Morphological, Anatomical, Physiological and Genetic Studies of Iris aphylla L. Wild Species Conservation in “Ex Situ” Conditions
Abstract
1. Introduction
2. Materials and Methods
2.1. Site Description and Sampling
2.2. Identification of Morphological Characters
2.3. Anatomical Study
2.4. Determination of Photosynthetic Pigments
2.5. DNA Extraction, Amplification and Sequencing
2.6. Phylogenetic Analysis and Plant Genotyping
3. Results
3.1. Species Description and Distribution
3.2. Morphological Characters
3.3. Study of Anatomical Structure
3.4. Photosynthetic Pigments
3.5. Molecular Identification of Native Iris aphylla Specimen
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Corlett, R.T. Plant diversity in a changing world: Status, trends, and conservation needs. Plant Divers. 2016, 38, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Duschanova, G.; Rakhimova, N.K.; Abdinazarov, S.H. Adaptive signs of a leaf of some endemic species of the genus Iris L. From Different Sections Under Conditions of Introduction in Uzbekistan. J. Nov. Appl. Sci. 2017, 6, 113–118. [Google Scholar]
- Rhizopoulou, S.; Pouris, J. Retrospective Approach to the Endemic Dianthus fruticosus L. ssp. fruticosus on Serifos Island (Cyclades, Greece). Plants 2024, 13, 3002. [Google Scholar] [PubMed]
- Kandemir, N.; Khan, G.; Çelik, A. Comparative morphological, anatomical and ecological studies on two varieties of Iris unguicularis subsp. carica (iridaceae) in Turkey. Planta Daninha 2019, 37, e019192808. [Google Scholar] [CrossRef]
- Raycheva, T.; Stoyanov, K.; Ranđelović, V.; Uzundzhalieva, K.; Marinov, J.; Trifonov, V. Overview of the floristic and taxonomic studies on Iridaceae Juss. in Bulgaria. Thaiszia J. Bot. Overv. 2021, 31, 87–104. [Google Scholar] [CrossRef]
- Aukhadieva, E.; Kalashnik, N.; Ishbirdin, A. Discussion of some taxonomy issues of species of the genus Iris L. based on biomorphological and karyological characteristics. E3S Web Conf. 2021, 254, 06008. [Google Scholar] [CrossRef]
- Crișan, I.; Cantor, M. New perspectives on medicinal properties and uses of Iris sp. Heavy metals in water View project lavandula View project. Hop Med. Plants 2016, 1, 57–62. [Google Scholar]
- Khatib, S.; Faraloni, C.; Bouissane, L. Exploring the Use of Iris Species: Antioxidant Properties, Phytochemistry, Medicinal and Industrial Applications. Antioxidants 2022, 11, 526. [Google Scholar] [CrossRef]
- Stoyanov, K.; Tsvetanka, G. Raycheva Current State of Iris L., Subgenus Iris (Iridaceae) in Bulgaria. Ecol. Balk. 2022, 14, 31–46. [Google Scholar]
- Sennikov, A.; Khassanov, F.; Ortikov, E.; Kurbonaliyeva, M.; Tojibaev, K.S. The genus Iris L. s. l. (Iridaceae) in the Mountains of Central Asia biodiversity hotspot. Plant Divers. Cent. Asia 2022, 2, 1–104. [Google Scholar] [CrossRef]
- Troitskyi, M.O.; Troitska, T.B.; Buydin, Y.V.; Miroshnichenko, N.O.; Mykhailenko, O.O. Classifications of Iris L. genus at the biological and molecular levels as a basis for modern phylogenetic studies. J. Org. Pharm. Chem. 2022, 19, 12–19. [Google Scholar] [CrossRef]
- Hoshimov, H.; Ortikov, E. Distribution Species of the Genus Iris L. (Iridaceae) in the Northern Foothills Fergana Valley (Part of Uzbekistan). Biologiya 2022, 3, 205–209. [Google Scholar]
- Khassanov, F.O.; Rakhimova, N. Taxonomic revision of the genus Iris L. (Iridaceae Juss.) for the flora of Central Asia. Stapfia 2012, 97, 174–179. [Google Scholar]
- Rohollahi, I.; Naji, A.M.; Stewart, J.R.; Kamrani, R. Morphological characterization of Iris hymenospatha and Iris histrio populations in Iran: Implications for conservation and breeding. Front. Plant Sci. 2024, 15, 1305240. [Google Scholar] [CrossRef]
- Celep, A.; Tugay, O.; Dural, H.; Ulukuş, D.; Bahadur, S.; Celep, F. Comparative root and leaf anatomy of the Turkish Iris subgenus Scorpiris and their taxonomic and phylogenetic utility. Plant Biosyst. 2022, 156, 1325–1335. [Google Scholar] [CrossRef]
- Kandemir, N. Comparative morphological and anatomical studies on Iris peshmeniana Güner & T. Hall. AND Iris aucheri (Baker) Sealy (Iridaceae). Trak. Univ. J. Nat. Sci. 2019, 20, 105–113. [Google Scholar] [CrossRef]
- Kang, Y.J.; Kim, S.; Lee, J.; Won, H.; Nam, G.H.; Kwak, M. Identification of plastid genomic regions inferring species identity from de novo plastid genome assembly of 14 Korean-native Iris species (Iridaceae). PLoS ONE 2020, 15, e0241178. [Google Scholar] [CrossRef]
- Hoang, L.; Beneš, F.; Fenclová, M.; Kronusová, O.; Švarcová, V.; Řehořová, K.; Baldassarre Švecová, E.; Vosátka, M.; Hajšlová, J.; Kaštánek, P.; et al. Phytochemical composition and in vitro biological activity of iris spp. (iridaceae): A new source of bioactive constituents for the inhibition of oral bacterial biofilms. Antibiotics 2020, 9, 403. [Google Scholar] [CrossRef]
- Śmigała, M.; Winiarczyk, K.; Dąbrowska, A.; Domaciuk, M.; Gancarz, M. Determination of the influence of mechanical properties of capsules and seeds on the susceptibility to feeding of mononychus pubctumalbum in endangered plant species iris aphylla l. And iris sibirica L. Sensors 2021, 21, 2209. [Google Scholar] [CrossRef]
- Colasante, M.; Fadda, A.; Rudall, P.; Tarquini, F. The genus Iris as a critical taxon in establishing an integrated approach to Italian plant biodiversity. Flora Mediterr. 2021, 31, 213–239. [Google Scholar] [CrossRef]
- Boltenkov, E.V.; Artyukova, E.V.; Trias-Blasi, A. Taxonomic composition of iris subser. Chrysographes (iridaceae) inferred from chloroplast dna and morphological analyses. Plants 2021, 10, 2232. [Google Scholar] [CrossRef]
- Abdinazarov, S.H.; Rakhimova, N.K.; Duschanova, G.M. The study of the anatomical structure of the vegetative organs of the endemic species Iris alberti regel in the introduction of the Botanical Garden of Uzbekistan. J. Nov. Appl. Sci. 2017, 6, 124–129. [Google Scholar]
- Makarevitch, I.; Golovnina, K.; Scherbik, S.; Blinov, A. Phylogenetic relationships of the Siberian Iris species inferred from noncoding chloroplast DNA sequences. Int. J. Plant Sci. 2003, 164, 229–237. [Google Scholar] [CrossRef]
- Kress, W.J. Plant DNA barcodes: Applications today and in the future. J. Syst. Evol. 2017, 55, 291–307. [Google Scholar] [CrossRef]
- Mosa, K.A.; Gairola, S.; Jamdade, R.; El-Keblawy, A.; Al Shaer, K.I.; Al Harthi, E.K.; Shabana, H.A.; Mahmoud, T. The promise of molecular and genomic techniques for biodiversity research and DNA barcoding of the Arabian Peninsula Flora. Front. Plant Sci. 2019, 9, 1929. [Google Scholar] [CrossRef]
- Srivastava, D.; Manjunath, K. DNA barcoding of endemic and endangered orchids of India: A molecular method of species identification. Pharmacogn. Mag. 2020, 16, 290–299. [Google Scholar] [CrossRef]
- Saddhe, A.A.; Kumar, K. DNA barcoding of plants: Selection of core markers for taxonomic groups. Plant Sci. Today 2018, 5, 9–13. [Google Scholar] [CrossRef]
- Wilson, C.A. Phylogenetic relationships among the recognized series in Iris section Limniris. Syst. Bot. 2009, 34, 277–284. [Google Scholar] [CrossRef]
- Wilson, C.A.; Padiernos, J.; Sapir, Y. The royal irises (Iris subg. Iris sect. Oncocyclus): Plastid and low-copy nuclear data contribute to an understanding of their phylogenetic relationships. Taxon 2016, 65, 35–46. [Google Scholar] [CrossRef]
- Wilson, C.A. Sectional relationships in the Eurasian Bearded Iris (subgen. Iris) based on phylogenetic analyses of sequence data. Am. Soc. Plant Taxon. 2017, 42, 392–401. [Google Scholar] [CrossRef]
- Guo, J.; Wilson, C.A. Molecular phylogeny of crested Iris based on five plastid markers (Iridaceae). Syst. Bot. 2013, 38, 987–995. [Google Scholar] [CrossRef]
- Weber, T.; Jakše, J.; Sladonja, B.; Hruševar, D.; Landeka, N.; Brana, S.; Bohanec, B.; Milović, M.; Vladović, D.; Mitić, B.; et al. Molecular study of selected taxonomically critical taxa of the genus iris L. From the broader alpine-dinaric area. Plants 2020, 9, 1229. [Google Scholar] [CrossRef]
- Nikitina, E.V.; Ortikov, E.; Beshko, N.Y.; Khalbekova, K.U. Molecular authentication of some rare Iris (Iridaceae) species from Uzbekistan. Plant Sci. Today 2023, 10, 444–454. [Google Scholar] [CrossRef]
- Boltenkov, E.V.; Artyukova, E.V. Updated taxonomy of Iris scariosa (Iridaceae) inferred from morphological and chloroplast DNA sequence data with remarks on classification of Iris subg. Iris. Plants 2024, 13, 2349. [Google Scholar] [CrossRef]
- Goldblatt, P.; Savolainen, V.; Porteous, O.; Sostaric, I.; Powell, M.; Reeves, G.; Manning, J.C.; Barraclough, T.G.; Chase, M.W. Radiation in the Cape flora and the phylogeny of peacock irises Moraea (Iridaceae) based on four plastid DNA regions. Mol. Phylogenetics Evol. 2002, 25, 341–360. [Google Scholar] [CrossRef]
- Tillie, N.; Chase, M.W.; Hall, T. Molecular studies in the genus Iris L.: A preliminary study. Ann. Bot. 2000, 58, 105–112. [Google Scholar] [CrossRef]
- Jiang, Y.L.; Huang, Z.; Liao, J.Q.; Song, H.X.; Luo, X.M.; Gao, S.P.; Lei, T.; Jiang, M.Y.; Jia, Y.; Chen, Q.B.; et al. Phylogenetic analysis of IRIS L. from China on chloroplast TRNL-F sequences. Biologia 2018, 73, 459–466. [Google Scholar] [CrossRef]
- Ikinci, N.; Hall, T.; Lledó, M.D.; Clarkson, J.J.; Tillie, N.; Seisums, A.; Saito, T.; Harley, M.; Chase, M.W. Molecular phylogenetics of the juno irises, Iris subgenus Scorpiris (Iridaceae), based on six plastid markers. Bot. J. Linn. Soc. 2011, 167, 281–300. [Google Scholar] [CrossRef]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Gielly, L.; Miquel, C.; Valentini, A.; Vermat, T.; Corthier, G.; Brochmann, C.; Willerslev, E. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 2007, 35, e14. [Google Scholar] [CrossRef]
- Oprea, A. Critical List of Vascular Plants in Romania; „Alexandru Ioan Cuza” Publishing House: Iaşi, Romania, 2005. [Google Scholar]
- Crişan, I.; Vidican, R.; Stoian, V.; Stoie, A. Wild Iris spp. from Romanian Meadows and their importance for ornamental plant breeding. Rom. J. Grassl. Forage Crop. 2017, 16, 21–32. [Google Scholar]
- Marinescu, M.V.; Alexiu, V. Iris aphylla L. ssp. hungarica critically endangered taxon in Europe. Curr. Trends Nat. Sci. 2013, 2, 96–99. [Google Scholar]
- Senator, S.; Savchuk, S.; Lebed’ko, V. Estimation of the rare status of Iris aphylla L. according to the categories and criteria of the IUCN Red list in the western and eastern edge of the East European plain. BIO Web Conf. 2020, 24, 00075. [Google Scholar] [CrossRef]
- Wróblewska, A.; Brzosko, E.; Czarnecka, B.; Nowosielski, J. High levels of genetic diversity in populations of Iris aphylla L. (Iridaceae), an endangered species in Poland. Bot. J. Linn. Soc. 2003, 142, 65–72. [Google Scholar] [CrossRef]
- Wróblewska, A.; Brzosko, E.; Chudziñska, E.; Bordács, S.; Prokopiv, A.I. Cytotype distribution and colonization history of the steppe plant Iris aphylla. Ann. Bot. Fenn. 2010, 47, 23–33. [Google Scholar] [CrossRef]
- Wróblewska, A. From the center to the margins of geographical range: Molecular history of steppe plant Iris aphylla L. in Europe. Plant Syst. Evol. 2008, 272, 49–65. [Google Scholar] [CrossRef]
- Mitić, B.; Halbritter, H.; Šoštarić, R.; Nikolić, T. Pollen morphology of the genus Iris L. (Iridaceae) from Croatia and surrounding area: Taxonomic and phylogenetic implications. Plant Syst. Evol. 2013, 299, 271–288. [Google Scholar] [CrossRef]
- Dąbrowska, A.; Śmigała, M.; Denisow, B.; Winiarczyk, K. Biology of flowering and insect visitors of iris Aphylla l. (Iridaceae). Turk. J. Bot. 2019, 43, 798–808. [Google Scholar] [CrossRef]
- Śmigała-Lasota, M.; Dziurka, K.; Dąbrowska, A.; Winiarczyk, K. Development of the male and female gametophyte, fertilization, and assessment of germination and regulation of dormancy in Iris aphylla L. Seeds. Acta Sci. Pol. Hortorum Cultus 2023, 22, 29–40. [Google Scholar] [CrossRef]
- Crișan, I.; Stoie, A.; Buta, E.; Cantor, M. Flowering phenology of some Iris species in the UASVM Cluj agrobotanical garden. Rom. Biotechnol. Lett. 2018, 23, 13702. [Google Scholar]
- Ghorbani, N.; Chamani, E.; Shokouhian, A.A.; Ramezanpour, S.S.; Soltanlou, H. Assessment of genetic diversity and photosynthetic pigments among wild populations of Yellow Flag (Iris pseudacorus). J. Plant Mol. Breed. 2021, 9, 1–11. [Google Scholar] [CrossRef]
- Shmakova, N.Y.; Markovskaya, E.F. Photosynthetic pigments of plants and lichens inhabiting arctic tundra of West Spitsbergen. Russ. J. Plant Physiol. 2010, 57, 764–769. [Google Scholar] [CrossRef]
- Emsdiasum. Available online: https://www.emsdiasum.com/microscopy (accessed on 28 November 2018).
- Lichtenthaler, H.K.; Buschmann, C. Chlorophylls and Carotenoids: Measurement and Characterization by UV—VIS Spectroscopy. Curr. Protoc. Food Anal. Chem. 2001, 1, F4.3.1–F4.3.8. [Google Scholar] [CrossRef]
- Taberlet, P.; Fumagalli, L.; Wust-Saucy, A.G.; Cosson, J.F. Comparative phylogeography and postglacial colonization routes in Europe. Mol. Ecol. 1998, 7, 453–464. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- GenBank. Available online: https://www.ncbi.nlm.nih.gov/GenBank (accessed on 15 October 2024).
- Prodan, I.; Nyárády, E. Genus Iris L.; Acad. R.S. Publishing House: Singapore, 1966. [Google Scholar]
- Webb, D.A.; Chater, A.O. Genus Iris L.; Cambridge Univ. Press: Cambridge, UK, 2010. [Google Scholar]
- Porcar-Castell, A.; Tyystjärvi, E.; Atherton, J.; Van Der Tol, C.; Flexas, J.; Pfündel, E.E.; Moreno, J.; Frankenberg, C.; Berry, J.A. Linking chlorophyll a fluorescence to photosynthesis for remote sensing applications: Mechanisms and challenges. J. Exp. Bot. 2014, 65, 4065–4095. [Google Scholar] [CrossRef]
- Croft, H.; Chen, J.M.; Luo, X.; Bartlett, P.; Chen, B.; Staebler, R.M. Leaf chlorophyll content as a proxy for leaf photosynthetic capacity. Glob. Chang. Biol. 2017, 23, 3513–3524. [Google Scholar] [CrossRef]
- Lobato, A.K.S.; Gonçalves-Vidigal, M.C.; Vidigal Filho, P.S.; Andrade, C.A.B.; Kvitschal, M.V.; Bonato, C.M. Relationships between leaf pigments and photosynthesis in common bean plants infected by anthracnose. N. Z. J. Crop Hortic. Sci. 2010, 38, 29–37. [Google Scholar] [CrossRef]
- Ivanov, L.A.; Ivanova, L.A.; Ronzhina, D.A.; Yudina, P.K. Changes in the chlorophyll and carotenoid contents in the leaves of steppe plants along a latitudinal gradient in South Ural. Russ. J. Plant Physiol. 2013, 60, 812–820. [Google Scholar] [CrossRef]
- Yue, C.; Wang, Z.; Yang, P. Review: The effect of light on the key pigment compounds of photosensitive etiolated tea plant. Bot. Stud. 2021, 62, 21. [Google Scholar] [CrossRef]
- Tan, J.; Zhang, T.; Xia, S.; Yan, M.; Li, F.; Sang, X.; He, G.; Ling, Y. Fine mapping of a novel yellow-green leaf 14 (ygl14) mutant in rice. Euphytica 2019, 215, 100. [Google Scholar] [CrossRef]
- Streit, N.M.; Canterle, L.P.; do Canto, M.W.; Hecktheuer, L.H.H. As clorofilas. Ciência Rural. 2005, 35, 748–755. [Google Scholar] [CrossRef]
- Lichtenthaler, H.K.; Babani, F. Contents of photosynthetic pigments and ratios of chlorophyll a/b and chlorophylls to carotenoids (a+b)/(x+c) in C4 plants as compared to C3 plants. Photosynthetica 2022, 60, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Tian-yuan, Z.; Yin-hu, W.; Shu-feng, Z.; Feng-min, L.; Hong-ying, H.; Crofcheck, C.; Crocker, M.; Welter, C.; Schwenk, J.; Kanani, B.; et al. winCATS planar chromatography manager. Bioresour. Technol. 2018, 8, 1–7. [Google Scholar]
- De Carvalho Gonçalves, J.F.; Marenco, R.A.; Vieira, G. Concentration of photosynthetic pigments and chlorophyll fluorescence of mahogany and tonka bean under two light environments. Rev. Bras. Fisiol. Veg. 2001, 13, 149–157. [Google Scholar] [CrossRef]
- Bahrim, C. The Behavior of Some Species and Cultivars of Perennial Flowers in the Ecological Conditions of the North-East of Romania; “Ion Ionescu de la Brad” Iasi University of Life Sciences: Iași, Romania, 2020. [Google Scholar]
- Amișculesei, P. Evaluation of Cultivation and Capitalization Possibilities of Some Ornamental Species from the Iridaceae family; “Ion Ionescu de la Brad” Iasi University of Life Sciences: Iași, Romania, 2022. [Google Scholar]
- Amișculesei, P.; Apostol, M.; Bernardis, R.R. Influence of the planting season and corms size on the Crocosmia, in agroclimatic conditions of Iasi (Northeastern Romania). Sci. Pap. Ser. B Hortic. 2022, LXVI, 624–631. [Google Scholar]
- Lozada-Gobilard, S.; Nielsen, N.; Sapir, Y. Flower Size as an Honest Signal in Royal Irises (Iris Section Oncocyclus, Iridaceae). Plants 2023, 12, 2978. [Google Scholar] [CrossRef]
- Asgari, E.; Taghizadeh, M.; Abbasifar, A. Exploration and morphologic variation of Iris wild species with ornamental potential. Ornam. Hortic. 2021, 28, 36–48. [Google Scholar] [CrossRef]
- Haldar, A. Fundamentals of reliability analysis. In Handbook of Probabilistic Models; Elsevier: Amsterdam, The Netherlands, 2020; pp. 1–35. [Google Scholar] [CrossRef]
- Ozarchevici, A.-Ș.; Apostol, M.; Chiruță, C.; Draghia, L. Preliminary results regarding the behavior of some Camassia species in Iaşi ecological conditions (North-Eastern Romania). Sci. Pap. Ser. B Hortic. 2023, LXVII, 468–478. [Google Scholar]
- Saffari, V.; Khalighi, A.; Lesani, H.; Babalar, M.; Obermaier, J.F. Effects of different plant growth regulators and time of pruning on yield components of Rosa damascena Mill. Int. J. Agric. Biol. 2004, 6, 1040–1042. [Google Scholar]
- Popa-Mitroi, D.; Popa-Mitroi, G.; Nicu, C.; Manda, M. Study on Behavior of Physalis alkekengi L. Species in Spontaneous Flora and Culture in Order To Evaluate Its Decorative Quality. South West. J. Hortic. Biol. Environ. 2012, 3, 185–202. [Google Scholar]
- Nowińska, R.; Czarna, A. Naturalization of the Ornamental Plant Crocus tommasinianus Herb. (Iridaceae) in Forest Ecosystems: A Case Study from Poland. Forests 2024, 15, 1851. [Google Scholar] [CrossRef]
- Mitroi, D.; Anton, D.; Nicu, C.; Manda, M. Variability of decorative morphological characteristics in the species Papaver rhoeas of spontaneous vegetation. South West. J. 2010, 1, 21–27. [Google Scholar]
- Paradiso, R.; Buonomo, R.; De Pascale, S.; Cardarelli, M. Evaluation of spontaneous species for the innovation in floriculture: Pancratium maritimum L. as ornamental plant. Acta Hortic. 2010, 881, 563–566. [Google Scholar] [CrossRef]
- Kandemir, N.; Çelik, A. Comparison of morphological and anatomical properties of endangered endemic iris pamphylica and i. masia in Turkey. Acta Bot. Hung. 2017, 59, 371–388. [Google Scholar] [CrossRef]
- Guo, J. Comparative micromorphology and anatomy of crested sepals in IRIS (Iridaceae). Int. J. Plant Sci. 2015, 176, 627–642. [Google Scholar] [CrossRef]
- Gitelson, A.A.; Merzlyak, M.N. Remote estimation of chlorophyll content in higher plant leaves. Int. J. Remote Sens. 1997, 18, 2691–2697. [Google Scholar] [CrossRef]
- Wang, S.; Li, Y.; Ju, W.; Chen, B.; Chen, J.; Croft, H.; Mickler, R.A.; Yang, F. Estimation of Leaf Photosynthetic Capacity From Leaf Chlorophyll Content and Leaf Age in a Subtropical Evergreen Coniferous Plantation. J. Geophys. Res. Biogeosciences 2020, 125, e2019JG005020. [Google Scholar] [CrossRef]
- Palta, J.P. Leaf Chlorophyll Content. Remote Sens. Rev. 1990, 5, 207–213. [Google Scholar] [CrossRef]
- Brînză, M.; Chelariu, E.L.; Hlihor, R.M.; Gavrilescu, M.; Draghia, L. Influence of controlled release fertilizers on Lilium regale species growth and flowering. Environ. Eng. Manag. J. 2019, 18, 1153–1162. [Google Scholar] [CrossRef]
- Bahrim, C.; García–Breijo, F.J.; Apostol, M.; Asănică, A.C.; Teliban, G.C.; Munteanu, N.; Rotaru, L.; Draghia, L. Study of some foxtail lilies species (Eremurus M. Bieb.) grown in the North-East of Romania. Rom. Biotechnol. Lett. 2021, 26, 2489–2498. [Google Scholar] [CrossRef]
- Zhang, R.; Yang, P.; Liu, S.; Wang, C.; Liu, J. Evaluation of the methods for estimating leaf chlorophyll content with SPAD chlorophyll meters. Remote Sens. 2022, 14, 5144. [Google Scholar] [CrossRef]
- Eitel, J.U.H.; Long, D.S.; Gessler, P.E.; Hunt, E.R. Combined spectral index to improve ground-based estimates of nitrogen status in dryland wheat. Agron. J. 2008, 100, 1694–1702. [Google Scholar] [CrossRef]
- Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; Fazekas, A.J.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef]
- Chase, M.W.; Cowan, R.S.; Hollingsworth, P.M.; Van Den Berg, C.; Madriñán, S.; Petersen, G.; Seberg, O.; Jørgsensen, T.; Cameron, K.M.; Pedersen, N.; et al. A Proposal for a Standardised Protocol to Barcode All Land Plants. Taxon 2007, 56, 295–299. [Google Scholar] [CrossRef]
- Letsiou, S.; Madesis, P.; Vasdekis, E.; Montemurro, C.; Grigoriou, M.E.; Skavdis, G.; Moussis, V.; Koutelidakis, A.E.; Tzakos, A.G. DNA Barcoding as a Plant Identification Method. Appl. Sci. 2024, 14, 1415. [Google Scholar] [CrossRef]
- Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J.; De Biologie, L.; Fourier, U.J. Plant universal primer. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef]
- Schaefer, H.; Mark, A.C.; Rumsey, F.J. From European priority species to invasive weed: Marsilea azorica (Marsileaceae) is a misidentified alien. Syst. Bot. 2011, 36, 845–853. [Google Scholar] [CrossRef]
- Volis, S.; Blecher, M. Translocation success in Iris atrofusca: Importance of replicating sites and long-term monitoring. Restor. Ecol. 2022, 30, e13502. [Google Scholar] [CrossRef]
- Ensslin, A.; Godefroid, S. Ex situ cultivation impacts on plant traits and drought stress response in a multi-species experiment. Biol. Conserv. 2020, 248, 108630. [Google Scholar] [CrossRef]
- Maxted, N.; Kell, S.P. Biodiversity and conservation|Plant Diversity, Conservation and Use. In Encyclopedia of Applied Plant Sciences; Elsevier: Amsterdam, The Netherlands, 2003; pp. 25–48. [Google Scholar] [CrossRef]
- Othman, Y.A.; Ayasrah, B.; Al-Kofahi, S. Habitat Selection to Reintroduce Iris bismarckiana in Semi-Arid Environments. Diversity 2023, 15, 957. [Google Scholar] [CrossRef]
- Ren, H.; Jian, S.G.; Liu, H.X.; Zhang, Q.M.; Lu, H.F. Advances in the reintroduction of rare and endangered wild plant species. Sci. China Life Sci. 2014, 57, 603–609. [Google Scholar] [CrossRef] [PubMed]
- Jones, K.D.; Kaye, T.N. Factors influencing germination of a functionally important grassland plant, Iris tenax. PLoS ONE 2014, 9, e90084. [Google Scholar] [CrossRef] [PubMed]
- Jéhan, H.; Courtois, D.; Ehret, C.; Lerch, K.; Pétiard, V. Plant regeneration of Iris pallida Lam. and Iris germanica L. via somatic embryogenesis from leaves, apices and young flowers. Plant Cell Rep. 1994, 13, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Nabieva, A.Y.U.; Elisafenko, T.V. Approaches to the conservation of iris tigridia bunge—The endangered species of flora in Russia. Plant Cell Biotechnol. Mol. Biol. 2017, 18, 356–365. [Google Scholar]









| Average monthly temperatures (°C) | |||||||||||||
| Months/ Years | I | II | III | IV | V | VI | VII | VIII | IX | X | XI | XII | Means |
| 2017 | −5 | −1.1 | 7.4 | 9.7 | 16.5 | 21.4 | 21.8 | 22.8 | 17.1 | 10.8 | 5.2 | 2.9 | 10.7 |
| 2018 | −1 | −2.2 | 0.8 | 15.3 | 19.1 | 20.7 | 21.2 | 22.9 | 16.7 | 12.3 | 2.5 | −1.4 | 10.5 |
| 2019 | −2.9 | 1.8 | 7.1 | 10.4 | 16 | 22.4 | 21.5 | 22.5 | 17.4 | 11.4 | 8.1 | 3.2 | 11.5 |
| 2020 | 1.1 | 4.3 | 7 | 11.3 | 14 | 20.9 | 22.7 | 23.5 | 19.6 | 13.6 | 4.5 | 1.8 | 12.03 |
| 2021 | 0.1 | −0.9 | 3.1 | 8.1 | 15.4 | 19.7 | 23.4 | 20.9 | 14.7 | 9.5 | 6.7 | 0.2 | 10.0 |
| Monthly precipitation (mm) | |||||||||||||
| Months/ Years | I | II | III | IV | V | VI | VII | VIII | IX | X | XI | XII | Sum |
| 2017 | 18.10 | 22.70 | 64.00 | 78.40 | 47.80 | 49.00 | 67.60 | 24.00 | 26.60 | 64.20 | 37.00 | 47.20 | 546.6 |
| 2018 | 38.8 | 37.0 | 72.2 | 9.2 | 13.6 | 219.6 | 184.2 | 3.0 | 30.4 | 2.6 | 64.6 | 52.6 | 727.8 |
| 2019 | 50.6 | 32.8 | 9.8 | 46 | 98.6 | 63 | 33.8 | 43.2 | 38.8 | 30.6 | 10.2 | 21.3 | 478.7 |
| 2020 | 3.6 | 43.2 | 18.2 | 8.4 | 102.2 | 108.4 | 42 | 9.2 | 29.8 | 104.8 | 22.8 | 54.8 | 547.4 |
| 2021 | 28.4 | 24.6 | 50.4 | 53.2 | 68.2 | 93.6 | 87.6 | 95.4 | 10.4 | 2.8 | 8.8 | 69.2 | 593.0 |
| Sunlight duration (hours) | |||||||||||||
| Months/ Years | I | II | III | IV | V | VI | VII | VIII | IX | X | XI | XII | Sum |
| 2017 | 53.6 | 42 | 128 | 221.6 | 290.5 | 291 | 293.4 | 278.4 | 205.5 | 147.7 | 101 | 85 | 2137.7 |
| 2018 | 53.8 | 57.5 | 214 | 192.7 | 328.5 | 231.2 | 214.1 | 284.8 | 252.7 | 140.8 | 64.2 | 93.5 | 2127.8 |
| 2019 | 83.1 | 72.5 | 151.1 | 239.2 | 285.5 | 282.8 | 276.5 | 198.4 | 199.9 | 190.6 | 96.4 | 73.6 | 2149.6 |
| 2020 | 99.6 | 116.4 | 191 | 279.8 | 178.2 | 235.7 | 275.6 | 295.3 | 259.5 | 123.1 | 65.1 | 25.5 | 2144.8 |
| 2021 | 65.2 | 107.1 | 163.4 | 183.7 | 212.8 | 218 | 283.7 | 265.1 | 188.3 | 195.9 | 116.4 | 30.1 | 2029.7 |
| Primers | Sequences (5′-3′) | cpDNA | PCR Conditions | Reference |
|---|---|---|---|---|
| S-523 | AAACCAAAATTGGGATTATCCGCAAAAAATTA | rbcL | 95 °C for 5 min, 35 cycles × 95 °C for 45 s, 57 °C for 1 min, 72 °C for 1 min; 72 °C for 10 min | [23] |
| Z-1204R | CCCTAAGGGTGTCCTAAAGTTTCTCCACC | |||
| trnL2 c | CGAAATCGGTAGACGCTACG | trnL-F | 95 °C for 5 min, 35 cycles × 95 °C for 45 s, 55 °C for 1 min, 72 °C for 1 min; 72 °C for 10 min | [55] |
| trnF f* | ATTTGAACTGGTGACACGAG |
| Morphological Characteristics | Iris aphylla L. | |
|---|---|---|
| “Ex Situ” (Personal Results) | “In Situ” [58,59] | |
| Height of the floral stems (cm) | 25–50 | 15–30 |
| Number of flowers per stem (pc) | 5–9 | 2–5 |
| Length of tepals (mm) | 40–64 | 40–65 |
| Width of tepals (mm) | 20–26 | 20–25 |
| Flowers color | violet | violet |
| Number of leaves (pc) | 2–6 | 2–4 |
| Length of leaves (cm) | 27–48 | 15–30 |
| Width of leaves (cm) | 2–5 | 2–3 |
| Vegetation Phenophase | Chl. a mg/g FW | Chl. b mg/g FW | x + c mg/g FW | TC Σ | Chl.a/Chl.b | Chl./ Car. |
|---|---|---|---|---|---|---|
| Before the occurrence of flowering stems | 1.65 ± 0.03 | 0.56 ± 0.02 | 0.54 ± 0.05 | 2.75 | 2.95 | 4.1 |
| At/during flowering | 1.97 ± 0.02 | 0.61 ± 0.04 | 0.57 ± 0.02 | 3.22 | 2.90 | 4.6 |
| Post-flowering | 1.45 ± 0.03 | 0.51 ± 0.02 | 0.65 ± 0.04 | 2.61 | 2.84 | 3.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Apostol, M.; Draghia, L.; Sîrbu, C.; Efrose, R.-C.; Flemetakis, E.; Hlihor, R.-M.; Simion, I.M.; Armiñana, J.R.; Garcia Breijo, F.J. Morphological, Anatomical, Physiological and Genetic Studies of Iris aphylla L. Wild Species Conservation in “Ex Situ” Conditions. Agriculture 2024, 14, 2358. https://doi.org/10.3390/agriculture14122358
Apostol M, Draghia L, Sîrbu C, Efrose R-C, Flemetakis E, Hlihor R-M, Simion IM, Armiñana JR, Garcia Breijo FJ. Morphological, Anatomical, Physiological and Genetic Studies of Iris aphylla L. Wild Species Conservation in “Ex Situ” Conditions. Agriculture. 2024; 14(12):2358. https://doi.org/10.3390/agriculture14122358
Chicago/Turabian StyleApostol, Maria, Lucia Draghia, Culiță Sîrbu, Rodica-Catalina Efrose, Emmanouil Flemetakis, Raluca-Maria Hlihor, Isabela Maria Simion, Jose Reig Armiñana, and Francisco José Garcia Breijo. 2024. "Morphological, Anatomical, Physiological and Genetic Studies of Iris aphylla L. Wild Species Conservation in “Ex Situ” Conditions" Agriculture 14, no. 12: 2358. https://doi.org/10.3390/agriculture14122358
APA StyleApostol, M., Draghia, L., Sîrbu, C., Efrose, R.-C., Flemetakis, E., Hlihor, R.-M., Simion, I. M., Armiñana, J. R., & Garcia Breijo, F. J. (2024). Morphological, Anatomical, Physiological and Genetic Studies of Iris aphylla L. Wild Species Conservation in “Ex Situ” Conditions. Agriculture, 14(12), 2358. https://doi.org/10.3390/agriculture14122358

