Next Article in Journal
Correction: Wan et al. Design and Performance Testing of a Multi-Variety Forage Grass Mixed-Sowing Seed Metering Device. Agriculture 2025, 15, 1788
Previous Article in Journal
Mechanism Analysis of Soil Disturbance in Sodic Saline–Alkali Soil Tillage Based on Mathematical Modeling and Discrete Element Simulation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 17
10.3390/agriculture15171887
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Comparative Analysis of Genetic Effects of 2Ns Chromosome Introgression from Psathyrostachys huashanica and Leymus mollis into Common Wheat

by
Yuhui Pang
1,†,
Jiaojiao Li
1,†,
Wenjie Huo
1,
Xueyou Hua
1,
Jiayi Yuan
1,
Xicheng Tang
1,
Huanhuan Yang
1,
Chongyang Jia
1,
Jiachuang Li
1,* and
Jixin Zhao
2,*
1
College of Agronomy, Henan University of Science and Technology, Luoyang 471023, China
2
College of Agronomy, Northwest A&F University, Xianyang 712100, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this study.
Agriculture 2025, 15(17), 1887; https://doi.org/10.3390/agriculture15171887
Submission received: 27 July 2025 / Revised: 22 August 2025 / Accepted: 28 August 2025 / Published: 5 September 2025
(This article belongs to the Section Crop Genetics, Genomics and Breeding)
Browse Figures
Versions Notes

Abstract

Psathyrostachys huashanica (2n = 2x = 14, NsNs) and Leymus mollis (2n = 4x = 28, NsNsXmXm) are important wild relatives of common wheat. The Ns chromosomes from two species have been successfully introgressed into wheat through distant hybridization. To compare the genetic effects and evolutionary relationship of Ns chromosomes from different genera in a wheat background, wheat-P. huashanica derivative WH15 and wheat-L. mollis derivative WM14-2 were selected. Sequential FISH-GISH showed that both WH15 and WM14-2 contained 40 wheat chromosomes (with 2D deletion) and two Ns chromosomes with different FISH karyotypes. Molecular markers and SNP array analysis revealed that the two lines both introduced 2Ns chromosomes. However, the P. huashanica 2Ns and L. mollis 2Ns had distinct sequence compositions, and the different SNPs between the two species 2Ns chromosomes were primarily clustered on the short arm. WH15 and WM14-2 exhibited significant differences in spike-related morphologies but shared leaf rust resistance and susceptibility to powdery mildew and Fusarium head blight. Cytogenetic analysis confirmed stable meiotic inheritance of the introduced 2Ns chromosomes. We further developed universal diagnostic markers for 2Ns chromosomes based on SLAF-seq. Therefore, substantial divergence likely exists between the Ns genomes of P. huashanica and L. mollis, and P. huashanica is probably not the direct Ns genome donor for Leymus. Our research-developed derivatives provide unique resources for comparative studies of the structural and functional evolution of homoeologous Ns chromosomes across genera, while offering valuable alleles for wheat improvement.

1. Introduction

Common wheat (Triticum aestivum L; 2n = 6x = 42, AABBDD) supplies 20% of the global population’s protein and energy requirements, making its stable and high yield production crucial for worldwide food security [1]. However, the excessive focus on yield improvement in earlier breeding programs has led to high genetic homogeneity among wheat cultivars [2,3]. Moreover, the intensive use of pesticides and chemical fertilizers has accelerated pathogen evolution, resulting in the emergence of new virulent races. These factors have collectively contributed to the current ‘bottleneck period’ in wheat breeding [4,5]. Wild relatives of wheat have evolved under diverse environmental pressures and accumulated a rich reservoir of beneficial alleles [6,7]. To date, successful hybridization with wheat has been reported for all genera in the Triticeae except for Crithopsis delileana (Schult.) Roshev., Deschampsia caespitosa (Linn.) Beauv, Anomianthus Zoll., Schnabelia Hand. Mazz., and Arrhenatherum elatius var. elatius [8,9]. The introgression of elite alien genes can effectively enhance wheat genetic diversity and strengthen fundamental innovation in germplasm resources [10,11].
Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs), belonging to the genus Psathyrostachys, is a diploid self-incompatible species predominantly distributed on rocky slopes of Mount Hua in Shaanxi Province, China. This perennial grass exhibits a distinctive tufted growth habit with well-developed rhizomes. Research has demonstrated its multiple agronomically beneficial traits, particularly enhanced tolerance to abiotic stresses and resistance to biotic stresses [12]. The first successful wheat-P. huashanica hybridization was achieved by Chen et al. using F1 embryo rescue techniques; subsequent successful crosses were obtained through multiple pollination methods by Kang et al. and Kishii et al. [12].The unequal segregation and frequent loss of alien chromosomes generated numerous wheat-P. huashanica derivatives with diverse phenotypic characteristics, including some disomic addition lines, substitution lines, and translocation lines [13,14]. These studies collectively demonstrate that P. huashanica chromosome introgressions can effectively modify wheat’s agronomic performance and quality traits.
Leymus mollis Trin. (2n = 4x = 28, NsNsXmXm), a tetraploid self-incompatible species within the genus Leymus, displays outstanding agronomic features including extensive root systems, thick culms, waxy abaxial cuticles, and large spikes [15]. Research has identified exceptional stress tolerance and remarkable resistance to wheat aphids as well as significant resistance to fungal pathogens, thus positioning it as an essential genetic resource for the genetic improvement of wheat [10]. Fu et al. pioneered the development of the octoploid Tritileymus line M842 through embryo rescue techniques [16]. Subsequent advances include some wheat-L. mollis substitution lines, and addition lines were identified [16]. These achievements systematically demonstrate that L. mollis chromosome introgression substantially enhances disease resistance in recipient wheat.
The Ns genome is shared between Psathyrostachys and Leymus genera. Through chromosome pairing analysis and genomic Southern blot using repetitive sequence probes, Dewey et al. demonstrated that the Ns genome in Leymus was derived from Psathyrostachys [17]. However, among the ten recognized Psathyrostachys species, the precise donor species remains undetermined [14]. P. huashanica occupies a derived evolutionary position within the genus, exhibiting a unique 2A karyotype (vs. the 1A karyotype in other congeners), and it has distinctive morphological characteristics compared to other Psathyrostachys species [12]. These phylogenetic and cytogenetic differentiators make P. huashanica a particular candidate for investigating its potential role as the Ns genome donor to Leymus. Therefore, the key questions remain: do the Ns chromosomes from these two genera exhibit the same genetic effects when introduced into a wheat background? Is P. huashanica the actual donor species of the Ns genome in Leymus?
This study utilized a newly developed wheat-P. huashanica derivative and wheat-L. mollis derivative as experimental materials. Through molecular cytogenetic approaches, the research aimed to (1) identify target alien homologous derivatives and (2) compare the major differences of Ns chromosomes from different genera and their effects on wheat agronomic traits. The investigation sought to elucidate the phylogenetic relationship between P. huashanica and L. mollis, thereby facilitating breeding applications.

2. Materials and Methods

2.1. Plant Materials

The experimental materials included P. huashanica, L. mollis, common wheat 7182, wheat-P. huashanica derivative WH15, and wheat-L. mollis derivative WM14-2, with Chinese Spring and tetraploid wheat D4286 serving as controls. All materials were cultivated at the experimental farm of Henan University of Science and Technology using a randomized complete block design with three replicates, featuring a 1.2 m row length, 0.2 m plant spacing, and 0.25 m row spacing. Agronomic traits and disease resistance were evaluated during the 2021–2024 growing seasons. The grown environment was a warm temperate, sub-humid monsoon climate, with an annual average temperature of about 14.6 °C and an annual average precipitation of approximately 580–630 mm. The average value of the statistical data over four years is used for analysis.

2.2. Chromosome Preparation and Observation

For harvesting root tips, the kernels were germinated on a germinator at 27 °C. The tips were collected when roots reached 2 cm in length and fixed in Carnoy’s fixative I. Root tip tissues were digested using an enzyme mixture containing 2% cellulase and 1% pectinase at 37 °C for 55 min, followed by chromosome preparation via the drop method for microscopic examination of chromosome numbers [18]. Young spikes were sampled when the distance between the flag leaf and penultimate leaf was approximately 6 cm, fixed in Carnoy’s fixative II, and stained with 1% acetocarmine solution [19]. Chromosome behavior during pollen mother cell meiosis was then analyzed using the squash method under microscopy.

2.3. In Situ Hybridization (FISH/GISH) Analysis

Genomic DNA was extracted from test materials using the PVP-40 method [20]. For genomic in situ hybridization (GISH), the P. huashanica genomic DNA was labeled with Dig-Nick-Translation Mix (NO. 11745808910, Roche Group, Basel, Switzerland) and hybridized to slides with well-preserved mitotic/meiotic phases [21]. For oligonucleotide-based FISH, the following probes were used: pTa535-1, pSc119.2, HS-TZ3, and HS-TZ4 (Sangon Biotech Co., Ltd., Shanghai, China). The probe was dissolved in 1× TE buffer to 20 ng/uL. Each slide added the probe mixture (each probe, 2 uL, was added to 1× TE to make a 10 uL system) and was arranged in a moisturizing black box at 43 °C for more than 4 h. Then slides were immersed in a 2× SSC buffer to make a coverslip, which was used to counterstain the chromosomes. Sequential FISH-GISH was performed by stripping fluorescence signals with 70% ethanol on the same slides [18,22,23]. Chromosomes were observed under a ZEISS fluorescence microscope (ZEISS Imager M1, Carl Zeiss AG, Baden-Württemberg, Germany), and karyotypes were analyzed using ZEN software (Version 2.3, Carl Zeiss AG, Baden-Württemberg, Germany).

2.4. Molecular Marker Analysis

PCR amplification was performed using 128 expressed sequence tag–sequence tagged site (EST-STS) primers distributed across all seven homoeologous chromosome groups and 385 simple sequence repeat (SSR) markers (including xgdm, xcfd, xwmc, and barc series) spreading over 21 wheat chromosomes [16]. Polymerase chain reactions (PCR) were conducted using 2 × FastTaq PCR mix with dye (NO. B639295, Sangon Biotech Co., Ltd., Shanghai, China). The PCR performed followed the normal three steps: 94 °C, 5 min; (94 °C, 40 s; Tm °C, 40 s; and 72 °C, 1 min) ×30 cycles; and 72 °C, 10 min. The PCR products of SCAR markers were photoed by ultraviolet gel imaging system (BIO-RAD chemiDoc XRS+, ImageLab System Company, Hercules, CA, USA). The products of the markers separated and visualized used 8% polyacrylamide electrophoresis and were combined with silver staining.

2.5. K SNP Array Analysis

Genotyping of the materials was conducted using the Illumina Wheat 55K infinium SNP array (China Golden Marker Biotechnology Co., Ltd., Beijing, China). Bi-allelic SNPs with a missing data rate less than 15% and a minor allele count greater than three were kept for analyses. Data analysis included statistical evaluation of missing and heterozygous SNP genotypes across chromosomes (heterozygosity rate = The number of heterozygous genotypes/Total SNP marker number; Missing rate = The number of NA genotypes/Total SNP marker number). Density plots of missing SNPs were generated using the online bioinformatics platform (http://www.bioinformatics.com.cn, accessed on 14 October 2024). Differential SNPs between target Ns chromosomes were physically mapped and visualized using MapChart (Version 2.32, Wageningen University & Research, Wageningen, The Netherlands), employing a 1 Mb sliding window for density analysis. All analyses applied strict quality controls, with reference to the IWGSC RefSeq v2.1 genome assembly for physical positioning.

2.6. Agronomic Trait and Disease Resistance Evaluation

The study investigated six morphological traits in the test materials. Grain quality parameters were measured using a near-infrared grain analyzer (DA7250, Perten Company, Stockholm, Switzerland). Total nitrogen (N) and phosphorus (P) content in grains were determined with a continuous flow analyzer (AA3, Bran Luebbe Instruments, Hamburg, Germany). Additionally, the micronutrient content in grains was quantified following the method described by Ren et al. [24]. Five plants were randomly selected from each material for data collection.
At the jointing stage, plants were artificially inoculated with a mixture of Puccinia triticina f. sp. tritici (Ptt) races PHKS, PHST, and PHTT by applying the spore suspension to flag leaves after rainfall. During the flowering stage, infection types (ITs) were referenced to Kruppa et al. using the 0–4 scale [18]. Five plants were investigated for each material.
The highly virulent Blumeria graminis f. sp. tritici (Bgt) race E09 was used as the inoculum source. Chinese Spring seedlings served as the fungal propagation hosts, with spores mass-produced on their leaves. Mechanical inoculation by gently rubbing leaves with a spore suspension. During the flowering stage, disease response was assessed following the An et al. classification system, where four leaves per plant (flag leaf and three lower leaves) were examined [25]. Resistance levels were categorized into six grades (near-immune (IM), highly resistant (HR), moderately resistant (MR), moderately susceptible (MS), highly susceptible (HS), and very highly susceptible (VHS)) based on the percentage of leaf area covered by powdery mildew colonies. Five plants were investigated for each material.
The Fusarium graminearum strain ZJU-Fhb1 was activated and cultured to an optimal concentration of 1 × 105 spores/mL in a sterile 0.01% Tween-20 solution. At the flowering stage, ten randomly selected spikes per material were inoculated using the single-floret injection method, where 10 μL of spore suspension was injected into the basal floret of central spikelets. Inoculated spikes were immediately covered with moistened plastic bags for 72 h to maintain >95% humidity. Disease severity was evaluated 21 days post-inoculation [26].

2.7. Development of Species-Specific SCAR Markers

Genomic DNA (gDNA) from the experimental materials was subjected to simplified genome sequencing (SLAF) (Biomarker Technologies Co., Ltd., Beijing, China). The SLAF-tags obtained from WH15 were aligned against the Chinese Spring reference genome (IWGSC RefSeq v1.0), and sequences with 0% similarity were extracted and compiled into a FASTA database. These sequences were then compared with the L. chinensis (2n = 4x = 28, NsNsXmXm) genome to identify those with 100% similarity, which were considered P. huashanica-specific sequences in WH15. The same procedure was applied to WM14-2 to isolate L. mollis-specific sequences. Finally, the alien chromosome-specific sequences from both derivatives were cross-referenced to identify 100% conserved sequences, which served as the basis for designing universal SCAR markers targeting the Ns chromosomes.

3. Results

3.1. In Situ Hybridization

Wheat-P. huashanica derivative WH15 and wheat-L. mollis derivative WM14-2 were confirmed to possess 42 chromosomes. GISH revealed the presence of two Ns chromosomes in both WH15 and WM14-2 (Figure 1a,b). Subsequent FISH on the same slides identified 40 wheat chromosomes in both derivatives with confirmed loss of 2D chromosomes (Figure 1c,d). The two Ns chromosomes identified by GISH fluorescence exhibited distinct hybridization patterns in FISH analysis. Specifically, the P. huashanica-derived Ns chromosomes in WH15 showed no detectable signals with conventional wheat probes, while the L. mollis-derived Ns chromosomes in WM14-2 displayed clear fluorescent hybridization signals at both terminal regions of the long and short arms. Instead, FISH using P. huashanica-specific oligo probes set of HS-TZ3 + HS-TZ4 revealed telomeric hybridization signals on the Ns chromosomes of WH15 but no signals on those of WM14-2 (Figure 1e,f). These results demonstrate that the alien Ns chromosomes in the two derivative lines possess markedly different FISH karyotypes when analyzed with different probe systems.

3.2. Molecular Marker Analysis

Six SSR markers specific to chromosome 2D amplified characteristic D-genome bands in the wheat parent 7182 but failed to produce target fragments in both derivatives and tetraploid wheat D4286 (Figure 2a). The finding confirmed the complete absence of 2D in WM15 and WH14, which was consistent with the evidence of FISH karyotype.
The EST-STS markers distributed on the 2rd homoeologous group amplified Ns-chromosome-specific fragments in WM15, WH14-2, P. huashanica, and L. mollis but not in the wheat parent line 7182. In addition, five pairs of markers generated conserved amplification profiles between the derivatives and their respective alien donors (Figure 2b). Three pairs of markers exhibited specific amplification only in WH15 and P. huashanica (Figure 2c), while one marker showed unique amplification in WM14-2 and L. mollis (Figure 2d). These evidences collectively demonstrate that WH15 and WM14-2 carry different 2Ns chromosomes originating from P. huashanica and L. mollis, respectively, and indicate the substantial sequence divergence between Ns genomes.

3.3. K SNP Array Genotyping

In 55K SNP array analysis, 49,079 high-quality polymorphic SNPs were retained to analyze chromosomal composition differences between WM15 and WH14-2. Pairwise genotype comparisons revealed significant synteny between the substitution lines and their respective donor species on chromosome 2D: WH15 showed 89.2% allelic concordance with P. huashanica (Figure 3a), while WM14-2 exhibited 87.6% concordance with L. mollis (Figure 3b). Chromosome-wide mapping of nullisomic/heterozygous SNPs demonstrated elevated frequencies on 2D in both lines (Figure 3c,d), confirming their status as 2Ns (2D) disomic substitution lines. Physical mapping of divergent SNPs revealed an asymmetric distribution pattern, with 68.3% of polymorphic markers clustered on the short arm of 2Ns (Figure 3e), indicating that the substantial structural divergence between the introduced P. huashanica 2Ns and L. mollis 2Ns chromosomes primarily involved the 2NsS.

3.4. Comparison of Agronomic Traits and Disease Resistance

To further investigate genetic effects of the introduced 2Ns chromosomes from different genera into the wheat recipient, we evaluated major agronomic traits and disease resistance in WH15 and WM14-2. The plant height of both WH15 and WM14-2 was comparable to their parental lines (Figure 4a and Table 1). However, distinct morphological differences were observed: WH15 exhibited a dispersion-plant-type growth habit with increased tiller number, whereas WM14-2 displayed an erect plant architecture. Spike morphology revealed significant increases in length for both substitution lines compared to the wheat parent 7182 (Figure 4b). Notably, WM14-2 developed additional rachis branches at the lower sections of the main spike axis, resulting in more spikelets and grains (Figure 4c). Furthermore, WM14-2 demonstrated superior grain traits, including greater grain length and higher thousand-kernel weight than both WH15 and the parental line 7182 (Figure 4d).
Based on the susceptible control Chinese Spring (CS), we assessed the resistance responses of the materials to wheat, via mainly diseases from artificial inoculation assays. The results demonstrated distinct disease response patterns: In leaf rust resistance, both substitution lines exhibited high resistance (Figure 5a), with infection types (IT) scored as follows: CS, IT = 4 (susceptible); 7182, IT = 3 (moderately susceptible); WH15, IT = 0; (nearly immune); and, WM14-2, IT = 0; (nearly immune). In powdery mildew susceptibility, all materials showed susceptibility (Figure 5b), with disease severity graded as follows: CS = HS (highly susceptible); 7182 = MS (moderately susceptible); WH15 = MS; and WM14-2 = MS. In the Fusarium head blight response, the susceptibility levels of all materials were (Figure 5c) as follows: CS = HS; 7182 = HS; WH15 = HS; and WM14-2 = MS.
An explanation of the grain quality parameters of the two derivatives showed in Table 2 is as follows: Compared to WH15 and parental line 7182, WM14-2 exhibited a moderately increased total protein and wet gluten content. These results indicate that the introduction of alien 2Ns chromosomes did not substantially improve grain quality traits in either WH15 or WM14-2. Mineral nutrient analysis (Table 3) revealed significantly enhanced concentrations of essential nutrients in both substitution lines compared to 7182. Specifically, WH15 and WM14-2 showed elevated levels of copper (Cu), iron (Fe), potassium (K), magnesium (Mg), manganese (Mn), phosphorus (P), and zinc (Zn); WH15 particularly outperformed WM14-2 in K, Mg, P, and Zn accumulation. These findings demonstrate that the introduced 2Ns chromosomes exert significant positive effects on grain mineral nutrient profiles, with WH15 showing superior nutrient enrichment capabilities.

3.5. Analysis of Genetic Stability

GISH analysis of key meiotic stages in WH15 and WM14-2 revealed high cytogenetic stability of the introduced 2Ns chromosomes. During metaphase I, both lines exhibited a single ring bivalent with distinct yellow-green fluorescent signals (Figure 6a,b), confirming that the Ns chromosomes in two derivatives were homologous chromosomes and underwent normal synapsis. At anaphase I, the bivalent separated synchronously with wheat chromosomes, with the 2Ns chromosomes migrating properly to the poles (Figure 6c,d). Tetrad-stage analysis demonstrated successful transmission of the fluorescently labeled 2Ns chromosomes to microspores in both WH15 and WM14-2 (Figure 6e,f). The consistent presence of intact 2Ns chromosomes introduced from two genera through multiple meiotic cycles confirms their high genetic stability in the wheat background.

3.6. Development of 2Ns-Specific Molecular Markers

SLAF-seq (Specific-Locus Amplified Fragment sequencing) analysis identified 24,964 P. huashanica-specific and 39,372 L. mollis-specific SLAFs in WH15 and WM14-2, respectively, with an average length of 150 base pairs (bp). From 200 conserved 2Ns chromosome sequences shared by both lines, we developed three validated SCAR markers (H2SLAF-241638, H2SLAF-3244129, and B2SLAF-10313) that specifically amplified diagnostic bands in the substitution lines and their alien donors but not in wheat parent 7182 (Table 4 and Figure 7), providing reliable molecular tools for the rapid identification of 2Ns introgression lines and marker-assisted breeding.

4. Discussion

4.1. Evolutionary Analysis of the Origin of the Ns Genome in Leymus

Early single-celled organisms evolved at a slow pace until the Cambrian explosion triggered a remarkable diversification of life forms [27]. Throughout evolutionary history, life has flourished through two fundamental mechanisms: divergent evolution driving species diversification and horizontal gene transfer creating unexpected genetic similarities between distantly related taxa [28,29]. Over 80% of the Triticeae genome consists of repetitive sequences, with strong synteny observed in chromosomal arrangements across different species within the tribe [30]. These genomic characteristics provide the genetic foundation for successful wide hybridization among Triticeae species, enabling the transfer of valuable agronomic traits across species barriers [31,32].
Species in Psathyrostachys and Leymus genera both contain the Ns genome, with studies showing Ns genome in Leymus originated from Psathyrostachys [33], and the Xm genome potentially also evolving from Ns [34,35]. Leymus chinensis (Trin. ex Bunge) Tzvelev genome sequencing revealed Ns and Xm subgenomes diverged 167.9 mya [15]. However, lacking Psathyrostachys reference genomes has hindered Ns chromosome comparisons between these genera. To investigate whether Ns chromosomes from P. huashanica and L. mollis (homoeologous group 2) produce different genetic effects in wheat, we developed wheat-P. huashanica and wheat-L. mollis 2Ns (2D) substitution lines basing on the cultivar 7182 background for molecular cytogenetic comparisons. This study supports previous conclusions through GISH experiments, confirming that the Ns genome in Leymus indeed originated from Psathyrostachys. However, based on chromosomal FISH karyotyping, molecular marker identification, and genetic effect analysis, significant differences were observed between the 2Ns chromosomes derived from Psathyrostachys and Leymus. Therefore, we think the donor species is unlikely to be P. huashanica but may instead be another species within Psathyrostachys.

4.2. Sequence Divergence in Ns Chromosomes Between the Two Genera

In situ hybridization is a critical cytogenetic technique [36]. GISH confirmed both WH15 and WM14-2 contain 40 wheat chromosomes plus 2Ns chromosomes. Using two probe sets (pSc119.2 and pTa535 from rye repetitive sequence and HS-TZ3 and HS-TZ4 from P. huashanica repetitive sequence) [22], FISH revealed distinct karyotypes on the 2Ns chromosomes, indicating significant differences in repetitive sequences between Psathyrostachys and Leymus Ns chromosomes, contradicting Dewey’s earlier findings [17]. Comparative FISH analysis using universal probes revealed distinct repetitive sequence distributions on homoeologous group 2 chromosomes in Figure 8 [23,37,38,39]. The 2Ns chromosome of L. mollis and wheat 2A showed pTa535-enriched regions at the short arm termini, whereas wheat 2B/2D, rye 2R, and barley 2H predominantly contained pSc119.2 repeats at these loci. Long arm distributions varied significantly across genomes. However, P. huashanica 2Ns displayed unique characteristics: absence of these common repeats but exclusive presence of species-specific signals of HS-TZ3 + HS-TZ4, which were undetectable on other chromosomes. These FISH karyotypes demonstrate substantial divergence between P. huashanica and L. mollis Ns genomes.
Molecular markers serve as efficient tools for identifying alien chromosomes in wheat [21]. SSR markers detect wheat chromosome deletions, while co-dominant EST-STS markers determine homoeologous groups [16]. For instance, a wheat-L. mollis 4Ns (4D) substitution line was successfully identified using SSR and PCR-based landmark unique gene (PLUG) markers [16]. In this study, the absence of D-genome specific SSR bands in WM15 and WH14-2 confirmed 2D chromosome deletions, consistent with FISH results. Especially, although group 2 EST-STS markers could verify 2Ns chromosome introgression, their amplification patterns differed between the two derivatives, reflecting genetic divergence in the introgressed segments from distinct genera.
SNP markers, as high-throughput genomic tools, are primarily used for target gene mapping due to their high density. Bai et al. characterized a major QTL (68.8–70.1 Mb) conferring high resistance to take-all disease on chromosome 2A using SNP analysis, while Zhu et al. identified a wheat- Secale Baili 6RL translocation line through SNP genotyping [12,40]. Today, the 55K SNP array not only determined the genetic composition of derivatives WH15 and WM14-2, but also revealed abundant distinguishing SNPs concentrated on the 2Ns short arms, providing valuable references for investigating sequence divergence between the Ns chromosomes of different genera.

4.3. Introducing 2Ns Chromosome-Mediated Trait Improvement in Wheat

Genetic differences are often manifested phenotypically [41], as exemplified by the blue grains in wheat-Thinopyrum ponticum (Podp.) 4Ag addition lines [42] and the improved processing quality of wheat-Aegilops geniculata Roth. 1Ug additions under specific conditions [43]. The wheat-Dasypyrum villosum L. 6V translocation also confers wheat streak mosaic virus resistance [44]. In this study, the introduced 2Ns chromosomes caused significant phenotypic alterations: WM14-2 developed branched spikes (a Leymus trait), while WH15 accumulated higher mineral content (a Psathyrostachys trait). This phenomenon may be attributed to superior variations that became fixed during the evolution of the two genera 2Ns chromosomes, which can be stably expressed when inherited by progeny. Both lines exhibited elongated spikes and leaf rust resistance, suggesting conserved genes on 2Ns chromosomes. However, their distinct spike/grain morphologies reflect genus-specific genomic differentiation, while maintaining adaptive and yield-related genes through selection pressure.
Although this study demonstrates that the 2Ns chromosomes from Psathyrostachys and Leymus can induce distinct phenotypic variations and carry conserved resistance genes in wheat, certain limitations should be acknowledged. Firstly, the lack of high-quality reference genomes for species in these two genera makes it difficult to correlate the repetitive sequence differences observed in FISH karyotypes with specific genomic loci, nor can we precisely identify key genes controlling traits such as branched spikes and mineral accumulation. Secondly, since the field evaluation was conducted at only a single location, we were unable to assess the stability of these beneficial traits introgressed from alien chromosomes across diverse environments or their potential genotype-by-environment interactions. Future research should prioritize the development of complete reference genomes, which would provide an essential framework for in-depth molecular analysis of Ns genome evolutionary dynamics and facilitate rapid cloning of beneficial genes derived from 2Ns chromosomes. Concurrently, large-scale phenotypic evaluations of wheat-2Ns derived lines across multiple locations and growing seasons are necessary to verify trait expression stability and comprehensively assess their potential applications and risks in wheat breeding programs. Finally, the development of small segment translocation lines carrying target traits through radiation-induced mutagenesis, CRISPR RNA-guided integrases [45], and other methods will accelerate breeding applications.

5. Conclusions

In this study, we successfully developed and characterized two wheat-alien derivatives: wheat-P. huashanica 2Ns (2D) substitution line WH15 and wheat-L. mollis 2Ns (2D) substitution line WM14-2, which represent valuable additions to wheat germplasm resources. Comparative analyses revealed substantial differences between these Ns chromosomes in both molecular cytogenetic characteristics and agronomic performance when introgressed into common wheat. Specifically, in different FISH karyotypes in chromosomal terminal regions, most differential SNPs clustered on the short arm, and there were significant differences in spike-related morphologies. A different sequence composition and genetic effects suggest P. huashanica is probably not the direct Ns genome donor for L. mollis. The development of 2Ns-specific molecular markers facilitates marker-assisted breeding applications. Future research will focus on identifying long spike and high mineral content genes located on the 2Ns chromosomes and creating smaller 2Ns segmental translocation lines with outstanding traits to enable the precise utilization of Ns chromatin for wheat improvement, while elucidating evolutionary relationships among Triticeae.

Author Contributions

Conceptualization, J.L. (Jiachuang Li) and J.Z.; formal analysis, J.Y., X.T., H.Y. and C.J.; investigation, Y.P., J.L. (Jiaojiao Li), W.H. and X.H.; writing—original draft, Y.P. and J.L. (Jiaojiao Li); writing—review and editing, J.L. (Jiachuang Li) and J.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the China Postdoctoral Science Foundation (2025M773998), the Postdoctoral Fellowship Program of CPSF (GZC20240426), the Natural Science Foundation of Henan Province (232300420200), the Key Research and Development Program of Henan (242102111142), and the Key Research and Development Program of Shaanxi (0105679005 and 2019ZDLNY04-06).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

The following abbreviations are used in this manuscript:
bpBase pairs
CSChinese Spring
DAPI4′,6-diamidino-2-phenylindole
EST-STSExpressed sequence tag–sequence tagged site
FISHFluorescence in situ hybridization
GISHGenomic in situ hybridization
HRHighly resistant
HSHighly susceptible
IMNear-immune
ITImmunity type
L. mollisLeymus mollis
MRModerately resistant
MSModerately susceptible
PCRPolymerase chain reaction
P. huashanicaPsathyrostachys huashanica
PIPropidium iodide
PLUGPCR-based landmark unique gene
VHSVery highly susceptible
SCARSequence-characterized amplified region
SLAF-seqSimplified genome sequencing
SNPSingle nucleotide polymorphism
SSRSimple sequence repeat

References

  1. Xiao, J.; Liu, B.; Yao, Y.Y.; Guo, Z.F.; Jia, H.Y.; Kong, L.R.; Zhang, A.M.; Ma, W.J.; Ni, Z.F.; Xu, S.B.; et al. Wheat genomic study for genetic improvement of traits in China. Sci. China Life Sci. 2022, 65, 1718–1775. [Google Scholar] [CrossRef]
  2. Tian, X.B.; Wang, Z.Y.; Liu, W.X.; Zhao, Y.S. Harness the wild: Progress and perspectives in wheat genetic improvement. J. Genet. Genom. 2025, in press. [Google Scholar] [CrossRef] [PubMed]
  3. Han, G.H.; Yan, H.W.; Li, L.H.; An, D.G. Advancing wheat breeding using rye: A key contribution to wheat breeding history. Trends Biotechnol. 2025, in press. [CrossRef] [PubMed]
  4. Yao, Y.Y.; Guo, W.L.; Gou, J.Y.; Hu, Z.R.; Liu, J.; Ma, J.; Zong, Y.; Xin, M.M.; Chen, W.; Li, Q.; et al. Wheat2035: Integrating pan-omics and advanced biotechnology for future wheat design. Mol. Plant 2025, 18, 272–297. [Google Scholar] [CrossRef] [PubMed]
  5. Li, H.H.; Men, W.Q.; Ma, C.; Liu, Q.W.; Dong, Z.J.; Tian, X.B.; Wang, C.L.; Liu, C.; Gill, H.S.; Ma, P.T.; et al. Wheat powdery mildew resistance gene Pm13 encodes a mixed lineage kinase domain-like protein. Nat. Commun. 2024, 15, 2449. [Google Scholar] [CrossRef] [PubMed]
  6. Li, Y.H.; Govta, L.b.; Sung, Y.C.; Coaker, G.; Fahima, T. The spectrum of diverse disease-resistance genes cloned and characterized in the Triticeae Tribe. Annu. Rev. Phytopathol. 2025, in press. [Google Scholar] [CrossRef]
  7. Singh, R.P.; Hodson, D.P.; Singh, P.K.; Lan, C.; He, X.; Lagudah, E.S.; Juliana, P.; Ayliffe, M.; Bhavani, S.; Saunders, D.G.O.; et al. Challenges to wheat disease resistance and current global strategies. Annu. Rev. Phytopathol. 2025, in press. [Google Scholar] [CrossRef]
  8. Han, G.H.; Liu, H.; Zhu, S.Y.; Gu, T.T.; Cao, L.J.; Yan, H.W.; Jin, Y.; Wang, J.; Liu, S.Y.; Zhou, Y.L.; et al. Two functional CC-NBS-LRR proteins from rye chromosome 6RS confer differential age-related powdery mildew resistance to wheat. Plant Biotechnol. J. 2024, 22, 66–81. [Google Scholar] [CrossRef]
  9. Liu, C.; Ran, H.; Xiaolu, W.; Gong, W.P.; Cheng, D.G.; Cao, X.Y.; Liu, A.F.; Li, H.S.; Liu, J.J. Research progress of wheat wild hybridization, disease resistance genes transfer and utilization. Sci. Agric. Sin. 2020, 53, 1287–1308. [Google Scholar]
  10. Subbarao, G.V.; Kishii, M.; Bozal-Leorri, A.; Ortiz-Monasterio, I.; Gao, X.; Ibba, M.I.; Karwat, H.; Gonzalez-Moro, M.B.; Gonzalez-Murua, C.; Yoshihashi, T.; et al. Enlisting wild grass genes to combat nitrification in wheat farming: A nature-based solution. Proc. Natl. Acad. Sci. 2021, 118, e2106595118. [Google Scholar] [CrossRef]
  11. Wang, H.W.; Sun, S.L.; Ge, W.Y.; Zhao, L.F.; Kong, L.R. Horizontal gene transfer of Fhb7 from fungus underlies Fusarium head blight resistance in wheat. Science 2020, 368, eaba5435. [Google Scholar] [CrossRef]
  12. Li, Y.H.; Tan, B.W.; Yang, J.Y.; Zhang, H.; Zhu, W.; Xu, L.L.; Cheng, Y.R.; Wang, Y.; Zeng, J.; Sha, L.; et al. Integrated review of Psathyrostachy huashanica: From phylogenetic research to wheat breeding application. Mol. Breed. 2025, 45, 42. [Google Scholar] [CrossRef]
  13. Tan, B.W.; Zhao, L.; Li, L.Y.; Zhang, H.; Zhu, W.; Xu, L.L.; Wang, Y.; Zeng, J.; Fan, X.; Sha, L.N.; et al. Identification of a wheat-Psathyrostachys huashanica 7Ns ditelosomic addition line conferring early maturation by cytological analysis and newly developed molecular and FISH markers. Front. Plant Sci. 2021, 12, 784001. [Google Scholar] [CrossRef]
  14. Liu, Y.X.; Huang, S.H.; Han, J.; Hou, C.C.; Zheng, D.S.; Zhang, Z.M.; Wu, J. Development and molecular cytogenetic identification of a new wheat–Psathyrostachys huashanica Keng translocation line resistant to powdery mildew. Front. Plant Sci. 2021, 12, 1127. [Google Scholar] [CrossRef] [PubMed]
  15. Li, T.; Tang, S.J.; Li, W.; Zhang, S.B.; Wang, J.L.; Pan, D.F.; Lin, Z.L.; Ma, X.; Chang, Y.N.; Liu, B.; et al. Genome evolution and initial breeding of the Triticeae grass Leymus chinensis dominating the Eurasian Steppe. Proc. Natl. Acad. Sci. 2023, 120, e2308984120. [Google Scholar] [CrossRef]
  16. Du, X.; Feng, X.B.; Li, R.X.; Jin, Y.L.; Shang, L.H.; Zhao, J.X.; Wang, C.Y.; Li, T.D.; Chen, C.H.; Tian, Z.R.; et al. Cytogenetic identification and molecular marker development of a novel wheat-Leymus mollis 4Ns(4D) alien disomic substitution line with resistance to stripe rust and Fusarium head blight. Front. Plant Sci. 2022, 13, 1012939. [Google Scholar] [CrossRef]
  17. Dewey, D.R. Genome relations among diploid Elymus junceus and certain tetraploid and octoploid Elymus species. Am. J. Bot. 1970, 57, 633–639. [Google Scholar] [CrossRef]
  18. Kruppa, K.; Türkösi, E.; Holušová, K.; Kalapos, B.; Szakács, É.; Cséplő, M.; Farkas, A.; Ivanizs, L.; Szőke-Pázsi, K.; Mikó, P.; et al. Genotyping-by-sequencing uncovers a Thinopyrum 4StS·1JvsS Robertsonian translocation linked to multiple stress tolerances in bread wheat. Theor. Appl. Genet. 2024, 138, 13. [Google Scholar] [CrossRef]
  19. Dolezel, J.; Lucretti, S.; Molnár, I.; Cápal, P.; Giorgi, D. Chromosome analysis and sorting. Cytom. Part A 2021, 99, 328–342. [Google Scholar] [CrossRef] [PubMed]
  20. Santos, M.E.A.H.P.; Rodrigues, M.S.; Siqueira, W.J.; Marques, M.O.M.; Mondego, J.M.C. Comparative analysis indicates a simple protocol for DNA extraction of the aromatic plant Lippia alba. Anal. Biochem. 2023, 675, 115225. [Google Scholar] [CrossRef]
  21. Kuang, Z.Y.; Ji, X.J.; Xu, S.R.; Han, H.M.; Zhang, J.P.; Zhou, S.H.; Yang, X.M.; Li, X.Q.; Li, L.H.; Liu, W.H. Generation and identification of a wheat–Agropyron cristatum (L.) Gaertn. 3P chromosome addition line and substitution line. Euphytica 2023, 219, 23. [Google Scholar] [CrossRef]
  22. Li, J.C.; Li, J.J.; Zhao, L.; Zhao, J.X.; Wu, J.; Chen, X.H.; Zhang, L.Y.; Dong, P.H.; Wang, L.M.; Zhao, D.H.; et al. Rapid identification of Psathyrostachys huashanica Keng chromosomes in wheat background based on ND-FISH and SNP array methods. J. Integr. Agric. 2023, 22, 2–16. [Google Scholar] [CrossRef]
  23. Tang, Z.X.; Yang, Z.J.; Fu, S.L. Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa–535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J. Appl. Genet. 2014, 55, 313–318. [Google Scholar] [CrossRef]
  24. Ren, P.X.; Zhao, D.H.; Zeng, Z.K.; Yan, X.F.; Zhao, Y.; Lan, C.X.; Wang, C.P. Pleiotropic effect analysis and marker development for grain zinc and iron concentrations in spring wheat. Mol. Breed. 2022, 42, 49. [Google Scholar] [CrossRef]
  25. An, D.G.; Ma, P.T.; Zheng, Q.; Fu, S.L.; Li, L.H.; Han, F.P.; Han, G.H.; Wang, J.; Xu, Y.F.; Jin, Y.L.; et al. Development and molecular cytogenetic identification of a new wheat-rye 4R chromosome disomic addition line with resistances to powdery mildew, stripe rust and sharp eyespot. Theor. Appl. Genet. 2019, 132, 257–272. [Google Scholar] [CrossRef] [PubMed]
  26. Giancaspro, A.; Lionetti, V.; Giove, S.L.; Zito, D.; Fabri, E.; Reem, N.; Zabotina, O.A.; De Angelis, E.; Monaci, L.; Bellincampi, D.; et al. Cell wall features transferred from common into durum wheat to improve Fusarium Head Blight resistance. Plant Sci. 2018, 274, 121–128. [Google Scholar] [CrossRef] [PubMed]
  27. Wood, R.; Liu, A.G.; Bowyer, F.; Wilby, P.R.; Dunn, F.S.; Kenchington, C.G.; Cuthill, J.F.H.; Mitchell, E.G.; Penny, A. Integrated records of environmental change and evolution challenge the Cambrian Explosion. Nat. Ecol. Evol. 2019, 3, 528–538. [Google Scholar] [CrossRef] [PubMed]
  28. McColgan, Á.; DiFrisco, J. Understanding developmental system drift. Development 2024, 151, 203054. [Google Scholar] [CrossRef]
  29. Soucy, S.M.; Huang, J.L.; Gogarten, J.P. Horizontal gene transfer: Building the web of life. Nat. Rev. Genet. 2015, 16, 472–482. [Google Scholar] [CrossRef]
  30. Guan, J.T.; Garcia, D.F.; Zhou, Y.; Appels, R.; Li, A.L.; Mao, L. The battle to sequence the bread wheat genome: A tale of the three kingdoms. Genom. Proteom. Bioinf. 2020, 18, 221–229. [Google Scholar] [CrossRef]
  31. Zhao, L.B.; Xie, D.; Huang, L.; Zhang, S.J.; Luo, J.T.; Jiang, B.; Ning, S.Z.; Zhang, L.Q.; Yuan, Z.W.; Wang, J.R.; et al. Integrating the physical and genetic map of bread wheat facilitates the detection of chromosomal rearrangements. J. Integr. Agric. 2021, 20, 2333–2342. [Google Scholar] [CrossRef]
  32. Farooq, M.; Frei, M.; Zeibig, F.; Pantha, S.; Özkan, H.; Kilian, B.; Siddique, K.H.M. Back into the wild: Harnessing the power of wheat wild relatives for future crop and food security. J. Exp. Bot. 2025, in press. [Google Scholar] [CrossRef]
  33. Bödvarsdóttir, S.K.; Anamthawat-Jónsson, K. Isolation, characterization, and analysis of Leymus-specific DNA sequences. Genome 2003, 46, 673–682. [Google Scholar] [CrossRef]
  34. Wang, R.R.C.; Zhang, J.Y.; Lee, B.S.; Jensen, K.B.; Kishii, M.; Tsujimoto, H. Variations in abundance of 2 repetitive sequences in Leymus and Psathyrostachys species. Genome 2006, 49, 511–519. [Google Scholar] [CrossRef]
  35. Orgaard, M.; Heslop-Harrison, J.S. Relationships between species of Leymus, Psathyrostachys, and Hordeum (Poaceae, Triticeae) inferred from Southern hybridization of genomic and cloned DNA probes. Plant Syst. Evol. 1994, 189, 217–231. [Google Scholar] [CrossRef]
  36. Xiao, K.Z.; Sun, Y.N.; Zhou, S.J. Revealing the abnormal meiosis and the variation of the functional female gametes of aneuploid lily (Lilium) using genomic in situ hybridization (GISH). Euphytica 2023, 219, 108. [Google Scholar] [CrossRef]
  37. Han, G.H.; Li, H.W.; Cao, L.J.; Liu, S.Y.; Yan, H.W.; Wang, J.; Zhou, Y.L.; An, D.G. A novel wheat-rye 2R (2D) disomic substitution line pyramids two types of resistance to powdery mildew. Plant Dis. 2022, 106, 2433–2440. [Google Scholar] [CrossRef]
  38. Wang, J.; Liu, C.; Guo, X.R.; Wang, K.; Du, L.P.; Lin, Z.S.; Ye, X.G. Development and genetic analysis of wheat double substitution lines carrying Hordeum vulgare 2H and Thinopyrum intermedium 2Ai#2 chromosomes. Crop J. 2019, 7, 163–175. [Google Scholar]
  39. Song, Z.P.; Dai, S.F.; Bao, T.Y.; Zuo, Y.Y.; Yan, Z.H. Analysis of structural genomic diversity in Aegilops umbellulata, Ae. markgrafii, Ae. comosa, and Ae. uniaristata by fluorescence in situ hybridization karyotyping. Front. Plant Sci. 2020, 11, 710. [Google Scholar] [CrossRef]
  40. Zhu, S.Y.; Du, H.N.; Su, F.Y.; Wang, J.; Meng, Q.F.; Liu, T.L.; Guo, R.; Chen, Z.Z.; Li, H.H.; Liu, W.X.; et al. Molecular cytogenetic analyses of two new wheat-rye 6RL translocation lines with resistance to wheat powdery mildew. Crop J. 2023, 11, 584–592. [Google Scholar] [CrossRef]
  41. Fan, W.; Sun, M.Q.; Zheng, Y.B.; Song, S.W.; Zhang, Z.Y.; Bian, Y. Karyotypic and phenotypic condensation in allotetraploid wheats accompanied with reproductive strategy transformation: From natural evolution to domestication. Planta 2024, 260, 83. [Google Scholar] [CrossRef] [PubMed]
  42. Pei, J.W.; Wang, Z.; Heng, Y.F.; Chen, Z.; Wang, K.; Xiao, Q.M.; Li, J.; Hu, Z.R.; He, H.; Cao, Y.; et al. Selection of dysfunctional alleles of bHLH1 and MYB1 has produced white grain in the tribe Triticeae. Plant Commun. 2025, 6, 101265. [Google Scholar] [CrossRef]
  43. Guo, L.; Yu, L.W.; Tong, J.Y.; Zhao, Y.Y.; Yang, Y.; Ma, Y.R.; Cui, L.; Hu, Y.G.; Wang, Z.H.; Gao, X. Addition of Aegilops geniculata 1Ug chromosome improves the dough rheological properties by changing the composition and micro-structure of gluten. Food Chem. 2021, 358, 129850. [Google Scholar] [CrossRef]
  44. Wan, W.T.; Zhao, R.H.; Chen, T.T.; Wang, L.; Zhang, X.; Li, H.F.; Wang, X.E.; Bie, T.D. Rapid development of wheat-Dasypyrum villosum compensating translocations resistant to powdery mildew using a triple marker strategy conducted on a large ph1b-induced population. Theor. Appl. Genet. 2023, 136, 148. [Google Scholar] [CrossRef] [PubMed]
  45. Beying, N.; Schmidt, C.; Pacher, M.; Houben, A.; Puchta, H. CRISPR–Cas9-mediated induction of heritable chromosomal translocations in Arabidopsis. Nat. Plants 2020, 6, 638–645. [Google Scholar] [CrossRef] [PubMed]
Agriculture 15 01887 g001
Figure 1. Sequential FISH-GISH analysis of WH15 and WM14-2. (a,b) GISH experiment of WH15 and WM14-2. Two chromosomes with fluorescent signals (yellow-green color) were identified as Ns chromosomes. (c) Sequential FISH result using the probe set of pSc119.2 + pTa535-1 in WH15. A total of 40 wheat chromosomes could be recognized, plus two P. huashanica Ns chromosomes with no fluorescent signal. (d) Sequential FISH result of WM14-2. 40 wheat chromosomes and two L. mollis Ns chromosomes all carrying fluorescent signals. (e) FISH experiment using P. huashanica Ns-chromosome-specific oligo probe of HS-TZ3 + HS-TZ4 for WH15. Two P. huashanica chromosomes had fluorescent signals at the end of the two arms. (f) HS-TZ3 + HS-TZ4 for WM14-2. No chromosomes show hybridization signals. DAPI (blue) and PI (red) were used for counterstaining in FISH and GISH, respectively. Scale bar, 10 mm.
Figure 1. Sequential FISH-GISH analysis of WH15 and WM14-2. (a,b) GISH experiment of WH15 and WM14-2. Two chromosomes with fluorescent signals (yellow-green color) were identified as Ns chromosomes. (c) Sequential FISH result using the probe set of pSc119.2 + pTa535-1 in WH15. A total of 40 wheat chromosomes could be recognized, plus two P. huashanica Ns chromosomes with no fluorescent signal. (d) Sequential FISH result of WM14-2. 40 wheat chromosomes and two L. mollis Ns chromosomes all carrying fluorescent signals. (e) FISH experiment using P. huashanica Ns-chromosome-specific oligo probe of HS-TZ3 + HS-TZ4 for WH15. Two P. huashanica chromosomes had fluorescent signals at the end of the two arms. (f) HS-TZ3 + HS-TZ4 for WM14-2. No chromosomes show hybridization signals. DAPI (blue) and PI (red) were used for counterstaining in FISH and GISH, respectively. Scale bar, 10 mm.
Agriculture 15 01887 g001
Agriculture 15 01887 g002
Figure 2. Molecular marker analysis to confirm the genetic composition of WH15 and WM14-2. (a) Simple sequence repeat (SSR) markers analysis of derivatives. As shown by red arrows, six pairs of SSR markers on the short or long arm of the wheat 2D chromosome did not amplify 2D-chromosome-specific bands in tetraploid wheat D4286, WH15, and WM14-2. (b) Five pairs of expressed sequence tag–sequence tagged site (EST-STS) markers belonging to the 2rd homoeologous group simultaneously amplified Ns-genome-specific bands in two derivatives, P. huashanica and L. mollis. Ns-genome-specific bands are shown by black arrows. (c) Three pairs of EST-STS markers belonging to the 2rd homoeologous group amplified P. huashanica Ns-genome-specific bands only in WH15 and P. huashanica. (d) One pair of markers belonging to the 2rd homoeologous group amplified L. mollis Ns-genome-specific bands only in WM14-2 and L. mollis. Lane M, DL2000; lane 1, wheat parent 7182; lane 2, WH15; lane 3, WM14-2; lane 4, P. huashanica; lane 5, L. mollis; lane 6, tetraploid wheat D4286.
Figure 2. Molecular marker analysis to confirm the genetic composition of WH15 and WM14-2. (a) Simple sequence repeat (SSR) markers analysis of derivatives. As shown by red arrows, six pairs of SSR markers on the short or long arm of the wheat 2D chromosome did not amplify 2D-chromosome-specific bands in tetraploid wheat D4286, WH15, and WM14-2. (b) Five pairs of expressed sequence tag–sequence tagged site (EST-STS) markers belonging to the 2rd homoeologous group simultaneously amplified Ns-genome-specific bands in two derivatives, P. huashanica and L. mollis. Ns-genome-specific bands are shown by black arrows. (c) Three pairs of EST-STS markers belonging to the 2rd homoeologous group amplified P. huashanica Ns-genome-specific bands only in WH15 and P. huashanica. (d) One pair of markers belonging to the 2rd homoeologous group amplified L. mollis Ns-genome-specific bands only in WM14-2 and L. mollis. Lane M, DL2000; lane 1, wheat parent 7182; lane 2, WH15; lane 3, WM14-2; lane 4, P. huashanica; lane 5, L. mollis; lane 6, tetraploid wheat D4286.
Agriculture 15 01887 g002
Agriculture 15 01887 g003
Figure 3. 55K SNP array analysis of genotypes WH15 and WM14-2. A total of 49,079 high-quality polymorphic SNPs were employed to compare. (a) Proportion of identical SNPs between WH15 and P. huashanica for each chromosome. The 2D chromosome showed the highest proportion of identical SNPs. (b) Proportion of identical SNPs between WM14-2 and L. mollis for each chromosome. The 2D chromosome also showed the highest proportion. (c) Distribution of null-heterozygous genotype SNPs along chromosomes by physical position in WH15. Null-heterozygous SNPs were distributed across the entire 2D chromosome. (d) Distribution of null-heterozygous genotype SNPs along chromosomes by physical position in WH15. The null-heterozygous genotype SNPs were distributed across the entire 2D chromosome. (e) Distribution of differential SNPs between P. huashanica 2Ns in WH15 and L. mollis 2Ns in WM14-2. The differential SNPs were predominantly concentrated on the short arms.
Figure 3. 55K SNP array analysis of genotypes WH15 and WM14-2. A total of 49,079 high-quality polymorphic SNPs were employed to compare. (a) Proportion of identical SNPs between WH15 and P. huashanica for each chromosome. The 2D chromosome showed the highest proportion of identical SNPs. (b) Proportion of identical SNPs between WM14-2 and L. mollis for each chromosome. The 2D chromosome also showed the highest proportion. (c) Distribution of null-heterozygous genotype SNPs along chromosomes by physical position in WH15. Null-heterozygous SNPs were distributed across the entire 2D chromosome. (d) Distribution of null-heterozygous genotype SNPs along chromosomes by physical position in WH15. The null-heterozygous genotype SNPs were distributed across the entire 2D chromosome. (e) Distribution of differential SNPs between P. huashanica 2Ns in WH15 and L. mollis 2Ns in WM14-2. The differential SNPs were predominantly concentrated on the short arms.
Agriculture 15 01887 g003
Agriculture 15 01887 g004
Figure 4. Agronomic traits of WH15, WM14-2, and wheat parent 7182. (a) Plant morphology. (b) Spike morphology. WM14-2 had lateral branched spike phenotype. (c) Spikelets. (d) Kernels. Kernel length of WM14-2 is the longest.
Figure 4. Agronomic traits of WH15, WM14-2, and wheat parent 7182. (a) Plant morphology. (b) Spike morphology. WM14-2 had lateral branched spike phenotype. (c) Spikelets. (d) Kernels. Kernel length of WM14-2 is the longest.
Agriculture 15 01887 g004
Agriculture 15 01887 g005
Figure 5. Disease resistance of WH15, WM14-2, wheat parent 7182, and control. (a) Symptoms after injecting with a mixture of Ptt races in the adult stage. WH15 and WM14-2 expressed near immunity which was superior to its wheat parent 7182. (b) Symptoms after injecting with Bgt isolate E09 in the adult stage. WH15 and WM14-2 both expressed moderately susceptibility like their wheat parent 7182. (c) Spike symptoms in response to inoculation with Fusarium graminearum. WH15 and WM14-2 both expressed susceptibility like their wheat parent 7182.
Figure 5. Disease resistance of WH15, WM14-2, wheat parent 7182, and control. (a) Symptoms after injecting with a mixture of Ptt races in the adult stage. WH15 and WM14-2 expressed near immunity which was superior to its wheat parent 7182. (b) Symptoms after injecting with Bgt isolate E09 in the adult stage. WH15 and WM14-2 both expressed moderately susceptibility like their wheat parent 7182. (c) Spike symptoms in response to inoculation with Fusarium graminearum. WH15 and WM14-2 both expressed susceptibility like their wheat parent 7182.
Agriculture 15 01887 g005
Agriculture 15 01887 g006
Figure 6. GISH analysis in meiotic stages of the two derivatives. (a) Two P. huashanica 2Ns chromosomes paired to form a ring bivalent in WH15. (b) L. mollis 2Ns chromosomes also paired to form a bivalent in WM14-2. (c) During anaphase I, the two P. huashanica 2Ns chromosomes in WH15 normally migrated to both poles. (d) During anaphase I, the two L. mollis 2Ns chromosomes in WM14-2 normally migrated to both poles. (e) Each of the microspore cells had a P. huashanica 2Ns chromosome in WH15. (f) The L. mollis 2Ns chromosomes were allocated to each microspore. Scale bar, 10 mm.
Figure 6. GISH analysis in meiotic stages of the two derivatives. (a) Two P. huashanica 2Ns chromosomes paired to form a ring bivalent in WH15. (b) L. mollis 2Ns chromosomes also paired to form a bivalent in WM14-2. (c) During anaphase I, the two P. huashanica 2Ns chromosomes in WH15 normally migrated to both poles. (d) During anaphase I, the two L. mollis 2Ns chromosomes in WM14-2 normally migrated to both poles. (e) Each of the microspore cells had a P. huashanica 2Ns chromosome in WH15. (f) The L. mollis 2Ns chromosomes were allocated to each microspore. Scale bar, 10 mm.
Agriculture 15 01887 g006
Agriculture 15 01887 g007
Figure 7. Validation of the SCAR markers for identification of 2Ns chromosomes. Target bands could be amplified in materials with 2Ns chromosomes. Arrows indicate the specific bands. Lane M-5: DL2000; wheat parent 7182; WH15; WM14-2; P. huashanica; L. mollis.
Figure 7. Validation of the SCAR markers for identification of 2Ns chromosomes. Target bands could be amplified in materials with 2Ns chromosomes. Arrows indicate the specific bands. Lane M-5: DL2000; wheat parent 7182; WH15; WM14-2; P. huashanica; L. mollis.
Agriculture 15 01887 g007
Agriculture 15 01887 g008
Figure 8. The 2rd homoeologous chromosomal FISH karyotype of wheat and its wild relative species based on common oligo probe set pSc119.2 + pTa535-1. Gradation of color indicates the intensity of the fluorescence signal.
Figure 8. The 2rd homoeologous chromosomal FISH karyotype of wheat and its wild relative species based on common oligo probe set pSc119.2 + pTa535-1. Gradation of color indicates the intensity of the fluorescence signal.
Agriculture 15 01887 g008
Table 1. Agronomic trait evaluation of the two derivatives and their wheat parent.
Table 1. Agronomic trait evaluation of the two derivatives and their wheat parent.
MaterialPlant Height
(cm)		Tiller NumberSpike Length
(cm)		Spikelets Per SpikeKernels Per SpikeThousand Kernel Weight (g)
718275.6 ± 4.3a11 ± 2b9.04 ± 0.64b18 ± 2b48 ± 4c30.71 ± 0.13b
WH1577.5 ± 3.1a15 ± 2a13.5 ± 0.47a24 ± 2b55 ± 6b30.33 ± 0.14b
WM14-280.2 ± 5.2a10 ± 2b18.46 ± 1.41a28 ± 3a68 ± 7a36.79 ± 0.44a
Note: Different lowercase letters indicate statistically significant differences at p ≤ 0.05 using LSD (Least Significant Difference) test. The value after the ± symbol is the positive and negative deviation.
Table 2. Measured results of grain quality of the two derivatives and their wheat parent.
Table 2. Measured results of grain quality of the two derivatives and their wheat parent.
MaterialsProtein Content (%)Crude Protein Content (%)Gluten Protein Content (%)Starch Content (%)Subsidence ValueDough Stability Time (min)
718215.14 ± 0.36b61.22 ± 0.27a33.01 ± 0.24b74.43 ± 0.85a40.35 ± 0.64a3.77 ± 0.44a
WH1514.35 ± 0.42b60.02 ± 0.23a33.92 ± 0.34b73.48 ± 0.64a38.44 ± 0.53a4.23 ± 0.63a
WM14-217.51 ± 0.25a58.38 ± 0.31a36.24 ± 0.47a72.78 ± 0.83a42.03 ± 0.72a5.25 ± 0.25a
Note: Different lowercase letters indicate statistically significant differences at p ≤ 0.05 using the LSD test. The value after the ± symbol is the positive and negative deviation.
Table 3. Grain mineral content analysis of the two derivatives and their wheat parent.
Table 3. Grain mineral content analysis of the two derivatives and their wheat parent.
MaterialCu (mg/kg)Fe (mg/kg)K (mg/kg)Mg (mg/kg)Mn (mg/kg)P (mg/kg)Zn (mg/kg)
71824.45 ± 0.18b37.32 ± 0.82b4163.80 ± 5.33c1806.70 ± 7.24c39.28 ± 0.83b3078.80 ± 6.86c20.04 ± 1.21c
WH157.90 ± 0.23a79.46 ± 0.43a8499.05 ± 7.64a2752.67 ± 7.54a63.81 ± 1.45a5500.63 ± 9.23a50.63 ± 0.88a
WM14-26.41 ± 0.12a82.42 ± 0.56a6111.69 ± 6.42b2214.00 ± 8.23b63.05 ± 1.21a4417.08 ± 7.87b44.97 ± 1.32b
Note: Different lowercase letters indicate statistically significant differences at p ≤ 0.05 using the LSD test. The value after the ± symbol is the positive and negative deviation.
Table 4. Sequences of 2Ns chromosome specific SCAR markers designed based on SLAF-seq.
Table 4. Sequences of 2Ns chromosome specific SCAR markers designed based on SLAF-seq.
MarkerPrimer Sequence (5′–3′)Tm (°C) Location
H2SLAF241638CCATCTGGCATCTGTGATGTACT
GTGCTCGGATGAACGCGC		602Ns
H2SLAF3244129CCGAAGATGAATACGAGTATCGG
AGCTTCAGCTGTCTCGGACATG		602NsS
B2SLAF10313CCCGAAGTAATTTGGTCCACC
GCCACCCTCAGCTCGATATC		602Ns
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pang, Y.; Li, J.; Huo, W.; Hua, X.; Yuan, J.; Tang, X.; Yang, H.; Jia, C.; Li, J.; Zhao, J. Identification and Comparative Analysis of Genetic Effects of 2Ns Chromosome Introgression from Psathyrostachys huashanica and Leymus mollis into Common Wheat. Agriculture 2025, 15, 1887. https://doi.org/10.3390/agriculture15171887

AMA Style

Pang Y, Li J, Huo W, Hua X, Yuan J, Tang X, Yang H, Jia C, Li J, Zhao J. Identification and Comparative Analysis of Genetic Effects of 2Ns Chromosome Introgression from Psathyrostachys huashanica and Leymus mollis into Common Wheat. Agriculture. 2025; 15(17):1887. https://doi.org/10.3390/agriculture15171887

Chicago/Turabian Style

Pang, Yuhui, Jiaojiao Li, Wenjie Huo, Xueyou Hua, Jiayi Yuan, Xicheng Tang, Huanhuan Yang, Chongyang Jia, Jiachuang Li, and Jixin Zhao. 2025. "Identification and Comparative Analysis of Genetic Effects of 2Ns Chromosome Introgression from Psathyrostachys huashanica and Leymus mollis into Common Wheat" Agriculture 15, no. 17: 1887. https://doi.org/10.3390/agriculture15171887

APA Style

Pang, Y., Li, J., Huo, W., Hua, X., Yuan, J., Tang, X., Yang, H., Jia, C., Li, J., & Zhao, J. (2025). Identification and Comparative Analysis of Genetic Effects of 2Ns Chromosome Introgression from Psathyrostachys huashanica and Leymus mollis into Common Wheat. Agriculture, 15(17), 1887. https://doi.org/10.3390/agriculture15171887

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop