Skip to Content
AgricultureAgriculture
  • Article
  • Open Access

6 June 2025

Effect of Ns Gene Dosage and Temperature on the Level of Potato Resistance to PVS

,
,
,
and
1
Plant Breeding and Acclimatization Institute—National Research Institute in Radzików, Młochów Division, Department of Potato Genetics and Parental Lines, Platanowa Str. 19, 05-831 Młochów, Poland
2
Plant Breeding and Acclimatization Institute—National Research Institute in Radzików, Jadwisin Division, Department of Potato Agronomy, Szaniawskiego Str. 15, 05-140 Serock, Poland
*
Author to whom correspondence should be addressed.

Abstract

The aim of this study was to verify the influence of the dosage of the gene Ns (simplex or duplex), derived from S. tuberosum subsp. Andigena, on potato resistance to PVS and to evaluate changes in the response of potatoes depending on the method of inoculation used and different cultivation temperatures. The analyses carried out made it possible to distinguish 42 clones in duplex and 8 in simplex form. The analysis showed that the Ns gene, even in simplex form, confers full resistance to PVS. Our results also suggest that an increase in temperature may weaken the resistance response of host plants carrying the Ns gene. In our research, PVS overcame the resistance conferred by the Ns gene at higher temperatures in three tetraploid clones: Ns-II-3, Ns-II-4 and Ns-II-81. These clones were classified as ‘temperature-dependent’ (TD). For clones Ns-II-6, Ns-II-10, Ns-II-40 and Ns-II-43, the increase in temperature had no effect on the resistance response of host plants carrying the Ns gene. These clones were classified as ‘resistant’ (R).

1. Introduction

Potato virus S belongs to the genus Carlavirus, family Betaflexiviridae, and is one of the most common and widespread potato viruses in the world [1,2,3]. Its virions are slightly flexible rod-shaped particles composed of multiple copies of the 33 kDa CP (coat protein) subunit. Although infected plants may often appear healthy, PVS infection can cause symptoms such as slight deepening of veins, wrinkling of leaves, and plant stunting. Yield losses range from 10% to 20% for PVS infection alone and up to 40% for mixed PVX and PVM infections [4]. The host range of PVS includes plant species from the Solanaceae and Chenopodiaceae families. Two types of potato virus S strains can be distinguished: common strains (PVSO), which are found throughout the world and are common strains in Europe (Germany, Poland, Central Europe) and Andean strains (PVSA), which are classified as quarantine parasites in Europe due to their much more severe reactions [5]. PVS can be easily transmitted both by contact between diseased and healthy plants and by aphids.
Viruses are a serious problem, not only because of the effects caused by primary infection but also because of transmission through the tubers to subsequent vegetative generations if the crop is vegetatively propagated. Losses may manifest themselves in lower yields, lower seed quality, and/or tuber defects, but the real costs also include expensive vector control measures. Although pesticides can be effective in controlling many pests and diseases (including vectors of potato viruses), they also have negative impacts on the environment, human health, and food security. Therefore, breeding and growing plants that are resistant to pest and diseases is the most economically viable and environmentally friendly way to control them. The spread of many viral potato diseases is very effectively controlled by the growing of potato cultivars possessing genes for hypersensitive response (HR) against potato viruses. Many of such genes have already been introduced into the cultivated potato gene pool and used in resistance breeding [6].
Temperature is one of the most important factors modeling the plant–pathogen interactions and the normal development of healthy plants [7,8,9]. Future changes in environmental conditions [10], especially temperature of the air, will affect plants, populations of the vectors that contribute to the spread of pathogens, and, consequently, plant diseases [11,12].
The importance of temperature as a factor influencing the progress of plant diseases will increase as the climate change models predict a progressive increase in global mean temperature by 4.6 °C by the year 2100 [13]. The dynamics of plant virus epidemics and the losses that they cause are likely to be strongly influenced by the direct effects of climate change [14]. So far, the literature shows conflicting data on temperatures favoring viral replication, with the exact result depending on the tested virus species tested as well as the plant host analyzed [15,16,17]. The objectives of this study were a) to verify the influence of the dosage of the Ns gene, derived from S. tuberosum subsp. andigena, on the potato resistance to PVS and b) to evaluate changes in the response of potato plants carrying the Ns resistance gene depending on the method of inoculation with PVS and on different cultivation temperatures.

2. Materials and Methods

2.1. Plant Material

The first stage of the research was to assess resistance to PVS in the unselected Ns-II population, consisting of 100 tetraploid potato clones (Table 1). A family of tetraploid clones (4x) was obtained from a cross between PVS resistant potato clones PS-1723 and PW-363. The source of PVS resistance was derived from S. tuberosum subsp. andigena. Both clones were generated within a parental line breeding program at the Plant Breeding and Acclimatization Institute—National Research Institute in Radzików, Department in Młochów. The resistance of the progeny clones to PVS was tested under greenhouse conditions (temperature was not controlled). The clones were mechanically inoculated with the PVS and tested for the presence of the virus after inoculation and in tuber progeny plants using the DAS-ELISA test. Based on the results obtained from the mechanically inoculated plants, seven resistant clones and one susceptible clone (treated as a control) were selected for detailed experiments. In our study, two standard cultivars, Sonda (resistant to PVS, with Ns gene) and Etola (susceptible to PVS, without Ns gene), were tested, along with the eight examined clones. In addition, the parental clones PS-1723 and PW-363 (resistant to PVS, with Ns gene) were evaluated in detailed experiments (Table 1).
Table 1. Plant material used in experiments.

2.2. PVS Isolates

Isolate S-923 of PVS was used for the inoculation of potato plants in all resistance tests carried out in this study. Two isolates, S-923 and S-966, were used for detailed analysis. S-923 is the PVS isolate Ewa (PVSO strain, NCBI GenBank accession LN851194.1) [18]. Isolate S-966 (PVSO strain) is from the IHAR-PIB collection. Isolate S-923 was found in the Polish cv. Leon and isolate S-966 in Polish cv. Bursztyn.

2.3. Preparation of the Virus Source

Isolate PVS was maintained and propagated in tomato plants Solanum lycopersicum cv. ‘Nevskij’. Tomato seeds were sown in the greenhouse in boxes filled with peat. Twelve days after sowing, the young plants were transplanted into 8 cm diameter pots filled with peat. Tomato plants with 3 to 4 true leaves were inoculated with isolates of PVS. Mechanical inoculation potato plants was performed using sap from systemically infected tomato leaf tissues that were diluted in sterile water according to Santillan et al. [19].

2.4. Potato Plants

Potato tubers were pre-sprouted in the light without chemical dormancy breakers or growth retardants. Seed potato tubers were first tested for the presence of viruses, for example, PVY, PVM, PVS, and PLRV, by ELISA in a growing-on test. Only virus-free, healthy tubers were used for multiplication of the potato test plants. Tubers with sprouts (about 1 cm long) were transferred to pots (8 cm in diameter) in the greenhouse. Between seasons, the tubers were stored in a dark chamber with controlled conditions (temperature 5 °C; humidity 95 °C), from September to April.

2.5. Mechanical and Graft Inoculation of Plants

Virus-free potato tubers of the tested clones and standard cultivars were planted in April in pots (9 cm in diameter) and grown under greenhouse conditions until PVS inoculation. Two methods inoculation: mechanical and graft were used. For mechanical inoculation, the young potato plants (with 3–4 leaves) were dusted with carborundum and then rubbed with a sponge soaked with virus inoculum. After 15 min, the inoculated plants were rinsed with tap water. Inoculation was carried out under greenhouse conditions [20]. The second method of inoculation was grafting. The scions were collected from tomato plants infected with PVS (the presence of PVS was confirmed by the ELISA test) [20]. Grafting was carried out in May under greenhouse conditions. The mechanically and graft-inoculated plants were transferred to separate growth chambers and maintained at temperatures of 20 °C and 28 °C (photoperiod, 16 h light at 100 µmol ·m−2 ·s−1). For each inoculation experiment, five plants per clone/cultivar were inoculated with PVS and one mock-inoculated plant (inoculation with water) was used as a control. The presence of PVS in the inoculated plants (and control) was verified serologically by a DAS-ELISA test six weeks after mechanical inoculation and four weeks after grafting inoculation (primary infection). The clones, with mean absorbance values not higher than the threshold value, were classified as highly resistant. To verify the level of resistance of the tested clones, the evaluation of the secondary infected plants (daughter tuber progeny plants) was carried out as follows:
1.
At the end of the vegetative period, tubers were collected separately from each inoculated (mechanical and grafted) and control plant;
2.
The following year, the pre-sprouted tubers were planted in pots in a greenhouse and six weeks after planting, the presence of the virus was again verified by DAS-ELISA. Clones were classified in the same way as for primary infected plants.

2.6. PVS Detection—Serological Test

The serological test was performed by DAS-ELISA using monoclonal antibodies against PVS (Neogen Europe Ltd.—ADGEN Phytodiagnostics, Ayr, UK), according to the manufacturer’s recommendations. One sample from each plant consisted of the tissue taken from the upper uninoculated leaves. The leaf sap extracted from each sample was diluted 1:4 with extraction buffer (0.057 M K2HPO4, pH 8.0). Absorbance readings at 405 nm were recorded using an ELISA reader (Dynex MRX II; Dynex Technologies, Inc., Chantilly, VA, USA) 1 and 2 h after the addition of the substrate. The clones/cultivars for which the mean absorbance values did not exceed the threshold value were considered to be resistant. The threshold value was the mean plus three standard deviations of the absorbance values from uninoculated control plants.

2.7. Gene

The determination of the dose of the Ns dominant allele at the DNA level was performed on the basis of the genomic sequence of the Ns gene marker (GenBank Accession No. DQ415915) using qPCR [21,22]. The experiment was performed on genomic DNA, as previously described [23]. DNA was isolated using a ready-to-use plant DNA isolation kit, based on gravity ion exchange membranes (Genomic Mini AX Plant; A&A Biotechnology, Gdańsk, Poland). The DNA extracts were then determined using a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and on a 1% agarose gel stained with ethidium bromide. In all cases, approximately 4.8 µg of good-quality, non-degraded DNA was obtained. Samples were then diluted and standardized to a concentration of 0.1 µg/µL. For the DNA marker of the dominant allele of the Ns under investigation, the following primers were used: F (5′-3′): GCAATACATGTATTCTTACTCGG and R (5′-3′): GACCTATATCAGTCCCTTCTAATCCACTAT. They amplify a product of 489 bp. (base pairs) length. To determine the amount of the tested marker product, ready-to-use EvaGreen® (A&A Biotechnology, Gdańsk, Poland) hot start real-time PCR mix kits were used. Reactions were performed in a 10 µL reaction mixture with the addition of 100 ng of template DNA and 5 µM of each primer. Marker amplification was performed under the following temperature conditions: 95 °C (3 min), 40× ((95 °C (20 s); 60 °C (20 s); 72 °C (30 s)); melting curve, 79.8 °C. All analyses of qPCR results were performed in a LightCycler® 480 thermal cycler (Roche, Basel, Switzerland). Analyses of fluorescence levels obtained from real-time PCR were performed using the LightCycler® 480 SW 1.5 computer program. Three PCRs were performed for each of the DNA samples. The control for the DNA duplex form of the Ns gene was the colchicine-induced diploid clone DW 83-3121. Colchicine was used to double the number of chromosomes in this clone.

3. Results

3.1. Segregation of Resistance to PVS

Out of 100 F1 clones tested, 80 clones were resistant to PVS and 20 were susceptible after mechanical inoculation in primary infection. The segregation ratio of 3:1 confirmed the presence of a single, dominant gene for extreme resistance to PVS in the simplex state in the tetraploid parental clones PS-1723 and PW-363. In secondary infection, 65 clones were resistant and 15 were susceptible. The mean values and the range of A405 for the clones evaluated in primary and secondary infection are presented in Table 2. The parental clones (PS-1723 and PW-363) and cv. Sonda with gene Ns confirmed a high level of resistance to PVS. The mean A405 values for the parental clones and cv. Sonda ranged from 0.001 to 0.008 (Figure 1).
Table 2. The mean values and the range of A405 for the clones evaluated in primary and secondary infection.
Figure 1. Mechanical inoculation PVS (primary and secondary infection): mean values A405 and ranges for clones resistant and susceptible to PVS, parental clones, and standard cv. Sonda (Ns); N = number evaluated clones.

3.2. Ns Gene Dosage in Potato Clones from Population Ns-II

Sixty-five potato clones from the Ns-II population were used to evaluate the dosage of the Ns gene using real-time PCR (Figure 2). The diploid clone DW 83-3121 was used as a model of the duplex form of the Ns gene. In this clone, the number of chromosomes was doubled by colchicine treatment. Among 65 potato clones, 42 Ns-duplex forms and 8 Ns-simplex forms were identified. Fifteen potato clones had an undefined number of chromosomes (Table 3).
Figure 2. (A) Curves obtained from real-time PCR by using EvaGreen® dye for simplex, duplex, and susceptible forms. (B) The melting curves of the products of the real-time PCR.
Table 3. Division of clones of the population Ns-II depending on the mean values of the threshold cycle (Ct) and 2−ΔCt (ΔCt = Ct for the tested samples; mean Ct for the samples PW-363).
(A)
The real-time PCR amplification curves produced, revealed using EvaGreen® dye: (+) simplex form; (++) duplex form; (sample -) susceptible clone and NC (negative control).
(B)
The melting curves of the products of the real-time PCR shown by the use of EvaGreen dye:
-
The blue lines correspond to the melting point of the tested PCR product for the sample.
-
The red lines show the melting curve of the non-specific product for susceptible clone (sample -) and water (NC, negative control).

3.3. Effect of the Cultivation Temperatures on the Resistance Reaction to Two PVS Isolates—Mechanical Inoculation (Primary and Secondary Infection)

The effect of two cultivation temperatures (20 °C and 28 °C) on the resistance response to two PVS isolates (S-966 and S-923) in potato tetraploid clones, parental clones, and standard cultivars was studied. In a detailed experiment, eight tetraploid clones from population Ns-II were used. Among these clones were six clones with gene Ns in duplex form, one clone undetermined, one clone without gene Ns, parental clones in simplex form, resistant cultivar Sonda in simplex form, and susceptible cultivar Etola without gene Ns (Table 4 and Table 5). For four clones: Ns-II-6, Ns-II-10, Ns-II-40 and Ns-II-43 there was temperature had no effect on PVS titer. For these clones, PVS was not detected at any incubation temperature in either primary or secondary infection (Table 4 and Table 5). The clones were classified as ’resistant’ (R). For the ‘resistant’ clone Ns-II-6, HR was observed after mechanical inoculation. Necrotic spots were observed when using two different temperatures and isolates of PVS. The character of the necrotic spots depended on the incubation temperature. Some small necrotic spots were observed in mechanically inoculated leaves after 14 days at 20 °C, and larger necrotic spots formed at 28 °C (Figure 3). For the other three tetraploid clones: Ns-II-3, Ns-4-II, and Ns-II-81 an effect of temperature on PVS titer was observed. For these clones, PVS was detected at 28 °C but not at 20 °C. Therefore, high temperature promoted the infection of development and spread of PVS in these plants. The virus was detected at 28 °C, using both PVS isolates in primary and secondary infection (Table 4 and Table 5).
Table 4. Evaluation of resistance to PVS of the chosen clones/cultivars in mechanical inoculation with two isolates (S-966 and S-923) and at two temperatures (20 °C and 28 °C). Mean value A405 for results of primary infection.
Table 5. Evaluation of resistance to PVS of the chosen clones/cultivars in mechanical inoculation with two isolates (S-966 and S-923) and at two temperatures (20 °C and 28 °C). Mean value A405 for results of secondary infection.
Figure 3. Effect of temperature on the development of necrotic spots in the leaflet of resistant clone Ns-II-6 (duplex) after inoculation with one of the two isolates PVS. Small, pinhole-like necrotic spots appeared at 14 days at 28 °C after mechanical inoculation (primary infection).
These clones were classified as ‘temperature dependent’ (TD). In two clones belonging to this group (TD), Ns-II-3 and Ns-II-4, mosaic and necrosis were observed on the upper leaves of the plants in secondary infection at 28 °C (Figure 4 and Figure 5). Clone Ns-II-11 was classified as ‘susceptible’ (S). After mechanical inoculation, PVS was detected in its leaflets at 20 °C and 28 °C (Table 4 and Table 5). For this clone, a very strong mosaic was observed in secondary infection (Figure 6). PVS was not detected in the parental clones and in the resistant standard cultivar Sonda and this effect was observed independently of temperature. With the use of both strains, S-966 and S-923, the same level of resistance was observed for parental clones and standard cultivars (Table 4 and Table 5). It was found that the dosage of the Ns gene in the evaluated clones did not influence the level of resistance to PVS. After analyzing the values A405 of the DAS-ELISA for the clones of both groups (duplex and simplex), it can be stated that it is not justified to create multiplex forms with regard to the Ns gene. The Ns gene in simplex form in tetraploid clones gives full resistance to PVS.
Figure 4. Systemic symptoms in secondary infection of ‘temperature-dependent’ potato clone Ns-II-3 at mechanical inoculated with isolate S-966 under high temperature: (A) mosaic and (B) necrosis on upper leaves of plants grown in a chamber at 28 °C at six weeks after plantation.
Figure 5. Systemic symptoms in secondary infection of ‘temperature-dependent’ potato clone Ns-II-4 mechanically inoculated with isolate S-966 under high temperature: (A) mosaic and (B) necrosis on upper leaves of plants grown in a chamber at 28 °C at six weeks post-planted.
Figure 6. Systemic symptoms (mosaic) in secondary infection on ‘susceptible’ potato clone Ns-II-11, which was mechanically inoculated with isolate S-966 and incubated at 28 °C. Symptoms six weeks post-planting.

3.4. Effect of Cultivation Temperatures on the Resistance Reaction to Two PVS Isolates—Graft Inoculation

Graft inoculation was carried out in a climatic chamber at controlled temperatures of 20 °C and 28 °C. The same eight tetraploid clones, parental clones, and standard cultivars were inoculated by grafting. For clones Ns-II-6, Ns-II-10, Ns-II-40 and Ns-II-43 of the ‘resistant’ group, PVS was not detected in either temperature in primary and secondary infection, as was the case in mechanical inoculation (Table 6 and Table 7). For clones Ns-II-3, Ns-4-II and Ns-II-81 of the ‘temperature-dependent’ group, the influence of temperature on PVS titer was observed. In these clones, PVS was detected at 28 °C but not at 20 °C (Table 6 and Table 7). In two clones of this group, Ns-II-3 (Figure 7) and Ns-II-4, very severe necrosis was observed in secondary infection using isolate S-966. In clone Ns-II-11, from the ‘susceptible’ group, PVS was observed after grafting at 20 °C and 28 °C (Table 6 and Table 7). Very severe necrosis was observed in the susceptible clones in the secondary infection (Figure 7). In graft inoculation, PVS was not detected in the parental clones and in the resistant cultivar Sonda (Table 6 and Table 7).
Table 6. Evaluation of resistance to PVS of the chosen clones/cultivars graft inoculated by with two isolates (S-923 and S-966) and at two temperatures (20 °C and 28 °C). Mean value A405 for results of primary infection.
Table 7. Evaluation of resistance to PVS of the chosen clones/cultivars, graft inoculated with two isolates (S-923 and S-966) and at two temperatures (20 °C and 28 °C). Mean value A405 for results of secondary infection.
Figure 7. Systemic symptoms (necrosis) in secondary infection in ‘temperature-dependent’ potato clone Ns-II-3 evaluated after graft inoculation with isolate S-966 and incubation at 28 °C. Symptoms six weeks post-planting.

4. Discussion

One of the key environmental factors influencing plant–virus interactions is temperature, which, according to climate change scenarios, is likely to increase during the potato growing season [24]. Heat stress can significantly but differentially affect plant–pathogen interactions by modulating host defense responses [25,26].
In some cases, higher temperatures improve plant tolerance to viral diseases during the late stages of infection, leading to a recovery from symptoms in the newly formed leaves [27,28,29,30,31]. In other cases, higher temperatures weaken plant defense responses or increase virus accumulation, resulting in more severe symptoms at both the early and late stages of infection [32,33,34].
In this study, the response of potato clones carrying the Ns gene from S. tuberosum subsp. andigena to inoculation with PVS and incubation at different temperature regimes (20 °C and 28 °C) was evaluated. Plants carrying the resistance gene Ns express two types of resistance response, i.e., extreme resistance (ER) and hypersensitive resistance (HR), which are controlled by R and N genes, respectively [35]. Our results suggest that the increase in temperature may weaken the activity of the Ns gene. At high temperature, PVS can multiply, increasing the risk of occurrence of resistance-breaking viruses. PVS was able to overcome resistance at higher temperatures in three tetraploid clones: Ns-II-3, Ns-II-4 and Ns-II-81 after mechanical or graft inoculation. For these clones, the virus was detected at 28 °C, using both isolates of PVS in primary and secondary infection. These clones were classified as ‘temperature-dependent’ (TD). For clones Ns-II-3 and Ns-II-4 in secondary infection at 28 °C, mosaic and necrosis were observed on upper leaves of the plants. For four clones: Ns-II-6, Ns-II-10, Ns-II-40 and Ns-II-43 the increase in temperature had no effect on the activity of the Ns gene. For these clones, PVS was not detected at any incubation temperature in either primary or secondary infection. These clones were classified as ’resistant’ (R). For one of them, Ns-II-6, HR was observed after mechanical inoculation. Necrotic spots were observed at two temperatures and two isolates. The nature of the necrotic spots differed according to the temperature. A few small necrotic spots were observed at 20 °C, and more at 28 °C. Studying the immune response of the selected eight clones over time and perhaps over a wider range of temperatures would provide a more complete picture of the changes taking place. Nevertheless, understanding the molecular mechanisms by which temperature may suppress Ns-dependent immunity requires further research at the cellular level.
The interaction between temperature and viral infections has been studied extensively for many different viruses. For example, research by Ohki et al. [17] suggests that an increase in temperature may weaken the activity of the Rychc gene. However, Tatarowska et al. [20] found that resistance to PVM conferred by the Rm gene is also temperature-dependent; in plants incubated at 20 °C, the virus was present in both grafted plants and tuber progeny, whereas complete inhibition of virus multiplication was observed in plants incubated at 28 °C. Nie et al. [16] observed HR on potato after inoculation with strain PVYO at both temperatures 22 °C and 30 °C, but systemic symptoms on the leaves only at 30 °C. Valkonen [36] observed at HR at low temperatures (16/18 °C) on plants of S. sparsipilum and S. sucrense inoculated with necrotic strain PVYN, as well as in plants of cv. Pito inoculated with strain PVYO. Systemic infection developed at 19/24 °C. A similar change in resistance related to HR was observed at higher temperatures in potato plants with the Ny-1N, Ny-1A, Ny-1S, and Ny-DG genes, which were inoculated with different strains of PVY [23,37]. Tobacco mosaic virus (TMV) infection of N-containing tobacco induces the HR within 48 h of infection, and virus particles are restricted to the region immediately surrounding the induced necrotic lesions. The HR to TMV is observed at temperatures above 28 °C [38].
The second aim of our study was to verify the influence of the dosage of the Ns gene on the potato resistance to PVS. The Ns gene is relatively easy to use in breeding programs. By using the most important resistance genes, it is possible to increase the efficiency of selection by increasing the frequency of resistant forms in the progeny. In the progeny of a genotype containing the desired gene in simplex form, 50% of the progeny can be expected to carry that gene. Using the parental form in crossbreeding with the resistance gene in the form of duplex with the nulliplex increases the percentage of progeny with resistance to over 80%. Crossing two clones with the resistance gene in the form of a duplex increases in resistant progeny to nearly 100% [39]. On the other hand, in the progeny of the triplex and quadruplex forms in relation to the searched resistance gene, we obtain almost 100% resistant forms. In such a case, the selection for the trait can be omitted. Identification of forms with an increased gene dosage is an element of genetic characterization of parental forms. For breeders, such an approach facilitates the selection of appropriate components for crossbreeding.
In the case of incomplete dominance, the dose of the dominant allele can be assessed based on the phenotype, whereas in the case of complete dominance, the dose of the dominant allele can only be determined based on the segregation of the trait in the progeny [40]. The conventional method of assessing the dose of resistance genes is to cross the resistant form with a susceptible one and to estimate the frequency of resistant clones in the progeny [41]. The use of molecular markers to identify the gene in the evaluated clones is faster and often cheaper. In the research of Ribeiro et al. [42], sixty-two clones were identified as PVY-immune by grafting. The SCAR marker RYSC3 allowed the identification of two duplex clones for the Ry allele (RyRyryry), which can be used as parents to produce progeny with approximately 80% PVY immunity in crosses with susceptible clones. As a result of their crosses, clones with an increased dose of the Ryadg gene (triplex/quadruplex) were obtained [43]. In our investigation, clones from the unselected population of Ns-II, derived from crosses of PVS-resistant parental clones, were evaluated for resistance to PVS in a phenotyping test. In this population, a 3:1 segregation of resistance clones was observed. This result suggests that the parental forms have the Ns gene in a simplex form, suggesting that among the selected clones resistant to PVS, both simplex and duplex forms can be expected in terms of the Ns gene. Szajko et al. [23] identified a dose of the Ny-1 gene that induces HR in PVY-infected potato plants using the real-time PCR with SYBR Green dye. In our study, the more sensitive EvaGreen® dye was used to assess the amplification of the Ns gene marker (with primer sequences modified for the qPCR). The performed analyses allowed 42 clones in duplex form and 8 in simplex form to be distinguished. It was found that the dose of the Ns gene in the evaluated clones had no influence on the level of resistance to PVS. Analysis of the A405 DAS-ELISA values for the tetraploid clones of both groups (duplex and simplex) shows that the Ns gene also confers full resistance to PVS in the simplex form.

Author Contributions

Conceptualization, B.T.; methodology, B.T. and K.S.; software, B.T.; validation, B.T., D.M. and J.P.; formal analysis, B.T.; investigation, B.T.; resources, B.T.; data curation, B.T., D.M., J.P. and D.B.-M.; writing—original draft preparation, B.T.; writing—review and editing, B.T., K.S., D.M., J.P. and D.B.-M.; visualization, B.T.; supervision, B.T.; project administration, B.T.; funding acquisition, B.T. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the project BH 4-3-00-3-03 of the Ministry of Agriculture and Rural Development.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. King, A.M.; Lefkowitz, E.; Adams, M.J.; Carstens, E.B. (Eds.) Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier: Amsterdam, The Netherlands, 2011; Volume 9, ISBN 978-0-12-384684-6. [Google Scholar]
  2. Duan, G.; Zhan, F.; Du, Z.; Ho, S.Y.; Gao, F. Europe was a hub for the global spread of potato virus S in the 19th century. Virology 2018, 525, 200–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Kreuze, J.F.; Souza-Dias, J.A.C.; Jeevalatha, A.; Figueira, A.R.; Valkonen, J.P.T.; Jones, R.A.C. Viral Diseases in Potato. In The Potato Crop; Campos, H., Ortiz, O., Eds.; Springer: NewYork, NY, USA, 2020; pp. 389–430. [Google Scholar]
  4. Stevenson, W.R.; Loria, R.; Franc, G.D.; Weingartner, D.P. Compendium of Potato Diseases, 2nd ed.; American Phytopathological Society, Press: St. Paul, MN, USA, 2001. [Google Scholar]
  5. Cox, B.A.; Jones, R.A.C. Genetic variability of the coat protein gene of Potato virus S and distinguishing its biologically distinct strains. Arch. Virol. 2010, 155, 1163–1169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Zimnoch-Guzowska, E.; Yin, Z.; Chrzanowska, M.; Flis, B. Sources and effectiveness of potato PVY resistance in IHAR’s breeding research. Am. J. Potato Res. 2013, 90, 21–27. [Google Scholar] [CrossRef] [Scilit]
  7. Chung, B.N.; Canto, T.; Tenllado, F.; Choi, K.S.; Joa, J.H.; Ahn, J.J.; Kim, C.H.; Do, K.S. The effects of high temperature on infection by Potato virus Y, Potato virus A, and Potato leafroll virus. Plant Pathol. J. 2016, 32, 321. [Google Scholar] [CrossRef] [Scilit]
  8. Obrępalska-Stęplowska, A.; Renaut, J.; Planchon, S.; Przybylska, A.; Wieczorek, P.; Barylski, J.; Palukaitis, P. Effect of temperature on the pathogenesis, accumulation of viral and satellite RNAs and on plant proteome in peanut stunt virus and satellite RNA-infected plants. Front. Plant Sci. 2015, 6, 903. [Google Scholar] [CrossRef] [Scilit]
  9. Del Toro, F.J.; Aguilar, E.; Hernandez-Walias, F.J.; Tenllado, F.; Chung, B.N.; Canto, T. High temperature, high ambient CO2 affect the interactions between three positive-sense RNA viruses and a compatible host differentially, but not their silencing suppression efficiencies. PLoS ONE 2015, 10, e0136062. [Google Scholar] [CrossRef] [Scilit]
  10. Li, J.; Lin, X.; Chen, A.; Peterson, T.; Ma, K.; Bertzky, M.; Poulter, B. Global priority conservation areas in the face of 21st century climate change. PLoS ONE 2013, 8, e54839. [Google Scholar] [CrossRef] [Scilit]
  11. Suzuki, N.; Rivero, R.M.; Shulaev, V.; Blumwald, E.; Mittler, R. Abiotic and biotic stress combinations. New Phytol. 2014, 203, 32–43. [Google Scholar] [CrossRef] [Scilit]
  12. Ashoub, A.; Baeumlisberger, M.; Neupaertl, M.; Karas, M.; Brüggemann, W. Characterization of common and distinctive adjustments of wild barley leaf proteome under drought acclimation, heat stress and their combination. Plant Mol. Biol. 2015, 87, 459–471. [Google Scholar] [CrossRef] [Scilit]
  13. IPCC. Climate Change 2023: Synthesis Report. Contribution of Working Groups I, II and III to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; Core Writing Team, Lee, H., Romero, J., Eds.; IPCC: Geneva, Switzerland, 2023; 184p, Available online: https://www.ipcc.ch/report/ar6/syr/downloads/report/IPCC_AR6_SYR_FullVolume.pdf (accessed on 3 June 2025).
  14. Jones, R.A. Plant virus emergence and evolution: Origins, new encounter scenarios, factors driving emergence, effects of changing world conditions, and prospects for control. Virus Res. 2009, 141, 113–130. [Google Scholar] [CrossRef] [Scilit]
  15. Szajko, K.; Chrzanowska, M.; Witek, K.; Strzelczyk-Żyta, D.; Zagórska, H.; Gebhardt, C.; Hennig, J.; Marczewski, W. The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance. Theor. Appl. Genet. 2008, 116, 297–303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Nie, X.; Liang, Z.; Nie, B.; Murphy, A.; Singh, M. Studies on varietal response to different strains of Potato virus Y (PVY) reveal hypersensitive resistance in Exploits to PVYO and extreme resistance in F87084 to all tested strains. Am. J. Potato Res. 2015, 92, 23–31. [Google Scholar] [CrossRef] [Scilit]
  17. Ohki, T.; Sano, M.; Asano, K.; Nakayama, T.; Maoka, T. Effect of temperature on resistance to Potato virus Y in potato cultivars carrying the resistance gene. Rychc. Plant Pathol. 2018, 67, 1629–1635. [Google Scholar] [CrossRef] [Scilit]
  18. Pájtli, É. Whole Genome Molecular Analysis of Potato Virus S(PVS) Isolates. Ph.D. Thesis, Corvinus University of Budapest, Budapest, Hungary, 2015. [Google Scholar]
  19. Santillan, F.W.; Fribourg, C.E.; Adams, I.P.; Gibbs, A.J.; Boonham, N.; Kehoe, M.A.; Maina, S.; Jones, R.A.C. The biology and phylogenetics of Potato virus S isolates from the Andean region of South America. Plant Dis. 2018, 102, 869–885. [Google Scholar] [CrossRef] [Scilit]
  20. Tatarowska, B.; Plich, J.; Milczarek, D.; Flis, B. Temperature-dependent resistance to potato virus M in potato (Solanum tuberosum). Plant Pathol. 2020, 69, 1445–1452. [Google Scholar] [CrossRef] [Scilit]
  21. Witek, K.; Strzelczyk-Żyta, D.; Hennig, J.; Marczewski, W. A multiplex PCR approach to simultaneously genotype potato towards the resistance alleles Ry-fsto and Ns. Mol. Breed. 2006, 18, 273–275. [Google Scholar] [CrossRef] [Scilit]
  22. Szajko, K.; Chrzanowska, M.; Strzelczyk-Żyta, D.; Zagórska, H.; Marczewski, W. Endonuclease restriction of SCAR amplicons SC811 is required to identify Ns-false-positive markers in PVS-susceptible potato cultivars. J. Appl. Genet. 2008, 49, 45–48. [Google Scholar] [CrossRef] [Scilit]
  23. Szajko, K.; Sołtys-Kalina, D.; Szarzyńska, B.; Strzelczyk-Żyta, D.; Szweykowska-Kulinska, Z.; Marczewski, W. A comparative proteomic analysis of the PVY-induced hypersensitive response in leaves of potato (Solanum tuberosum L.) plants that differ in Ny-1 gene dosage. Eur. J. Plant Pathol. 2019, 153, 385–396. [Google Scholar] [CrossRef] [Scilit]
  24. Torrance, L.; Talianksy, M.E. Potato Virus Y Emergence and Evolution from the Andes of South America to Become a Major Destructive Pathogen of Potato and Other Solanaceous Crops Worldwide. Viruses 2020, 12, 1430. [Google Scholar] [CrossRef] [Scilit]
  25. Makarova, S.; Makhotenko, A.; Spechenkova, N.; Love, A.J.; Kalinina, N.O.; Taliansky, M. Interactive responses of potato (Solanum tuberosum L.) plants to heat stress and infection with potato virus Y. Front. Microbiol. 2018, 9, 2582. [Google Scholar] [CrossRef] [Scilit]
  26. Prasch, C.M.; Sonnewald, U. Simultaneous application of heat, drought, and virus to Arabidopsis plants reveals significant shifts in signaling networks. Plant Physiol. 2013, 162, 1849–1866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Siddiqui, S.A.; Sarmiento, C.; Kiisma, M.; Koivumäki, S.; Lemmetty, A.; Truve, E.; Lehto, K. Effects of viral silencing suppressors on tobacco ringspot virus infection in two Nicotiana species. J. Gen. Virol. 2008, 89, 1502–1508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Velázquez, K.; Renovell, A.; Comellas, M.; Serra, P.; García, M.L.; Pina, J.A.; Navarro, L.; Moreno, P.; Guerri, J. Effect of temperature on RNA silencing of a negative-stranded RNA plant virus: Citrus psorosis virus. Plant Pathol. 2010, 59, 982–990. [Google Scholar] [CrossRef] [Scilit]
  29. Zhang, X.; Zhang, X.; Singh, J.; Li, D.; Qu, F. Temperature-dependent survival of Turnip crinkle virus-infected arabidopsis plants relies on an RNA silencing-based defense that requires DCL2, AGO2, and HEN1. J. Virol. 2012, 86, 6847–6854. [Google Scholar] [CrossRef] [Scilit]
  30. Ghoshal, B.; Sanfaçon, H. Temperature-dependent symptom recovery in Nicotiana benthamiana plants infected with tomato ringspot virus is associated with reduced translation of viral RNA2 and requires ARGONAUTE 1. Virology 2014, 456, 188–197. [Google Scholar] [CrossRef] [Scilit]
  31. Zhao, F.; Li, Y.; Chen, L.; Zhu, L.; Ren, H.; Lin, H.; Xi, D. Temperature dependent defense of Nicotiana tabacum against cucumber mosaic virus and recovery occurs with the formation of dark green islands. J. Plant Biol. 2016, 59, 293–301. [Google Scholar] [CrossRef] [Scilit]
  32. Király, L.; Hafez, Y.M.; Fodor, J.; Király, Z. Suppression of tobacco mosaic virus-induced hypersensitive-type necrotization in tobacco at high temperature is associated with downregulation of NADPH oxidase and superoxide and stimulation of dehydroascorbate reductase. J. Gen. Virol. 2008, 89, 799–808. [Google Scholar] [CrossRef] [Scilit]
  33. Anfoka, G.; Moshe, A.; Fridman, L.; Amrani, L.; Rotem, O.; Kolot, M.; Zeidan, M.; Czosnek, H.; Gorovits, R. Tomato yellow leaf curl virus infection mitigates the heat stress response of plants grown at high temperatures. Sci. Rep. 2016, 6, 19715. [Google Scholar] [CrossRef] [Scilit]
  34. Honjo, M.N.; Emura, N.; Kawagoe, T.; Sugisaka, J.; Kamitani, M.; Nagano, A.J.; Kudoh, H. Seasonality of interactions between a plant virus and its host during persistent infection in a natural environment. ISME J. 2020, 14, 506–518. [Google Scholar] [CrossRef] [Scilit]
  35. Marczewski, W.; Ostrowska, K.; Zimnoch-Guzowska, E. Identification of RAPD markers linked to the Ns locus in potato. Plant Breed. 1998, 117, 88–90. [Google Scholar] [CrossRef] [Scilit]
  36. Valkonen, J.P.T. Novel resistances to four potyviruses in tuber-bearing potato species, and temperature-sensitive expression of hypersensitive resistance to potato virus Y. Ann. Appl. Biol. 1997, 130, 91–104. [Google Scholar] [CrossRef] [Scilit]
  37. Szajko, K.; Strzelczyk-Żyta, D.; Marczewski, W. Ny-1 and Ny-2 genes conferring hypersensitive response to potato virus Y (PVY) in cultivated potatoes: Mapping and marker-assisted selection validation for PVY resistance in potato breeding. Mol. Breed. 2014, 34, 267–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Erickson, F.L.; Dinesh-Kumar, S.P.; Holzberg, S.; Ustach, C.V.; Dutton, M.; Handley, V.; Corr, C.; Baker, B.J. Interactions between tobacco mosaic virus and the tobacco N gene. Philos. Trans. R. Soc. London. Ser. B Biol. Sci. 1999, 354, 653–658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Toxopeus, H.J. On the significance of multiplex parental material in breeding for resistance to some disease in the potato. Euphytica 1953, 2, 139–146. [Google Scholar] [CrossRef] [Scilit]
  40. Kaeppler, S. Heterosis: Many genes, many mechanisms—End the search for an undiscovered unifying theory. Int. Sch. Res. Not. 2012, 2012, 682824. [Google Scholar] [CrossRef] [Scilit]
  41. Slater, A.T.; Cogan, N.O.I.; Hayes, B.J.; Schultz, L.; Dale, M.F.B.; Bryan, G.J.; Forster, J.W. Improving breeding efficiency in potato using molecular and quantitative genetics. Theor. Appl. Genet. 2014, 127, 2279–2292. [Google Scholar] [CrossRef] [Scilit]
  42. Ribeiro, A.M.; Pinto, C.A.B.P.; Andrade, C.M.; dos Santos, J.B.; dos Reis Figueira, A. SCAR marker for the selection of Ry-duplex potato clones immune to potato virus Y. Crop Breed. Appl. Biotechnol. 2006, 6, 1–8. [Google Scholar] [CrossRef] [Scilit]
  43. Andrade, C.M.; Pinto, C.A.B.P.; de Paula Ribeiro, S.R.R.; Peixouto, L.S.; Santos, L. Potato clones with multiple copies of the Ryadg allele conferring resistance to PVY. Crop Breed. Appl. Biotechnol. 2009, 9, 286–292. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.