.1 ± 3.6	15.0 ± 5.0	16.1 ± 4.5	d
Scl 014/20	19.3 ± 8.4	14.5 ± 1.1	14.6 ± 6.8	10.0 ± 3.9	9.5 ± 3.5	13.6 ± 4.7	b
Scl 015/20	10.4 ± 6.9	14.3 ± 3.8	14.6 ± 8.3	5.3 ± 2.6	11.9 ± 5.9	11.3 ± 5.5	abc
Scl 016/20	16.4 ± 6.3	13.8 ± 5.1	13.3 ± 2.8	14.4 ± 3.2	12.4 ± 4.9	14.1 ± 4.5	bc
Scl 017/20	16.2 ± 8.5	12.7 ± 4.5	19.8 ± 7.6	11.0 ± 2.4	17.1 ± 10.1	15.4 ± 6.6	bcd
Scl 018/20	27.9 ± 11.8	25.0 ± 7.5	27.1 ± 9.7	26.3 ± 3.7	21.3 ± 5.7	25.5 ± 7.7	lm
Scl 019/20	26.4 ± 6.6	17.6 ± 3.9	13.9 ± 8.5	14.0 ± 6.3	8.9 ± 7.5	16.1 ± 6.6	d
Scl 020/20	17.4 ± 9.9	17.8 ± 4.2	19.9 ± 5.3	12.8 ± 4.5	14.5 ± 2.6	16.5 ± 5.3	de
Scl 021/20	18.9 ± 5.5	15.8 ± 2.9	11.3 ± 6.2	18.2 ± 3.0	8.3 ± 3.8	14.5 ± 4.3	bcd
Scl 022/20	28.3 ± 11.9	15.5 ± 10.4	18.9 ± 16.1	20.5 ± 14.6	12.6 ± 6.9	19.1 ± 12.0	g
Scl 023/20	19.7 ± 7.1	18.3 ± 12.1	24.7 ± 6.0	11.9 ± 10.2	19.2 ± 13.4	18.8 ± 12.0	fg
Scl 024/20	18.2 ± 11.4	13.6 ± 16.5	18.9 ± 1.8	17.7 ± 8.1	7.4 ± 9.6	15.2 ± 9.0	c
Scl 025/20	18.6 ± 6.4	14.2 ± 8.7	13.8 ± 5.7	17.2 ± 5.7	16.6 ± 9.6	16.1 ± 7.2	d
Scl 026/20	25.8 ± 8.5	12.2 ± 10.2	18.7 ± 5.8	15.0 ± 5.3	13.8 ± 4.3	17.1 ± 6.8	e
Scl 027/20	25.0 ± 5.2	15.9 ± 13.0	17.7 ± 7.6	14.2 ± 11.8	10.1 ± 4.1	16.6 ± 8.4	de
Scl 028/20	27.5 ± 5.4	14.3 ± 13.9	22.5 ± 7.5	20.1 ± 11.2	11.8 ± 6.4	19.2 ± 8.4	g
Scl 029/20	16.1 ± 15.0	19.5 ± 6.2	25.8 ± 18.3	26.0 ± 13.9	12.6 ± 5.6	20.0 ± 11.8	h
Scl 030/20	19.6 ± 10.2	16.3 ± 5.9	17.4 ± 11.2	12.7 ± 8.8	12.1 ± 6.1	15.6 ± 8.4	cd
Scl 033/20	19.0 ± 5.5	16.5 ± 5.2	14.1 ± 10.5	22.7 ± 9.5	14.3 ± 6.2	17.3 ± 7.4	e
Scl 034/20	18.0 ± 6.5	23.8 ± 10.8	17.2 ± 7.3	25.0 ± 5.2	13.7 ± 10.0	19.5 ± 8.0	gh
Scl 035/20	15.2 ± 3.1	22.6 ± 11.7	18.1 ± 8.6	16.6 ± 6.6	12.5 ± 5.8	17.0 ± 7.2	e
Scl 036/20	15.5 ± 9.5	25.0 ± 20.0	23.1 ± 7.2	22.8 ± 10.1	18.3 ± 7.6	20.9 ± 10.9	i
Scl 037/20	21.3 ± 5.6	25.6 ± 6.5	20.4 ± 12.0	22.7 ± 4.9	21.0 ± 8.6	22.2 ± 7.5	k
Scl 038/20	26.2 ± 10.5	19.2 ± 8.4	22.3 ± 6.5	15.2 ± 3.6	18.6 ± 4.5	20.3 ± 6.7	hi
Scl 039/20	18.4 ± 6.2	22.2 ± 8.5	24.3 ± 8.2	23.0 ± 7.6	19.7 ± 6.5	21.5 ± 7.4	j
Scl 040/20	24.1 ± 12.4	24.5 ± 7.4	21.8 ± 8.3	21.6 ± 10.4	22.0 ± 6.7	22.8 ± 9.0	l
Scl 041/20	17.2 ± 5.8	22.4 ± 5.2	14.0 ± 7.5	19.1 ± 11.9	18.4 ± 5.3	18.2 ± 7.1	f
Scl 001/21	13.8 ± 4.7	12.1 ± 2.8	17.5 ± 7.9	8.3 ± 4.3	10.3 ± 2.4	12.4 ± 4.4	abcd
Scl 002/21	14.9 ± 5.5	9.4 ± 3.4	17.4 ± 6.8	10.5 ± 3.1	9.6 ± 3.0	12.4 ± 4.4	abcd
Scl 003/21	15.5 ± 5.8	10.8 ± 4.3	15.1 ± 5.4	14.6 ± 5.2	10.8 ± 4.1	13.4 ± 5.0	b
Scl 004/21	16.1 ± 6.1	12.2 ± 5.2	12.7 ± 4.0	18.7 ± 7.4	11.9 ± 5.2	14.3 ± 5.6	bc
Scl 005/21	17.6 ± 7.3	18.9 ± 2.4	15.2 ± 2.2	12.7 ± 5.5	13.7 ± 4.9	15.6 ± 4.4	cd
Scl 006/21	13.9 ± 5.4	10.2 ± 4.2	14.5 ± 3.8	13.4 ± 7.4	10.3 ± 2.8	12.4 ± 4.7	abcd
Scl 007/21	14.2 ± 6.1	7.9 ± 5.6	15.0 ± 6.4	18.0 ± 3.6	10.7 ± 8.4	13.2 ± 6.0	b
Scl 008/21	20.6 ± 10.4	16.5 ± 4.1	24.3 ± 10.3	18.0 ± 3.9	16.2 ± 6.0	19.1 ± 6.9	g
Scl 009/21	15.5 ± 5.0	10.7 ± 8.3	19.5 ± 6.1	15.5 ± 4.0	12.9 ± 4.5	14.8 ± 5.6	bcd
Scl 010/21	16.5 ± 8.5	9.3 ± 6.4	16.0 ± 1.8	19.7 ± 3.9	10.1 ± 5.2	14.3 ± 5.2	bc
Scl 011/21	16.1 ± 4.6	16.7 ± 6.0	24.9 ± 10.9	15.9 ± 3.6	15.1 ± 8.0	17.7 ± 6.6	ef
Scl 012/21	18.0 ± 5.6	14.1 ± 6.7	16.7 ± 5.8	11.0 ± 2.4	16.3 ± 5.1	15.2 ± 5.1	c
Scl 013/21	15.5 ± 3.7	14.3 ± 4.1	18.1 ± 6.4	14.5 ± 7.2	12.6 ± 5.0	15.0 ± 5.3	c
Scl 014/21	17.5 ± 7.2	16.3 ± 5.0	15.6 ± 9.2	15.2 ± 7.4	10.4 ± 2.8	15.0 ± 6.3	c
Scl 015/21	11.7 ± 3.3	14.0 ± 4.3	7.7 ± 7.0	11.4 ± 6.7	12.6 ± 4.5	11.5 ± 5.2	abc
Scl 001/22	16.7 ± 3.6	16.1 ± 3.8	20.1 ± 5.1	19.5 ± 7.1	17.9 ± 8.8	18.1 ± 5.7	f
Scl 002/22	15 ± 3.9	13.5 ± 5.3	18.7 ± 3.7	21.3 ± 5.6	18.6 ± 4.3	17.4 ± 4.6	e
Scl 003/22	11.3 ± 4.4	9.8 ± 4.2	14.8 ± 3.4	13.1 ± 5.3	13.1 ± 6.4	12.4 ± 4.7	abcd
Scl 004/22	13.8 ± 4.7	16.6 ± 3.5	24.8 ± 3.9	18.6 ± 5.9	17.3 ± 6.2	18.2 ± 4.8	f
Scl 005/22	12.7 ± 3.8	12.7 ± 5.4	12.6 ± 5.4	17.9 ± 6.2	14.8 ± 4.8	14.1 ± 5.1	bc
Scl 006/22	17.2 ± 2.6	17.6 ± 4.3	28.7 ± 6.1	26.7 ± 6.7	22.4 ± 6.8	22.5 ± 5.3	kl
Scl 007/22	17.4 ± 3.3	20.3 ± 3.7	27.2 ± 6.6	22.3 ± 7.2	18.8 ± 9.2	21.2 ± 6.0	ij
Scl 008/22	24.4 ± 6.9	21.1 ± 6.3	22.1 ± 5.4	25.4 ± 8.4	16.2 ± 5.1	21.8 ± 6.4	jk

Shown are relative lesion length (%) measured at 9 dpi on adult plants of five winter rapeseed cultivars inoculated with various Sclerotinia sclerotiorum isolates. ± SD: Standard deviation; values (Mean ± SD) designated with the same letters are not significantly different (p ≤ 0.05) according to Fisher’s least significant test (LSD).

). Specifically, isolates Scl 003/20 and Scl 007/20 showed the lowest levels of aggressiveness, with relative lesion lengths of 8.1% and 9.3%, respectively. In contrast, isolates Scl 006/22, Scl 037/20, Scl 040/20, and Scl 018/20 were the most aggressive, exhibiting relative lesion lengths between 22.2% and 25.5% at 9 dpi. The isolates with low aggressiveness differed significantly from those with high aggressiveness in terms of mean relative stem lesion length (Table 3).

Additionally, significant differences in susceptibility or tolerance levels were observed among the rapeseed cultivars following inoculation with various Sclerotinia spp. isolates at 9 dpi (p ≤ 0.05; Figure 3). Among the cultivars tested, Avatar and Crocodile exhibited the highest susceptibility, with mean relative stem lesion lengths of 17.9% (ranging from 4.0% to 28.3%) and 17.5% (7.7% to 28.7%), respectively. For Kicker and Bende, mean lesion lengths were 16.6% (5.3% to 26.7%) and 15.9% (4.2% to 25.6%), respectively; these values did not differ significantly from those of Avatar and Crocodile. The cultivar PT303 was identified as the most tolerant to Sclerotinia stem rot, showing a mean relative stem lesion length of 13.9% (5.3% to 22.4%) (Figure 3).

3.3. Evaluation of Fungicidal Effects on Mycelial Growth

After three days of incubation on agar plates containing various fungicide concentrations, the inhibition of mycelial growth in S. sclerotiorum isolates reflected differences in the efficacy of the tested fungicides and their active substances (Figure 4). In general, greater variability in isolate responses was observed at the lower concentrations (0.1 and 0.5 µg a.s. mL⁻¹). At the lowest concentration, 0.1 µg a.s. mL⁻¹, fludioxonil, followed by boscalid and azoxystrobin, were the least effective in suppressing mycelial growth, with mean inhibition rates of 4% (ranging from 0.0% to 32%), 6% (0% to 64%), and 11% (0% to 52%), respectively (Figure 4a). While mean inhibition rates for azoxystrobin increased from 11% to 20% and for fludioxonil from 4% to 7%, rates for boscalid remained 6% at 0.5 µg a.s. mL⁻¹ (Figure 4b)_. This is in contrast to the inhibition rates observed for isolates growing on plates containing 0.1 µg a.s. mL⁻¹ of azoles, where inhibition rates already reached up to 85–100% for individual isolates. However, the mean efficacies were as follows: 41% for tebuconazole (mean), 33% for prothioconazole, and 54% for metconazole. Only mefentrifluconazole reached efficacy values ranging from 22 to 100% (mean 60%) at the lowest tested concentration compared to the respective controls. An increase in the azole concentrations up to 0.5 µg a.s. mL⁻¹, revealed mean inhibition rates of 90% (range 61–100%) for mefentrifluconazole and 85% (range 27–100%) for metconazole, while lower inhibition rates were detected for prothioconazole and tebuconazole (both mean 62%) (ranges from 30 to 100% and 24–100%) (Figure 4b). All azoles attained mean inhibition rates over 93% at a concentration of 5 µg a.s. mL⁻¹ and over 97% at a concentration of 10 µg a.s. mL⁻¹ in the tested isolates, whereas metconazole and mefentrifluconazole seem to be the most effective and prothioconazole the less effective substance among the tested azoles (Figure 4c,d). Unlike the azoles, the other three tested substances appeared less effective, even at higher concentrations, compared to their respective controls. Azoxystrobin caused mean inhibition rates of 45% (range 40–100%), 52% (range 10–100%), and 66% (range 40–100%) at concentrations of 5, 10, and 50 µg a.s. mL ⁻¹, respectively (Figure 4d–f). On the other hand, the effectiveness of fludioxonil was higher with mean inhibition rates of 75% (range 0–94%), 83% (range 0–97%), and 98% (range 85–100%) at concentrations of 5, 10, and 50 µg mL ⁻¹ (Figure 4d–f). Clearly, boscalid showed the lowest mean inhibition rates of all tested substances with 15% (range 0–92%), 23% (range 0–99%), and 47% (range 0–99%) at concentrations of 5, 10, and 50 µg a.s. mL ⁻¹, respectively (Figure 4d–f).

Based on the growth inhibition rates, EC₅₀ values were calculated for all isolates to estimate the fungicide concentration required to inhibit mycelial growth by 50%. Across the tested fungicide groups, the azoles were found to be the most effective ones with an EC₅₀ value range between 0.0 and 1.6 μg a.s. mL⁻¹ (Figure 5). The active substances mefentrifluconazole and metconazole showed 0.09 μg a.s. mL⁻¹ (range 0.0–0.27) and 0.07 μg a.s. mL⁻¹ (range 0.0–0.27) lower EC₅₀-values compared to tebuconazole with 0.28 μg a.s. mL⁻¹ (range 0.0–1.1) and prothioconazole with 0.29 μg a.s. mL⁻¹ (range 0.03–1.6). Fludioxonil and boscalid showed higher mean EC₅₀-values of 4.0 μg a.s. mL⁻¹ (range 0.0–12.6) and 4.1 μg a.s. mL⁻¹ (range 0.0–11.7), respectively, compared to all other tested active substances, whereas for azoxystrobin, a mean EC₅₀-value of 3.3 μg a.s. mL⁻¹ (range 0.0–8.7) was calculated (Figure 5).

4. Discussion

This study builds on previous research that monitored the prevalence of Sclerotinia spp. associated with Sclerotinia stem rot in Germany [10] by comparing the aggressiveness and fungicide sensitivity of 62 Sclerotinia species recovered from symptomatic rapeseed plants in 12 German federal states.

Although the presence of individual S. subarctica isolates in Germany has been reported (personal communication), our study did not confirm an increased occurrence of this species. However, this does not exclude the possibility that the species may occur at low frequency in Germany. Our findings, therefore, provide no evidence for its presence in the surveyed regions. Larger-scale surveys with expanded sampling would be necessary to clarify its potential distribution in Germany. However, the detection method using the primer pair described by Clarkson et al. [24] and the ITS Sanger sequencing proved to be valid. In case of uncertainty whether the collected isolate is S. subarctica or S. sclerotiorum, it is suitable for rapid and clear identification. This is in line with findings from a Master’s study (MSc) in 2023 that compared various molecular detection methods for Sclerotinia spp. Interestingly, the Sanger sequencing analysis of the PCR product using NCBI BLAST performed reliably, while nanopore sequencing and the sequencing analysis using Kraken2 and UNITE reference databases yielded unexpected and inconsistent results [30]. For future appropriate disease management strategies, it will be important to distinguish between the two species. Misidentification may lead to the wrong use of fungicides that could result in the development of resistance and ecotoxicity. The potential for the pathogen to become established in Germany, along with its economic impact, remains uncertain and will depend on various factors. For example, S. sclerotiorum becomes more virulent as air humidity rises, with disease development in lettuce plants reaching its peak when air relative humidity exceeds 80% [31], while the relationship between precipitation and Sclerotinia stem rot incidence seems rather weak [32]. However, to date, S. subarctica prefers colder environments but may evolve to live in warmer ones through phenotypic plasticity and/or genetic differentiation.

In the present study, differences in the aggressiveness of S. sclerotiorum isolates were assessed by stem inoculating five rapeseed cultivars, each exhibiting varying levels of susceptibility or tolerance to Sclerotinia stem rot. Several methods exist for inoculating rapeseed genotypes with S. sclerotiorum [33]. However, in this study, stem inoculation at the flowering stages was chosen, as it closely resembles the natural infection process under field conditions. Significant differences in aggressiveness were observed among the 62 S. sclerotiorum isolates (p ≤ 0.05). In our previous study [10], the same isolates were evaluated using cotyledon inoculation assays. When comparing those data with the adult plant inoculation results presented here, no predictive relationship was found between disease responses at the cotyledon and adult-plant stages (y = 0.0146x + 16.146, R² = 0.0015). This suggests that distinct resistance mechanisms may be involved in the response to S. sclerotiorum at different developmental stages in rapeseed. Similar results were also reported by Li in 2006 [34], who found that the relationship between seedling and adult plant responses to Leptosphaeria maculans, the causal agent of Phoma stem canker in rapeseed, was influenced by the growth stage of the plant at the time of inoculation. In our study, two-way ANOVA revealed significant differences between rapeseed cultivars, S. sclerotiorum isolates, and their interaction. All 62 S. sclerotiorum isolates collected from various geographical regions in Germany exhibited differences in aggressiveness, as measured by the length of stem lesions. Furthermore, significant differences in aggressiveness were observed among S. sclerotiorum isolates (p ≤ 0.05), even when the isolate × cultivar interaction was not considered (Table 3). Notably, the isolate × cultivar interaction was also significant (p ≤ 0.05), indicating that certain rapeseed cultivars exhibited greater tolerance to specific S. sclerotiorum isolates. The findings of this study are consistent with those reported by Kamvar et al. [35], who observed significant population differentiation of S. sclerotiorum correlated with both geographic regions and the year of isolate collection. Population differentiation based on genetic and morphological variation among S. sclerotiorum isolates has been documented across a wide range of geographical scales, from continents and countries to regions, individual fields, and even within the same field across seasons [36,37,38]. For example, substantial differentiation has been identified between rapeseed fields in China and the USA [37], as well as among various European countries [24]. Notably, Lehner and colleagues demonstrated that, despite comparable levels of genotypic diversity, distinct genetic differentiation exists between S. sclerotiorum populations from North and South America [39]. Furthermore, Poudel reported a wide range of aggressiveness between S. sclerotiorum isolates in lesion formation on sunflower stems, with only a moderate correlation in aggressiveness between the two tested lines [40]. Their population genetic analysis also revealed clear differentiation between S. sclerotiorum populations from warmer climate regions compared to those from cooler regions. Such knowledge is important for developing targeted disease management strategies, as isolates may differ in aggressiveness and response to control measures. However, while these studies reported population differentiation by geographic region or year of collection, our study did not analyze isolates based on collection site or timing due to the low number of isolates per location; therefore, direct comparisons are not possible.

Another interesting aspect of the current study was the investigation of whether the 62 collected S. sclerotiorum isolates responded differently to fungicide treatments, which was assessed through plate assays. Azoles demonstrated efficacy against the tested S. sclerotiorum isolates, whereas azoxystrobin, boscalid, and fludioxonil were comparatively less effective. Boscalid displayed the lowest efficacy values among the tested active substances (Figure 3). This is in line with earlier findings suggesting decreased sensitivity in field isolates [16], but controversy regarding monitoring stems from a German publication from 2021 [1]. In that study, mycelial growth was reduced by 47% to 65% at 3 μg a.s. mL⁻¹ and by 78% to 90% at 10 μg a.s. mL⁻¹ for boscalid in isolates collected from naturally Sclerotinia-infected rapeseed fields in Germany during 2017 to 2019 [1]. On the other hand, isolates collected during 2020 to 2022 revealed reduced mycelial growth inhibition rates of 15% (range 0–92%) and 23% (range 0–99%) at concentrations of 5 and 10 µg a.s. mL⁻¹ boscalid compared to the rates published in 2021 (Figure 4d,e). Nevertheless, these findings should not be interpreted as evidence of a temporal decline in boscalid sensitivity, since intrinsic efficacy differences between active substances may explain the observed patterns [41]. Still, the consistent observation of comparatively low inhibition values across different studies highlights the importance of further monitoring boscalid sensitivity in S. sclerotiorum populations. Similarly to previous findings, where the mycelial growth reduction by azoxystrobin at 100 µg a.s. mL⁻¹ was less than 66% [1], the sensitivity to azoxystrobin at 50 µg a.s. mL⁻¹ observed in the isolates of the current study showed mean values of 66% (Figure 4f). At a concentration of 1 µg a.s. mL⁻¹, the mean inhibition values did not differ between the two studies, both showing 26%. However, recent values ranged from 0% to 60% (Figure 4c), while older ones ranged only from 20 to 42% [1]. Compared to azoxystrobin, higher inhibition rates were observed for fludioxonil. Isolates growing on plates with fludioxonil showed mean inhibition rates of 83% and 98% at concentrations of 10 and 50 µg a.s. mL⁻¹, respectively (Figure 4e,f). Nevertheless, fludioxonil is a candidate for substitution, which meets the endocrine disruption criteria as assessed by the EFSA [42]. This, in turn, could possible lead to the exclusion of this active substance from the market and therefore to the control of Sclerotinia stem rot.

When considering the azoles, mefentrifluconazole and metconazole were effective even at lower doses (Figure 4a,b). Yet, all azoles reached inhibition rates between 84 and 100% at a concentration of 10 µg a.s. mL⁻¹ (Figure 4e). This is in line with findings from the baseline study on S. sclerotiorum isolates collected in field sites in Germany by Zamani-Noor, where the azoles prothioconazole and tebuconazole were tested [1]. Azoles appear most effective against S. sclerotiorum, and in 2019, 30% of the fungicides used in the rapeseed segment relied on azoles [43]. However, shifts in sensitivities against azoles are described for several pathogens like Zymoseptoria tritici [44,45] or Ramularia collo-cygni [46]. It is therefore plausible that similar shifts in sensitivity may also occur in S. sclerotiorum populations. In the current study, prothioconazole resulted in moderate to high inhibition of mycelial growth across most isolates, yet a few showed lower sensitivity, indicating possible early signs of resistance development.

To avoid the risk of resistance and preserve the efficacy of azoles, it is strongly recommended to combine them with fungicides that have a different mode of action. Such integrated strategies can help delay the onset of resistance and ensure more sustainable disease control in rapeseed-production systems.

5. Conclusions

This study expands on previous surveillance of Sclerotinia species associated with stem rot in rapeseed across Germany by assessing the aggressiveness and fungicide sensitivity of 62 isolates collected from field sites in diverse geographic regions. While S. subarctica has been sporadically reported, it was not found to be prevalent in this sampling. Differences in isolate aggressiveness and cultivar responses emphasize the need for targeted breeding and integrated management strategies. High mycelium growth inhibition values were observed for azole fungicides, while boscalid and azoxystrobin showed lower inhibition values. To sustain fungicide efficacy, integrated approaches that combine fungicides with different modes of action are necessary.

Overall, this study underscores the dynamic nature of S. sclerotiorum populations in Germany, with considerable diversity in isolate aggressiveness and cultivar responses. These findings are highly relevant for breeding programs, as resistance improvement requires consideration of pathogen variability. At the same time, continuous monitoring of pathogen aggressiveness and fungicide sensitivity remains essential to inform integrated management strategies that reduce resistance development and minimize economic losses in rapeseed production.