Next Article in Journal
A GIS-Driven, Machine Learning-Enhanced Framework for Adaptive Land Bonitation
Previous Article in Journal
Study on the Possibility of Rapid Elimination of Accidentally Spilled Petroleum Hydrocarbons in Agricultural Soil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 16
10.3390/agriculture15161733
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigation of Relationship Between Drought Stress Resilience and Some Wrky Transcription Factor Genes in Some Kiwi (Actinidia deliciosa) Cultivars

by
Emine Açar
1,
Mansur Hakan Erol
2 and
Yıldız Aka Kaçar
1,3,*
1
Biotechnology Department, Institute of Applied and Natural Sciences, Çukurova University, Adana 01330, Turkey
2
Biotechnology Research and Application Center, Cukurova University, Adana 01330, Turkey
3
Department of Horticulture, Faculty of Agriculture, Cukurova University, Adana 01330, Turkey
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(16), 1733; https://doi.org/10.3390/agriculture15161733
Submission received: 1 March 2025 / Revised: 17 April 2025 / Accepted: 21 April 2025 / Published: 12 August 2025
(This article belongs to the Section Crop Genetics, Genomics and Breeding)
Browse Figures
Versions Notes

Abstract

Drought stress significantly affects the yield and quality of agricultural crops. Plants have developed various adaptations to cope with drought stress. These adaptations involve the regulation of physiological and biochemical mechanisms regulated by many genes. Therefore, identification of cultivars with strong responses to drought stress will provide important contributions to breeding programs. In this study, Hayward and Matua kiwifruit cultivars were used and the plants were subjected to drought in vitro in nutrient media containing PEG 6000 (Polyethyleneglycol) at concentrations of 0, 1, 2, and 3%. The morphological parameters of the plants were examined during the culture period and WRKY TF was utilized to determine the molecular regulations induced by drought stress in plants. For this purpose, the expression levels of WRKY3, WRKY9, WRKY21, WRKY28, WRKY41, WRKY47, WRKY65 and WRKY71 genes were analyzed in leaf and root tissues of the cultivars. The findings showed that the plants in the 2% and 3% PEG media were significantly affected by drought stress, with a notably low root formation performance. The gene expression analysis revealed that the expression levels of genes in the leaf and root tissues of plants under drought conditions were higher compared to the control group. The data obtained from the analyses indicated that the Hayward and Matua cultivars exhibited strong responses to drought both morphologically and genetically.

1. Introduction

Kiwifruit is a commercially cultivated temperate climate plant belonging to the Actinidiaceae family, represented by approximately 76 genera. Kiwi is a perennial dioecious plant species and its homeland is China [1,2,3]. It is a very valuable fruit in terms of nutrient content, especially high in vitamin C content and fiber, and rich in calcium and potassium [1,3,4,5]. With the cultivation of kiwifruit, it gained commercial importance and became part of the global economy [5]. Kiwi has a very high adaptability, so it has spread over a wide geography in the world. Today, kiwi is grown in 23 countries. China, Italy, New Zealand, Iran, Chile, Greece, France, USA and Turkey are the important countries where kiwi is grown [6]. Today, “Hayward” kiwifruit is the most widely produced kiwifruit cultivar, and Abbott, Bruno and Monty are also among the other preferred cultivars. Matua and Tomuri are preferred as pollinator cultivars [1,2,7].
Plants are in constant interaction with their environment due to their nature. Negative interactions of plants with their environment cause negativities in the plant. Plants form various adaptations against the negativities they encounter. In the inadequacy of adaptations, some physiological negativities occur in plants and this inadequacy is defined as stress [8]. Stress causes many important physiological and metabolic effects in plants. In particular, drought stress adversely affects growth and development in plants, causes sterile pollen formation, and leads to a loss in product quantity and quality [9].
Drought is one of the most important environmental factors limiting agricultural production in most of the agricultural areas [10]. Global climate changes and the increase in the world population make available water resources insufficient [11]. Inadequacies in water resources will lead to a decrease in irrigable land and significant damage to agricultural production. Therefore, it is important to determine the morphological, physiological, biochemical and molecular changes caused by drought stress in plants [12,13,14,15,16,17]. Drought causes significant decreases in yield and quality in kiwifruit as in all agricultural products. The aims of breeding processes are to ensure the adaptation of kiwi, which is grown in cool and humid regions, to changing global climate conditions and to increase its resistance to drought stress. Therefore, it is necessary to understand how drought affects yield and quality parameters and to investigate the physiological and molecular changes that occur in the plant during drought stress or the adaptation mechanisms to these changes. The adaptation mechanism in plants is usually provided by transcription factors [18,19,20,21].
The WRKY transcription factors, which are involved in various physiological regulations, are one of the transcription factors that can serve a wide range of functions [21,22,23]. The WRKY transcription factor gene family has been reported to be particularly involved in the generation of stress resistance responses, and has also been reported to act as a regulator in plant growth and development under stress conditions and to be effective in regulating many signaling mechanisms, including hormones [21,22,23]. One of the most important features of the WRKY transcription factors is their response to abiotic stress. In particular, it has been reported that their responses to drought stress provide plant resistance under stress conditions [22]. Throughout the evolution of plants, WRKYs have been reported to play a role in facilitating various physiological activities in the development of cellular structure and to be central components of the plant defense system [23,24]. In this sense, it is very important to determine the responses of the WRKY transcription factors under stress conditions and the responses of plant cultivars to these stress conditions. They are very valuable scientific resources especially for breeding programs that carry out and manage the breeding process. With the use of these resources, it will be possible to develop new cultivars that can adapt to changing climatic conditions, especially drought conditions, which are considered as a major problem.

2. Material and Methods

2.1. Initation Stage

One-year-old fresh shoots of Hayward (female) and Matua (male) kiwi cultivars in the greenhouses of Çukurova University Biotechnology Research and Application Center were used as the starting material. For sterilization, the shoots were soaked in 70% ethanol for 1 min, followed by a 10 min soak in a 10% sodium hypochlorite solution. The tissues were then washed three times with sterile water, and the sterile explants were transferred to MS medium [25] containing 1 mg L−1 BA, 30 g L−1 sucrose, and 7 g L−1 agar (pH 5.8). The shoot tips were cultured at 25 °C under a 16 h light and 8 h dark photoperiod. The plants were propagated under the same conditions for 3 subcultures.

2.2. In Vitro Drought Stress in Micropropagation Stage

The cultured and propagated plants were transferred to MS nutrient media containing 0, 1, 2, and 3% PEG 6000 (Polyethylene glycol 6000) supplemented with 2 mg L−1 BA. The shoots were cultured under 16 h of light, 8 h of darkness, and 25 °C climate conditions. The plants in the culture medium were subcultured three times, each for about 4 weeks. Plant height, growth coefficient, number of leaves, fresh weight, and dry weight parameters were examined to determine the morphological effects of in vitro drought stress during micropropagation.

2.3. In Vitro Drought Stress at the Rooting Stage

The shoots cultured under in vitro drought stress conditions were transferred to MS nutrient media containing 0, 1, 2, and 3% PEG supplemented with 2 mg L−1 IBA for rooting at the end of subculture periods. The shoots were cultured under 16 h of light, 8 h of darkness, and 25 °C for approximately 4–6 weeks. The plant height, number of roots, root length, number of leaves, wet weight, and dry weight parameters were examined to determine the morphological effects of drought stress on the rooting stage of the plants.

2.4. In Vitro Intense Drought Stress Experiment

The Hayward and Matua cultivars were strongly affected by drought stress in vitro conditions. Especially in the stress groups with 2% and 3% PEG content, root formation remained at a very low level and even many plants did not form roots. Yellowing was also observed in the shoots of the plants in these groups. These negativities in the plants in the stress groups caused insufficient leaf and root tissues to be used in molecular analyses. In order to carry out molecular analyses, a drought stress experiment containing intense PEG was established.
In the intensive drought stress experiment, nutrient media were prepared using 20% PEG 6000. The rooted Hayward and Matua cultivars developed in vitro were used for this experiment. For the experiment, plants were transferred to the control group without hormones and PEG, and to the nutrient media containing 20% PEG for drought stress (treatment group). The plants were exposed to drought stress for 24 h [26,27,28]. At the end of the period, leaf and root tissues of the plants were used for molecular analysis.

2.5. RNA Extractions and cDNA Synthesis

Leaf and root tissues of the plants belonging to the control and treatment groups were used for RNA isolation. Isolation was performed according to the CTAB protocol [29]. The RNA concentration was measured using a NanoDrop, ND 1000 (Thermo Fisher Scientific, Waltham, MA, USA) spectrophotometer and agarose gel electrophoresis. Applied Bıosystems High Capacity cDNA Reverse Transcription Kit (LOT: 00756490) was used for cDNA synthesis. The cDNA synthesis was performed according to the kit protocol, and the kit protocol was also used in PCR cycling conditions.

2.6. qRT-PCR Reactions

The Primers belonging to the WRKY Transcription Factor (WRKY TF) gene family and the primers belonging to the 18S rRNA gene were used in the qRT-PCR reactions (Table 1). The SYBR GREEN (Applied Biosystems, Waltham, MA, USA) kit was also used in the reactions. The reactions were set up according to the kit protocol. The PCR cycling conditions were also programmed according to the kit protocol.
PCR reactions were prepared in three replicates and placed into the Real-Time PCR device. The CT values obtained as a result of the reaction were evaluated based on 2−∆∆Ct formula and the gene expression profiles formed between the tissues of the cultivars were created. In 2−∆∆Ct formula, ∆∆Ct was calculated as [(Ct Target gene) − (Ct Endogenous)] gene.

3. Results

3.1. In Vitro Drought Stress Responses of Plants at the Micropropagation Stage

The Hayward and Matua kiwifruit cultivars were exposed to in vitro drought stress with different concentrations of PEG 6000 (Polyethylene glycol 6000). The results showed that drought stress negatively affected plant growth and development parameters in both kiwifruit cultivars (Figure 1). The plant height, multiplication rate, number of leaves, fresh weight, and dry weight decreased significantly with increasing PEG concentration in the Hayward kiwifruit cultivar (Table 2).
The plant height decreased from 2.25 cm in the control group to 1.51 cm, 1.22 cm, and 1.19 cm with 1%, 2%, and 3% PEG treatments, respectively. Similarly, the multiplication rate was 3.07 in the control group, while it was 2.90, 2.17, and 1.70 in the 1%, 2%, and 3% PEG treatments, respectively. The number of leaves decreased from 14 in the control group to 10.5 in the 1% PEG treatment, 9.93 in the 2% PEG treatment, and 7 in the 3% PEG treatment.
While the wet weight was 2.63 g in the control group, it was recorded as 1.68 g, 1.10 g, and 0.85 g with 1%, 2%, and 3% PEG treatments, respectively. The dry weight decreased from 0.26 g in the control group to 0.16 g, 0.11 g, and 0.07 g with 1%, 2%, and 3% PEG treatments, respectively (Table 2).
In the Matua cultivar, there was a significant decrease in all growth parameters with increasing PEG treatment (Table 3). While the plant height was 2.46 cm in the control group, it decreased to 1.78 cm, 1.34 cm, and 1.28 cm with 1%, 2%, and 3% PEG treatments, respectively. The propagation coefficient was 3.30 in the control group, 3.10 in the 1% PEG treatment, 2.13 in the 2% PEG treatment, and 1.87 in the 3% PEG treatment. The number of leaves decreased from 14.7 in the control group to 12.37 in the 1% PEG treatment, 9.67 in the 2% PEG treatment, and 9.1 in the 3% PEG treatment. While the wet weight was 3.02 g in the control group, it was recorded as 1.77 g, 1.18 g, and 1.01 g with 1%, 2%, and 3% PEG treatments, respectively. The dry weight decreased from 0.32 g in the control group to 0.18 g, 0.10 g, and 0.09 g with 1%, 2%, and 3% PEG treatments, respectively.
In conclusion, Hayward and Matua kiwifruit cultivars are sensitive to PEG-exposed drought stress. This situation resulted in significant reductions in plant growth and development parameters. The results provide important information for evaluating the performance of kiwifruit plants under drought stress.

3.2. Rooting Stage and In Vitro Drought Stress Responses of Plants

In vitro drought stress was applied using different PEG concentrations on the Hayward and Matua kiwi cultivars, and their effects on the rooting stage were examined. The results showed that drought stress negatively affected rooting and growth parameters in both kiwi cultivars (Figure 2).
As the PEG concentration increased in the Hayward cultivar, all parameters decreased (Table 4). The plant height decreased from 4.83 cm in the control group to 0.94 cm and 0.63 cm with 1% and 2% PEG treatments, respectively. No data could be obtained for the 3% PEG treatments as the plants completely dried out. The number of roots decreased from 10.78 in the control group to 1.11 in the 1% PEG treatment, with no rooting observed in the 2% and 3% PEG treatments. The root length was 11.78 cm in the control group, while it decreased to 1.36 cm in the 1% PEG treatment, and no root formation was observed in the 2% and 3% PEG treatments. The number of leaves was 10.61 in the control group, 9.55 in the 1% PEG treatment, and 3.91 in the 2% PEG treatment. While the wet weight was 3.44 g in the control group, it decreased to 0.44 g in the 1% PEG treatment, and no wet weight was observed in the 2% and 3% PEG treatments. The dry weight was 0.40 g in the control group, 0.13 g in the 1% PEG treatment, and no dry weight was observed in the 2% and 3% PEG treatments. These results indicate that the plant height, number of roots, root length, number of leaves, fresh weight, and dry weight decreased significantly with increasing PEG concentration in the Hayward cultivar.
As the PEG concentration increased in the Matua cultivar, all parameters decreased (Table 5). The plant length decreased from 4.50 cm in the control group to 1.17 cm, 0.77 cm, and 0.84 cm with 1%, 2%, and 3% PEG treatments, respectively. The number of roots decreased from 4.55 in the control group to 0.75 and 0.18 in the 1% and 2% PEG treatments, respectively. Rooting did not occur in the 3% PEG treatment. The root length was 6.41 cm in the control group, 0.94 cm in the 1% PEG treatment, and 0.19 cm in the 2% PEG treatment. The number of leaves was 13.44 in the control group, 9.06 in the 1% PEG treatment, 4.64 in the 2% PEG treatment, and 8.67 in the 3% PEG treatment. The wet weight was 2.33 g in the control group, 0.98 g in the 1% PEG treatment, 0.32 g in the 2% PEG treatment, and 0.38 g in the 3% PEG treatment. The dry weight was 0.32 g in the control group, 0.15 g in the 1% PEG treatment, 0.03 g in the 2% PEG treatment, and 0.07 g in the 3% PEG treatment. These data indicate that there was a significant decrease in all rooting and growth parameters of the Matua kiwifruit cultivar with increasing PEG treatment.
When the data obtained from in vitro drought stress trials of the Hayward and Matua kiwifruit cultivars were analyzed, it was observed that both cultivars were sensitive to drought stress. As seen from the micropropagation and rooting data, drought stress increases linearly with PEG concentration. This indicates that the development of vegetative tissues is negatively affected as drought severity increases.

3.3. Gene Expression Level of WRKY TFs

It was clearly seen in the in vitro experiments that the Hayward and Matua cultivars were affected by drought stress. In this sense, the molecular level responses of cultivars to drought stress are of great significance. In the drought stress experiment using intense PEG, the expression level of WRKY genes in the tissues of Hayward and Matua cultivars showed changes in many genes in the treatment groups compared to the control groups. The expression level of the genes and the direction of the expression level were parallel to the direction of regulation of the genes.
When the gene expression level of the tissues of the cultivars was examined, it was determined that the expression values of WRKY3, WRKY9, WRKY28, WRKY65 and WRKY71 were higher in the leaf and root tissues in the treatment groups compared to the control group. The expression level of WRKY21, WRKY41 and WRKY47 decreased in the leaf tissue in the treatment group compared to the control, while it increased in the root tissue. When the expression level of the tissues of the Hayward cultivar was examined, it was determined that the expression level of WRKY3 and WRKY71 were higher in the leaf and root tissues in the treatment group compared to the control group. As for WRKY21, WRKY28 and WRKY47, the expression level in leaf and root tissues decreased significantly in the treatment group compared to the control group. While the expression level of WRKY9, WRKY41 and WRK65 decreased in the treatment group compared to the control group in the leaf tissue, it increased in the treatment group compared to the control group in the root tissue. The gene expression directions of the tissues of the Hayward and Matua cultivars are very similar, but the expression directions of the WRKY28 and WRKY65 genes differ (Figure 3 and Figure 4). When the Hayward and Matua cultivars are compared in terms of gene expression profile, it is seen that the root tissues of both cultivars were more affected by drought stress compared to the leaf tissues. The rate of change in gene expression levels in leaf tissues is not very high, but the expression level in root tissues changes dramatically. This is clearly seen in the gene expression levels of WRKY9, WRKY21 and WRKY28 in the Matua cultivar and WRKY28, WRKY65 and WRKY71 in the Hayward cultivar. As a result, it was determined that both cultivars were affected by drought stress by changes in the expression level of WRKY genes. It has been determined by changes in the expression level of genes that create important molecular responses to drought stress, especially in the root tissues of the cultivars.

4. Discussion

Resistance to drought stress is an important adaptive ability in plants. Due to this ability, plants can manage many adverse effects of drought stress and continue their metabolic functions. Drought-sensitive plants lacking this ability cannot manage the process effectively, leading to many negative impacts on their metabolic functions. When the data from the in vitro drought stress experiments of Hayward and Matua kiwi cultivars were examined, it was observed that both cultivars showed sensitivity to drought stress. As seen from the micropropagation and rooting data, drought stress increased linearly with PEG concentration. This indicates that as the severity of drought increases, all aspects of plant development, including vegetative tissues, are negatively affected. Zhang et al. (2018) [30] applied drought stress using PEG (polyethylene glycol) on five different Actinidia species and examined the changes in the plants. Growth indicators such as plant height, number of leaves, and fresh weight of various species, including Actinidia deliciosa ‘Hayward’, were evaluated. They reported significant decreases in these parameters under stress conditions with 10%, 15%, and 20% PEG concentrations. Liang et al. (2019) reported that drought stress in kiwi strongly suppressed biomass accumulation, damaged cellular membranes, and inhibited photosynthesis in seedlings [31]. Kovalikova et al. (2020) [32] found that osmotic stress, induced in vitro by increasing the concentration of polyethylene glycol (PEG), led to a morphological decrease in fresh and dry weight, water content, and leaf area, as well as a physiological decrease in chlorophyll and carotenoid content. In this study, the decreases in parameters such as plant height, proliferation coefficient, number of leaves, and fresh and dry weight were observed as a result of PEG treatments in the Hayward and Matua cultivars. These findings reveal that PEG negatively affects plant growth and development by inducing osmotic stress. It has been reported that with optimal irrigation, the kiwi plant produces a significant amount of carbohydrates, ensures root–stem development, yields important and high-quality fruits, and increases photosynthetic substance storage [33]. Savé and Adillón (1987) [34] applied moderate drought to the Hayward kiwi cultivar both in vitro and ex vitro. They reported that the cuticular transpiration of rooted cuttings was 28% less than that of in vitro plants, electrolyte leakage resulting from drought stress increased in in vitro plants, and drought hardening was observed in the plants. As a result of PEG treatments during the rooting stage, significant decreases in the rooting rate were observed. At high doses, no rooting occurred, and drying was observed in the upper parts of the plants. It can be said that plants in the rooting stage are more adversely affected by PEG treatments. This highlights the inhibitory effects of PEG on root development and aligns with findings in the literature. Among the two cultivars, it can be concluded that the kiwi is particularly sensitive to drought. The WRKY TF gene family has functions in the regulation of morphological, physiological and molecular mechanisms [35,36].
It has important contributions to the formation of stress responses in plants, especially against biotic and abiotic stress factors [37,38]. WRKY3 gene, like other WRKY members, is an important gene that plays a role in the formation of molecular responses in plants against biotic and abiotic stress factors. It is reported that it quickly stimulates the plant under stress conditions and contributes positively to the plant’s resistance to stress conditions [37]. In our study, the gene expression level of WRKY3 was higher in the stress groups compared to the control groups. In the molecular analysis, the increase in WRKY3 gene expression level was higher in the tissues of Hayward cultivar compared to Matua cultivar. In many studies conducted to determine the functions of the WRKY3 gene in plants against biotic and abiotic stress conditions, it has been confirmed that the accumulation of WRKY3 increases especially under stress conditions and that it provides resistance to the plant [37,38,39,40,41]. In our study, the reason why the expression level of the WRKY3 gene, like many WRKY genes, is higher in the stress group compared to the control group is to protect the plant against drought stress or to provide resistance to the plant. As a matter of fact, the increase in the expression level of WRKY3 in leaf and root tissues of the cultivars supports this view.
WRKY9 is another gene that helps the formation of resistance responses in the plant in the abiotic stress mechanism. It has been emphasized in research that it plays a role in the regulation of some genes related to suberin biosynthesis and apoplastic barriers, which allows the increase in resistance of plant roots, especially in abiotic stress, thus providing resistance to the plant [42,43]. Studies have reported that the gene expression level varies tissue-specifically, whereas the expression level of WRKY9 increases in root tissues [43]. In the study, the expression level of WRKY9 increased in the stress groups compared to the control groups in the root tissues of Hayward and Matua cultivars. This situation is parallel to previous studies and is considered as a regulatory response to increase resistance in root tissues. WRKY9 is also involved in the biosynthesis regulation of some plant growth regulators such as cytokinin (CTK), auxin (IAA), gibberyllic acid (GA) and bracimonoid (BR). WRKY9 has been reported to be expressed at higher levels in dwarf plants than in non-dwarf plants [44]. In PEG treatments, as the drought stress increased, shrinkage of stem and leaf bases and shortening of plant height were observed. In addition, weak root formation and even no root formation in some groups were among the morphological changes (Figure 1). The low rooting rates of the cultivars in the statistical analyses clearly support this situation (Table 4 and Table 5). These morphological changes seen in plants increased in parallel with the degree of drought stress and reached the highest level in 3% concentration PEG. This suggests that increased drought stress promotes an increase in WRKY9 gene expression level, thus causing stunting in plants. As a matter of fact, it is known that it promotes stunting in the plant by reducing Brassinosteroid (BR) biosynthesis, as well as the formation of resistance responses [44,45,46,47]. It has been reported that some WRKY genes (e.g., WRKY9) interact with MPK to induce immune responses in plants, but overexpression of these genes causes plant damage or cell death [48]. In the in vitro stress treatments, healthy plants were obtained only in the control groups, while the plants in the other groups showed very weak growth and even yellowing of some plant tissues. It can also be suggested that the tissue damages observed in plants are caused by the overexpression of WRKY9. This clearly shows that kiwifruit is sensitive to drought stress.
WRKY TFs can be found in positive or negative regulation in plants. Each WRKY gene has its own regulatory direction. The WRKY21 gene, like other WRKYs, is involved in the regulation of many molecular mechanisms, but it has been determined in studies that it has a close relationship with drought stress [48,49,50]. WRKY21 is a gene that negatively regulates drought stress. This function has been confirmed in transgenic plants with the WRKY21 gene silenced [50]. In our study, WRKY21 expression value decreased in the leaf tissues of both cultivars. When the root tissues of the cultivars were examined, it was determined that the root tissues of the Hayward cultivar were lower than the control group, but an increase was observed in the root tissues of the Matua cultivar compared to the control group. Although both cultivars were sensitive in the in vitro drought stress experiments, this negative regulation of WRKY21 may have contributed to the formation of resistance at the molecular level in the Hayward cultivar, but its level may have been insufficient. On the other hand, some studies have emphasized that the expression of WRKY21 increases in drought stress [51]. Its effects against drought stress in Arabidopsis have been investigated. In the study, it was determined that the expression value of this gene was higher in transgenic plant lines in which the WRKY21 gene was silenced compared to resistant lines in which the WRKY21 gene was active. At the end of the study, it was reported that WRKY21 has a negative regulation in the formation of plant resistance responses to drought stress [50]. The high expression value in the root tissues of the Matua cultivar suggests that the cultivar is inadequate in the formation of resistance responses. WRKY21 works negatively through the ABA signal formation mechanism. WRKY21 gene expression can be reduced or inhibited by negative regulation of ABA signaling [52,53]. When the data obtained in the study were examined, it was found that while the decreases in the expression of WRKY21 strengthened the ABA signal formation in the Hayward cultivar, it may not have stimulated the ABA signal formation at a sufficient level in Matua. This may have supported the resistance of the Hayward cultivar to drought compared to the Matua cultivar. As a matter of fact, it has been reported that ABA signaling gains positive effects through negative regulation of the WRKY21 gene. At the same time, it has been emphasized in studies that decreasing the expression level of WRKY21 increases the plant’s resistance to drought stress [53,54]. When the in vitro data in the study were examined, it was observed that the root formation of the Matua cultivar gave more positive results than the root formation of the Hayward cultivar. It may be a result of the interaction of the WRKY21 and WRKY28 genes. Studies have reported that the expression level of WRKY21 and WRKY28 genes contributes to root formation. It has been supported by studies where phosphate uptake is regulated as a result of negative regulation of the WRKY21 gene and positive regulation of the WRKY28 gene, and this provides positive contributions to root tissues [53,54,55]. Although in vitro drought-stressed tissues were not used in molecular analyses, the genetic structure of the Matua cultivar was compatible with the interaction of WRKY21 and WRKY28. Similar results may have been seen in vitro and therefore positive results in root tissues may have been obtained. WRKY28 is an important gene that regulates drought and oxidative stress mechanisms, and its increased expression has been reported to increase branching in plants and promote the formation of new lateral buds [56,57]. In a study, it was emphasized that the expression of WRKY28 increased in tissues subjected to drought stress, and in the same study, it was emphasized that ABA-dependent signaling pathways were associated with drought stress [58]. It was observed that the expression value of WRKY28 in vitis vinifera plants subjected to drought stress increased in leaf and root tissues. In the study, drought stress was applied for 48 h. While WRKY expression reached the highest level in the leaves at the 24th hour, it decreased at the 48th hour. In the root, it reached its highest expression level at the 12th hour and a decrease was observed at the 24th and 48th hours. It has been stated that this tissue-specific change may result from the relationship of WRKY28 with senescence. They also stated that the increase in expression in the roots was a result of previous stimulation of the roots [59]. The results obtained in our study support the study conducted by Liu et al. (2022) [59]. As a matter of fact, while the expression of WRKY28 increased in leaf and root tissues in Matua, it decreased in leaf and root tissues in Hayward. This supports that the Hayward cultivar responds earlier than the Matua cultivar.
WRKY65 is a WRKY TF member that controls the plant defense mechanism against biological attacks and various environmental conditions, as well as having positive regulation in the stimulation of various hormones. It regulates various adversities or physiological disorders with increased expression in plant tissues [54,60,61,62,63]. In the study, an increase in the expression level of WRKY65 was observed in the treatment groups compared to the control groups in both cultivars; the increase in root tissues was higher than in leaf tissues. In addition, while the expression in the leaf tissue of the Matua cultivar increased, the expression decreased in the leaf tissue of the Hayward cultivar. Studies have reported that the immune system in the plant is stimulated, and stress responses are generated as a result of the overexpression of WRKY65 [63]. In the study, the increase in WRKY65 gene expression in roots may be related to the direct effects of drought stress on root tissues. The increase in the expression of WRKY65 in the root tissues of both cultivars, and especially the highest increase in expression in the root tissue of the Hayward cultivar, was reported by Wang et al. (2020) [63]. The difference in expression levels in leaf tissues of cultivars may be tissue-specific, but it also suggests that the gene expression level is limited in time. Studies support this view. Skibbe et al. (2008) [41] emphasized in their study that an increase in WRKY expression was observed after a certain period of time and reported that the increase in gene expression occurred in a limited period of time. They argue that the increase in expression in the leaf tissue of the Matua cultivar may have contributed to the plant for a limited period of time and that this situation could provide positive contributions to the plant for a limited period of time. WRKY71 undertakes important functions in the adaptation of the plant to various ecological conditions, as well as in the morphological and physiological development of the plant [64]. It benefits from the strategies of salicylic acid, jasmonic acid, ethylene and ROS mechanism in the regulation of morphological, physiological and adaptive mechanisms [64,65,66]. Its effects on morphological development are to encourage the branching of the plant by contributing to the development of buds of axillary meristems [64]. WRKY71 also uses JA, SA, Ethylene, ABA, mannitol and ROS strategies under biotic and abiotic stress conditions [64,65,66]. Studies have reported that WRKY71 affects senescence and branching and regulates the formation of abiotic stress responses. As a result, WRKY71 has the potential to regulate more than one mechanism and this regulation is positive. This feature has been confirmed in many studies [65,66,67,68,69,70]. In our study, an increase in WRKY71 expression was observed in leaf tissues of Hayward and Matua cultivars. The expression level in the root tissues of the cultivars is higher in the Hayward cultivar compared to the Matua cultivar. When the results obtained in the study are examined, it is thought that WRKY71 promotes both branching and the formation of abiotic stress responses in the plant. When the results obtained in the in vitro study were examined, the tillering coefficient of the cultivars was higher in the Matua cultivar. The basis of this situation may be the increase in the expression of WRKY71. As a matter of fact, it has been determined that WRKY71 is overexpressed in tissues where branching is intense, whereas branching is not observed in transgenic plants in which WRKY71 is inactive [64,65,66]. WRKY71 is known to associate with ethylene or ABA. The interaction of WRKY71 and ethylene has been reported to stimulate senescence in leaves [64,65,66]. Additionally, WRKY71 and WRKY28 are phylogenetically very close and have similar functions. Studies have found that when the expression of WRKY71 and WRKY28 is high, ABA or ethylene hormones are also high [65,66,67,68,70]. In the study, an increase in the expression of WRKY71 was observed only in the leaf tissues of the Matua cultivar, while the expression level of WRKY71 increased in both leaf and root tissues of the Hayward cultivar. This supports that WRKY71 may have strong effects on the formation of stress responses in the plant and may have important functions in stimulating the resistance mechanism in the plant.
Some WRKY genes may have both activator and repressor motifs. The expression directions of these genes can be positive or negative [71]. Jia et al. (2020) [72] emphasized that WRKY genes may have different expression directions in drought stress. In their study, WRKY3, WRKY41, WRKY65, WRKY71, WRKY28 were stated as genes whose expression increased, and WRKY21 expression decreased. WRKY3 increased in leaves in drought stress treatments, WRKY65, WRKY71, WRKY28 increased in leaves and decreased in roots, WRKY41 decreased in leaves and increased in roots, and WRKY21 showed a decrease in leaves and roots [72]. Jia et al. (2020) [72] obtained results that are similar to the results we obtained in the study. The expression level of tissues and the expression directions of genes are largely parallel. Although there are WRKYs with a positive or negative expression profile, their expression directions may vary because they take part in complex signaling mechanisms and different networks in plants [37]. As a matter of fact, it is not yet fully known whether some genes (e.g., WRKY3) are directly regulated or whether they provide regulation in plants by interacting with the promoter of another transcription factor [41,70]. Studies have reported that an increase in WRKY expression is observed after a certain period of time and that this increase covers a limited period of time. It has been suggested that this situation may provide positive contributions to the plant for a limited period of time [41]. WRKY genes recognize the W-box element and can increase or repress the expression level of genes containing this element. This feature creates important warnings in plants depending on different growth stages and different stress conditions [58]. Considering all the features of WRKY TFs, they make significant contributions to the formation of immune responses against drought stress in cultivars and their tissues and help increase plant resistance to stress conditions. When the expression levels of all WRKY genes were examined in the study, it was seen that only one cultivar stood out, the immune responses of the Matua cultivar were stronger in the expression of some genes, and the immune responses of the Hayward cultivar were stronger in the expression of some genes. When the data obtained as a result of the stress in the in vitro drought stress experiment is examined, it is clearly seen that both cultivars are sensitive to drought. The results obtained from molecular analyses do not support the resistance of only a single cultivar, and it is seen that the regulatory stimuli created for resistance vary specifically for the tissue and/or cultivar. This clearly shows that the molecular results are similar to the in vitro results and that both cultivars have similar resistance levels. Although tissues subjected to in vitro drought stress were not used in molecular analyses, it was found important that the results obtained in molecular analyses supported the results obtained from in vitro drought stress. The fact that both the morphological data obtained from in vitro drought stress and the molecular data obtained from the intense drought stress experiment support each other contains important information for understanding the genetic basis of the cultivars. The genetic structures of cultivars have the potential to express similar reactions in different conditions, without being affected by the negativities of internal and external conditions. Therefore, we can obtain more precise information about the genetic structures of plants. Obtaining results supporting this view in the study is considered important and meaningful as it shows that the cultivars used have the potential to produce similar responses in different environments and different conditions.

5. Conclusions

In the presented study, the resistance of Hayward and Matua cultivars, which are used extensively in kiwi cultivation, against drought stress was investigated. It was studied in detail by in vitro drought stress and molecular analyses. The resistance levels of both cultivars against drought stress were compared. As a result of the analyses, important results were obtained regarding the morphological changes of the cultivars and the molecular changes that may be the basis for these morphological changes. It is thought that the results obtained are a resource that can be used in breeding studies.

Author Contributions

Methodology, E.A., M.H.E. and Y.A.K.; Formal analysis, E.A.; Writing—original draft, E.A., M.H.E. and Y.A.K.; Writing—review & editing, E.A.; Supervision, Y.A.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Cukurova University Scientific Research Projects Coordination Office (Project Number: FBA-2023-15825).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Guroo, I.; Wani, S.A.; Wani, S.M.; Ahmad, M.; Mir, S.A.; Masoodi, F.A. A Review of Production and Processing of Kiwifruit. J. Food Process. Technol. 2017, 8, 699. [Google Scholar]
  2. Şahin, G. KİVİ (Actinidia Deliciosa) Yetiştiriciliği Ve Türkiye Zirai Hayatındaki Yeri. Bartın Üniversitesi Edeb. Fakültesi Derg. 2019, 4, 3–32. (In Turkish) [Google Scholar]
  3. Drummond, L. Chapter Three—The Composition and Nutritional Value of Kiwifruit. Adv. Food Nutr. Res. 2013, 68, 33–57. [Google Scholar] [CrossRef] [PubMed]
  4. Vissers, M.C.M.; Carr, A.C.; Pullar, J.M.; Ve Bozonet, S.M. The Bioavailability of Vitamin C From Kiwifruit. Adv. Food Nutr. Res. 2013, 68, 125–147. [Google Scholar]
  5. Ward, C.; Courtney, D. Kiwifruit: Taking Its Place in The Global Fruit Bowl. Adv. Food Nutr. Res. 2013, 68, 1–14. [Google Scholar] [PubMed]
  6. Uzundumlu, A.S.; Bilgin, K.; Kurtoğlu, S.; Ertek, N. Kivi Yetiştiriciliğinde Karşılaşılan Temel Sorunların Faktör Ve Probit Analizleri İle Belirlenmesi: Rize İli Örneği. İşletme Ekon. Ve Yönetim Araştırmaları Derg. 2018, 1, 71–92. (In Turkish) [Google Scholar]
  7. Debersaques, F.; Mekers, O. Growth and Production of Kiwifruit and Kiwiberry. In Soils Plant Growth Crop Production; Eolss Publishers Company Limited: Abu Dhabi, United Arab Emirates, 2010; Volume 2, p. 8. [Google Scholar]
  8. Greco, M.; Chiappetta, A.; Bruno, L.; Bitonti, M.B. In Posidonia Oceanica Cadmium induces Changes in DNA Methylation and Chromatin Patterning. J. Exp. Bot. 2012, 63, 695–709. [Google Scholar] [CrossRef] [PubMed]
  9. Suzuki, N.; Rivero, R.M.; Shulaev, V.; Blumwald, E.; Mittler, R. Abiotic and Biotic Stress Combinations. New Phytol. 2014, 203, 32–43. [Google Scholar] [CrossRef]
  10. Zhu, J.K. Salt and Drought Stress Signal Transduction in Plants. Annu. Rev. Plant Biol. 2002, 53, 247. [Google Scholar] [CrossRef]
  11. Nezhadahmadi, A.; Prodhan, Z.H.; Faruq, G. Drought tolerance in Wheat. Sci. World J. 2013, 1, 610721. [Google Scholar] [CrossRef]
  12. Szegletes, Z.; Erdei, L.; Tari, I.; Cseuz, L. Accumulation of Osmoprotectants in Wheat Cultivars of Different Drought Tolerance. Cereal Res. Commun. 2000, 28, 403–410. [Google Scholar] [CrossRef]
  13. Rizhsky, L.; Liang, H.; Mittler, R. The Combined Effect of Drought Stress and Heat Shock on Gene Expression in Tobacco. Plant Physiol. 2000, 130, 1143–1151. [Google Scholar] [CrossRef]
  14. Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding Plant Responses to Drought—From Genes to The Whole Plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef] [PubMed]
  15. Denby, K.; Gehring, C. Engineering Drought and Salinity tolerance in Plants: Lessons from Genome-Wide Expression Profiling in Arabidopsis. Trends Biotechnol. 2005, 23, 547–552. [Google Scholar] [CrossRef] [PubMed]
  16. Flexas, J.; Bota, J.; Cifre, J.; Mariano Escalona, J.; Galmés, J.; Gulías, J.; Medrano, H. Understanding down-regulation of photosynthesis under water stress: Future prospects and searching for physiological tools for irrigation management. Ann. Appl. Biol. 2004, 144, 273–283. [Google Scholar] [CrossRef]
  17. Flexas, J.; Bota, J.; Loreto, F.; Cornic, G.; Sharkey, T.D. Diffusive and metabolic limitations to photosynthesis under drought and salinity in C3 plants. Plant Biol. 2004, 6, 269–279. [Google Scholar] [CrossRef]
  18. Pandey, S.P.; Somssich, I.E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 2009, 150, 1648–1655. [Google Scholar] [CrossRef]
  19. Latchman, D.S. Transcription factors: An overview. Int. J. Biochem. Cell 1997, 29, 1305–1312. [Google Scholar] [CrossRef]
  20. Yamasaki, K.; Kigawa, T.; Seki, M.; Shinozaki, K.; Yokoyama, S. DNA-binding domains of plant-specific transcription factors: Structure, function, and evolution. Trends Plant Sci. 2013, 18, 267–276. [Google Scholar] [CrossRef]
  21. Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
  22. Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY transcription factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [PubMed]
  23. Wang, C.; Deng, P.; Chen, L.; Wang, X.; Ma, H.; Hu, W.; He, G. A wheat WRKY transcription factor TaWRKY10 confers tolerance to multiple abiotic stresses in transgenic tobacco. PLoS ONE 2013, 8, e65120. [Google Scholar] [CrossRef]
  24. Wang, Y.; Ma, F.; Li, M.; Liang, D.; Zou, J. Physiological responses of kiwifruit plants to exogenous ABA under drought conditions. Plant Growth Regul. 2011, 64, 63–74. [Google Scholar] [CrossRef]
  25. Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  26. Liu, Y.; Meng, Q.; Duan, X.; Zhang, Z.; Li, D. Effects of PEG-induced drought stress on regulation of indole alkaloid biosynthesis in Catharanthus roseus. J. Plant Interact. 2017, 12, 87–91. [Google Scholar] [CrossRef]
  27. Meher Shivakrishna, P.; Ashok Reddy, K.; Manohar Rao, D. Effect of PEG-6000 imposed drought stress on RNA content, relative water content (RWC), and chlorophyll content in peanut leaves and roots. Saudi J. Biol. Sci. 2018, 25, 285–289. [Google Scholar] [CrossRef]
  28. Teng, K.; Li, J.; Liu, L.; Han, Y.; Du, Y.; Zhang, J.; Sun, H.; Zhao, Q. Exogenous ABA induces drought tolerance in upland rice: The role of chloroplast and ABA biosynthesis-related gene expression on photosystem II during PEG stress. Acta Physiol. Plant. 2014, 36–38, 2219–2227. [Google Scholar] [CrossRef]
  29. Zarei, A.; Zamani, Z.; Mousavi, A.; Fatahi, R.; Alavijeh, M.K.; Dehsara, B.; Salami, S.A. An effective protocol for isolation of high-quality RNA from pomegranate seeds. Asian Aust. J. Plant Sci. Biotechnol. 2012, 6, 32–37. [Google Scholar]
  30. Zhang, Y.; Chen, Q.; Lan, J.; Luo, Y.; Wang, X.; Chen, Q.; Sun, B.; Wang, Y.; Gong, R.; Tang, H. Effects of Drought Stress and Rehydration on Physiological Parameters and Proline Metabolism in Kiwifruit Seedling. Int. J. Agric. Biol. 2018, 20, 2891–2896. [Google Scholar]
  31. Liang, D.; Ni, Z.; Xia, H.; Xie, Y.; Lv, X.; Wang, J.; Luo, X. Exogenous melatonin promotes biomass accumulation and photosynthesis of kiwifruit seedlings under drought stress. Sci. Hortic. 2019, 246, 34–43. [Google Scholar] [CrossRef]
  32. Kovalikova, Z.; Jiroutova, P.; Toman, J.; Dobrovolna, D.; Drbohlavova, L. Physiological responses of apple and cherry in vitro culture under different levels of drought stress. Agronomy 2020, 10, 1689. [Google Scholar] [CrossRef]
  33. Sale, P.R. Kiwifruit Culture; Williams, D.A., Ward, V.R., Eds.; Government Printer: Wellington, New Zealand, 1985; pp. 14–18. [Google Scholar]
  34. Savé, R.; Adillón, J. Comparison between plant water relations of in vitro plants and rooted cuttings of kiwifruit. In International Symposium on Kiwifruit Mount; Acta Horticulturae: Maunganui, New Zealand, 1987; Volume 282, pp. 193–198. [Google Scholar]
  35. Mahiwal, S.; Pahuja, S.; Pandey, G.K. Structural-functional relationship of WRKY transcription factors: Unfolding the role of WRKY in plants. Int. J. Biol. Macromol. 2013, 257, 128769. [Google Scholar] [CrossRef]
  36. Ryu, H.-S.; Han, M.; Lee, S.-K.; Cho, J.-I.; Ryoo, N.; Heu, S.; Lee, Y.-H.; Bhoo, S.H.; Wang, G.-L.; Hahn, T.-R. A comprehensive expression analysis of the WRKY gene superfamily in rice plants during defense response. Plant Cell Rep. 2006, 25, 836–847. [Google Scholar] [CrossRef]
  37. Lai, Z.; Vinod, K.; Zheng, Z.; Fan, B.; Chen, Z. Roles of ArabidopsisWRKY3 and WRKY4 Transcription Factors in Plant Responses to Pathogens. BMC Plant Biol. 2008, 8, 68. [Google Scholar] [CrossRef] [PubMed]
  38. Yu, S.; Lan, X.; Zhou, J.; Gao, K.; Zhong, C.; Xie, J. Dioscorea composita WRKY3 positively regulates salt-stress tolerance in transgenic Arabidopsis thaliana. J. Plant Physiol. 2022, 269, 153592. [Google Scholar] [CrossRef]
  39. Guo, R.; Yu, F.; Gao, Z.; An, H.; Cao, X.; Guo, X. GhWRKY3, a novel cotton (Gossypium hirsutum L.) WRKY gene, is involved in diverse stress responses. Mol. Biol. Rep. 2011, 38, 49–58. [Google Scholar] [CrossRef] [PubMed]
  40. Hichri, I.; Muhovski, Y.; Žižková, E.; Dobrev, P.I.; Gharbi, E.; Franco-Zorrilla, J.M.; Lopez-Vidriero, I.; Solano, R.; Clippe, A.; Errachid, A. The Solanum lycopersicum WRKY3 transcription factor SlWRKY3 is involved in salt stress tolerance in tomato. Front. Plant Sci. 2017, 8, 1343. [Google Scholar] [CrossRef] [PubMed]
  41. Skibbe, M.; Qu, N.; Galis, I.; Baldwin, I.T. Induced plant defenses in the natural environment: Nicotiana attenuata WRKY3 and WRKY6 coordinate responses to herbivory. Plant Cell 2008, 20, 1984–2000. [Google Scholar] [CrossRef]
  42. Krishnamurthy, P.; Vishal, B.; Ho, W.J.; Lok, F.C.J.; Lee, F.S.M.; Kumar, P.P. Regulation of a cytochrome P450 gene CYP94B1 by WRKY33 transcription factor controls apoplastic barrier formation in roots to confer salt tolerance. Plant Physiol. 2020, 184, 2199–2215. [Google Scholar] [CrossRef]
  43. Krishnamurthy, P.; Vishal, B.; Bhal, A.; Kumar, P.P. WRKY9 transcription factor regulates cytochrome P450 genes CYP94B3 and CYP86B1, leading to increased root suberin and salt tolerance in Arabidopsis. Physiol. Plant. 2021, 172, 1673–1687. [Google Scholar] [CrossRef]
  44. Zheng, X.; Zhao, Y.; Shan, D.; Shi, K.; Wang, L.; Li, Q.; Kong, J. Md WRKY 9 overexpression confers intensive dwarfing in the M26 rootstock of apple by directly inhibiting brassinosteroid synthetase Md DWF 4 expression. New Phytol. 2018, 217, 1086–1098. [Google Scholar] [CrossRef] [PubMed]
  45. Foster, T.M.; McAtee, P.A.; Waite, C.N.; Boldingh, H.L.; McGhie, T.K. Apple dwarfing rootstocks exhibit an imbalance in carbohydrate allocation and reduced cell growth and metabolism. Hortic. Res. 2017, 4, 17009. [Google Scholar] [CrossRef] [PubMed]
  46. Werner, T.; Motyka, V.; Laucou, V.; Smets, R.; Van Onckelen, H.; Schmülling, T. Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell 2003, 15, 2532–2550. [Google Scholar] [CrossRef] [PubMed]
  47. Werner, T.; Holst, K.; Pörs, Y.; Guivarc’h, A.; Mustroph, A.; Chriqui, D.; Grimm, B.; Schmülling, T. Cytokinin deficiency causes distinct changes of sink and source parameters in tobacco shoots and roots. J. Exp. Bot. 2008, 59, 2659–2672. [Google Scholar] [CrossRef]
  48. Adachi, H.; Nakano, T.; Miyagawa, N.; Ishihama, N.; Yoshioka, M.; Katou, Y.; Yaeno, T.; Shirasu, K.; Yoshioka, H. WRKY transcription factors phosphorylated by MAPK regulate a plant immune NADPH oxidase in Nicotiana benthamiana. Plant Cell 2015, 27, 2645–2663. [Google Scholar] [CrossRef]
  49. Phukan, U.J.; Jeena, G.S.; Shukla, R.K. WRKY transcription factors: Molecular regulation and stress responses in plants. Front. Plant science 2016, 7, 760. [Google Scholar] [CrossRef]
  50. Zhao, K.X.; Chu, S.S.; Zhang, X.D.; Wang, L.P.; Rono, J.K.; Yang, Z.M. AtWRKY21 negatively regulates tolerance to osmotic stress in Arabidopsis. Environ. Exp. Bot. 2020, 169, 103920. [Google Scholar] [CrossRef]
  51. Bakshi, M.; Oelmüller, R. WRKY transcription factors: Jack of many trades in plants. Plant Signal. Behav. 2014, 9, e27700. [Google Scholar] [CrossRef] [PubMed]
  52. Mi, X.; Tang, M.; Zhu, J.; Shu, M.; Wen, H.; Zhu, J.; Wei, C. Alternative splicing of CsWRKY21 positively regulates cold response in tea plant. Plant Physiol. Biochem. 2024, 208, 108473. [Google Scholar] [CrossRef]
  53. Ou, X.; Seemann, J.R.; Neuman, D.; Shen, Q.J. A WRKY gene from creosote bush encodes an activator of the abscisic acid signaling pathway. J. Biol. Chem. 2004, 279, 55770–55779. [Google Scholar]
  54. Wang, W.; Li, T.; Chen, Q.; Deng, B.; Deng, L.; Zeng, K. Transcription Factor CsWRKY65 Participates in the Establishment of Disease Resistance of Citrus Fruits to Penicillium digitatum. J. Agric. Food Chem. 2021, 69, 5671–5682. [Google Scholar] [CrossRef] [PubMed]
  55. Zhang, J.; Gu, M.; Liang, R.; Shi, X.; Chen, L.; Hu, X.; Wang, S.; Dai, X.; Qu, H.; Li, H.; et al. OsWRKY21 and OsWRKY108 function redundantly to promote phosphate accumulation through maintaining the constitutive expression of OsPHT1;1 under phosphate-replete conditions. New Phytol. 2021, 229, 1598–1614. [Google Scholar] [CrossRef]
  56. Babitha, K.C.; Ramu, S.V.; Pruthvi, V.; Mahesh, P.; Nataraja, K.N.; Udayakumar, M. Co-expression of at bHLH17 and at WRKY 28 confers resistance to abiotic stress in Arabidopsis. Transgenic Res. 2013, 22, 327–341. [Google Scholar] [CrossRef]
  57. Zhang, K.; Liu, F.; Wang, Z.; Zhuo, C.; Hu, K.; Li, X.; Wen, J.; Yi, B.; Shen, J.; Ma, C. Transcription factor WRKY28 curbs WRKY33-mediated resistance to Sclerotinia sclerotiorum in Brassica napus. Plant Physiol. 2022, 190, 2757–2774. [Google Scholar] [CrossRef]
  58. Cao, Q.; Huang, L.; Li, J.; Qu, P.; Tao, P.; Crabbe, M.J.C.; Zhang, T.; Qiao, Q. Integrated transcriptome and methylome analyses reveal the molecular regulation of drought stress in wild strawberry (Fragaria nilgerrensis). BMC Plant Biol. 2022, 22, 613. [Google Scholar] [CrossRef]
  59. Liu, J.; Chen, Y.; Wang, W.; Liu, J.; Zhu, C.; Zhong, Y.; Zhang, H.; Liu, X.; Yin, X. Transcription Factors Acerf74/75 Respond to Waterlogging Stress and Trigger Alcoholic Fermentation-Related Genes in Kiwifruit. Plant Sci. 2022, 314, 111115. [Google Scholar] [CrossRef]
  60. Chen, L.; Song, Y.; Li, S.; Zhang, L.; Zou, C.; Yu, D. The role of WRKY transcription factors in plant abiotic stresses. Biochim. et Biophys. Acta BBA-Gene Regul. Mech. 2012, 1819, 120–128. [Google Scholar] [CrossRef] [PubMed]
  61. Fan, Z.-Q.; Tan, X.-L.; Shan, W.; Kuang, J.-F.; Lu, W.-J.; Chen, J.-Y. BrWRKY65, a WRKY transcription factor, is involved in regulating three leaf senescence-associated genes in Chinese flowering cabbage. Int. J. Mol. Sci. 2017, 18, 1228. [Google Scholar] [CrossRef] [PubMed]
  62. Huo, T.; Wang, C.-T.; Yu, T.-F.; Wang, D.-M.; Li, M.; Zhao, D.; Li, X.-T.; Fu, J.-D.; Xu, Z.-S.; Song, X.-Y. Overexpression of ZmWRKY65 transcription factor from maize confers stress resistances in transgenic Arabidopsis. Sci. Rep. 2021, 11, 4024. [Google Scholar] [CrossRef]
  63. Wang, X.; Li, J.; Guo, J.; Qiao, Q.; Guo, X.; Ma, Y. The WRKY transcription factor PlWRKY65 enhances the resistance of Paeonia lactiflora (herbaceous peony) to Alternaria tenuissima. Hortic. Res. 2020, 7, 57. [Google Scholar] [CrossRef]
  64. Guo, D.; Qin, G. EXB1/WRKY71 transcription factor regulates both shoot branching and responses to abiotic stresses. Plant Signal. Behav. 2016, 11, e1150404. [Google Scholar] [CrossRef] [PubMed]
  65. Guo, D.; Zhang, J.; Wang, X.; Han, X.; Wei, B.; Wang, J.; Li, B.; Yu, H.; Huang, Q.; Gu, H. The WRKY transcription factor WRKY71/EXB1 controls shoot branching by transcriptionally regulating RAX genes in Arabidopsis. Plant Cell 2015, 27, 3112–3127. [Google Scholar] [CrossRef] [PubMed]
  66. Yu, Y.; Qi, Y.; Xu, J.; Dai, X.; Chen, J.; Dong, C.; Xiang, F. Arabidopsis WRKY71 regulates ethylene-mediated leaf senescence by directly activating EIN2, ORE1 and ACS2 genes. Plant J. 2021, 107, 1819–1836. [Google Scholar] [CrossRef] [PubMed]
  67. Huang, R.; Liu, D.; Huang, M.; Ma, J.; Li, Z.; Li, M.; Sui, S. CpWRKY71, a WRKY transcription factor gene of Wintersweet (Chimonanthus praecox), promotes flowering and leaf senescence in Arabidopsis. Int. J. Mol. Sci. 2019, 20, 5325. [Google Scholar] [CrossRef]
  68. Lei, Y.; Sun, Y.; Wang, B.; Yu, S.; Dai, H.; Li, H.; Zhang, Z.; Zhang, J. Woodland strawberry WRKY71 acts as a promoter of flowering via a transcriptional regulatory cascade. Hortic. Res. 2020, 7, 137. [Google Scholar] [CrossRef]
  69. Xu, Q.; Feng, W.J.; Peng, H.R.; Ni, Z.F.; Sun, Q.X. TaWRKY71, a WRKY transcription factor from wheat, enhances tolerance to abiotic stress in transgenic Arabidopsis thaliana. Cereal Res. Commun. 2014, 42, 47–57. [Google Scholar] [CrossRef]
  70. Yu, Y.; Wang, L.; Chen, J.; Liu, Z.; Park, C.-M.; Xiang, F. WRKY71 acts antagonistically against salt-delayed flowering in Arabidopsis thaliana. Plant Cell Physiol. 2018, 59, 414–422. [Google Scholar] [CrossRef]
  71. Xie, Z.; Zhang, Z.-L.; Zou, X.; Huang, J.; Ruas, P.; Thompson, D.; Shen, Q.J. Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells. Plant Physiol. 2005, 137, 176–189. [Google Scholar] [CrossRef]
  72. Jia, X.; Feng, H.; Bu, Y.; Ji, N.; Lyu, Y.; Zhao, S. Comparative transcriptome and weighted gene co-expression network analysis identify key transcription factors of Rosa chinensis ‘Old Blush’after exposure to a gradual drought stress followed by recovery. Front. Genet. 2021, 12, 690264. [Google Scholar] [CrossRef]
Agriculture 15 01733 g001
Figure 1. Images of plants taken during three subcultures in the in vitro drought stress.
Figure 1. Images of plants taken during three subcultures in the in vitro drought stress.
Agriculture 15 01733 g001
Agriculture 15 01733 g002
Figure 2. Response of plants to drought stress during the rooting stage.
Figure 2. Response of plants to drought stress during the rooting stage.
Agriculture 15 01733 g002
Agriculture 15 01733 g003
Figure 3. Gene expression levels in tissues of Matua and Hayward cultivars of WRKY TFs (Matua cultivar shown in gray and Hayward cultivar shown in black).
Figure 3. Gene expression levels in tissues of Matua and Hayward cultivars of WRKY TFs (Matua cultivar shown in gray and Hayward cultivar shown in black).
Agriculture 15 01733 g003
Agriculture 15 01733 g004
Figure 4. Gene expression levels in tissues of Matua and Hayward cultivars of WRKY TFs (Matua cultivar shown in gray and Hayward cultivar shown in black).
Figure 4. Gene expression levels in tissues of Matua and Hayward cultivars of WRKY TFs (Matua cultivar shown in gray and Hayward cultivar shown in black).
Agriculture 15 01733 g004
Table 1. Primers used in the study.
Table 1. Primers used in the study.
GenesForward PrimerReverse Primer
WRKY 3AGCGGGTCTAATGGTTCAAAGATGCTGATTGGTTGTTTCTGA
WRKY 9AGCAGAAGCAGCAGCAAAT CTCCAAAGTTGCTCCAGTGTG
WRKY 21TGACGCAGTCCGTGAACCGGACTTGGGAAGCTGAGGAG
WRKY 28CCAAGTGCAACGTGAAGAA GTTTTCGAGAGTAGGGACGATG
WRKY 41CCTTCTCCTTCCCTTCGACTAATGATCTCGGTGAGGTCAGA
WRKY47ACCTTGGTGTTGGCATCAGGCGGCCGAATAGTACATATCA
WRKY 65CAGAACCGCCTACCTCCTCCCGAGGTAGTGGAAGCAGAA
WRKY71GTGGTGATGGCGGTAAGAACCTTTCTTCCTCGGCTTGTT
18S rRNAGTCGTAACAAGGTTTCCGTAGGTCAAAGGGAAGAAAGAGTAGGGTT
Table 2. Effects of Hayward kiwi cultivar PEG treatments on micropropagation stage. Different letters are significant according to the LSD test (p ≤ 0.01).
Table 2. Effects of Hayward kiwi cultivar PEG treatments on micropropagation stage. Different letters are significant according to the LSD test (p ≤ 0.01).
CultivarsPEG 6000 (%)Plant HeightMultiplication RateNumber of LeavesFresh WeightDry Weight
Hayward02.25 a3.07 a14.00 a2.63 a0.26 a
11.51 b2.90 a10.50 b1.68 b0.16 b
21.22 c2.17 b9.93 b1.10 c0.11 c
31.19 c1.70 b7.00 c0.85 d0.07 d
LSDPlantheight: 0.096 LSDMultiplicationrate: 0.096 LSDNumberofleaves: 1.43 LSDFreshweight: 0.10 LSDDryweight: 0.01.
Table 3. Effects of Matua kiwi cultivar PEG treatments on micropropagation stage. Different letters are significant according to the LSD test (p ≤ 0.01).
Table 3. Effects of Matua kiwi cultivar PEG treatments on micropropagation stage. Different letters are significant according to the LSD test (p ≤ 0.01).
CultivarPEG 6000 (%)Plant HeightMultiplication RateNumber of LeavesFresh WeightDry Weight
Matua02.46 a3.30 a14.70 a3.02 a0.32 a
11.78 b3.10 a12.37 a1.77 b0.18 b
21.34 c2.13 b9.67 a1.18 c0.10 c
31.28 c1.87 b9.10 a1.01 c0.09 c
LSDPlantheight: 0.16 LSDMultiplicationrate: 0.34 LSDNumberofleaves: 1.46 LSDFreshweight: 0.01 LSDDryweight: 0.01.
Table 4. Effects of Hayvard kiwi cultivar PEG treatments on rooting stage. Different letters are significant according to the LSD test (p ≤ 0.01).
Table 4. Effects of Hayvard kiwi cultivar PEG treatments on rooting stage. Different letters are significant according to the LSD test (p ≤ 0.01).
CultivarPEG 6000 (%)Plant HeightNumber of RootRoot LengthNumber of LeafFresh WeightDry Weight
Hayward04.83 a10.78 a11.78 a10.61 a3.44 a0.40 a
10.94 b1.11 b1.36 b9.55 a0.44 b0.13 b
20.63 bc003.91 b00
3000000
LSDPlantheight: 0.38 LSDNumberofroot: 1.57 LSDRootlength: 1.36 LSDNumberofleaf: 1.72 LSDFreshweight: 0.33 LSDDryweight: 0.06.
Table 5. Effects of Matua kiwi cultivar PEG treatments on rooting stage. Different letters are significant according to the LSD test (p ≤ 0.01).
Table 5. Effects of Matua kiwi cultivar PEG treatments on rooting stage. Different letters are significant according to the LSD test (p ≤ 0.01).
CultivarPEG 6000 (%)Plant HeightMumber of RootRoot LengthMumber of LeafFresh WeightDry Weight
Matua04.50 a4.55 a6.41 a13.44 a2.33 a0.32 a
11.17 b0.75 b0.94 b9.06 a0.98 b0.15 b
20.77 b0.18 b0.19 b4.64 b0.32 c0.03 c
30.84 b008.67 ab0.38 bc0.07 bc
LSDPlantheight: 0.58 LSDKöksayısı: 1.20 LSDNumberofroo: 1.27 LSDNumberofleaf: 2.11 LSDFreshweight: 0.34 LSDDryweight: 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Açar, E.; Erol, M.H.; Aka Kaçar, Y. Investigation of Relationship Between Drought Stress Resilience and Some Wrky Transcription Factor Genes in Some Kiwi (Actinidia deliciosa) Cultivars. Agriculture 2025, 15, 1733. https://doi.org/10.3390/agriculture15161733

AMA Style

Açar E, Erol MH, Aka Kaçar Y. Investigation of Relationship Between Drought Stress Resilience and Some Wrky Transcription Factor Genes in Some Kiwi (Actinidia deliciosa) Cultivars. Agriculture. 2025; 15(16):1733. https://doi.org/10.3390/agriculture15161733

Chicago/Turabian Style

Açar, Emine, Mansur Hakan Erol, and Yıldız Aka Kaçar. 2025. "Investigation of Relationship Between Drought Stress Resilience and Some Wrky Transcription Factor Genes in Some Kiwi (Actinidia deliciosa) Cultivars" Agriculture 15, no. 16: 1733. https://doi.org/10.3390/agriculture15161733

APA Style

Açar, E., Erol, M. H., & Aka Kaçar, Y. (2025). Investigation of Relationship Between Drought Stress Resilience and Some Wrky Transcription Factor Genes in Some Kiwi (Actinidia deliciosa) Cultivars. Agriculture, 15(16), 1733. https://doi.org/10.3390/agriculture15161733

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop