Next Article in Journal
Selection of Faba Bean (Vicia faba L.) Genotypes for High Yield, Essential Amino Acids and Low Anti-Nutritional Factors
Previous Article in Journal
Effects of Agricultural Machinery Operations on PM2.5, PM10 and TSP in Farmland under Different Tillage Patterns
Previous Article in Special Issue
Use of Graphical and Numerical Approaches for Diallel Analysis of Grain Yield and Its Attributes in Bread Wheat (Triticum aestivum L.) under Varying Environmental Conditions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 5
10.3390/agriculture13050931
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants

by
Jeong-Mi Do
1,2,†,
Hee-Jin Kim
1,2,†,
Sun-Young Shin
1,
Seong-Im Park
1,2,
Jin-Ju Kim
1,2 and
Ho-Sung Yoon
1,2,3,*
1
Department of Biology, College of Natural Sciences, Kyungpook National University, Daegu 41566, Republic of Korea
2
BK21 FOUR KNU Creative BioResearch Group, School of Life Sciences, Kyungpook National University, Daegu 41566, Republic of Korea
3
Advanced Bio-Resource Research Center, Kyungpook National University, Daegu 41566, Republic of Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agriculture 2023, 13(5), 931; https://doi.org/10.3390/agriculture13050931
Submission received: 15 March 2023 / Revised: 13 April 2023 / Accepted: 19 April 2023 / Published: 24 April 2023
(This article belongs to the Special Issue Genomics and Breeding: Field and Horticultural Crop Perspective)
Browse Figures
Versions Notes

Abstract

:
Various abiotic stress factors, such as high temperatures and salinity, have a significant impact on the development and growth of crop plants and ultimately impact crop yield. Previous studies have reported that overexpression of heat-shock-protein (HSP) genes in transgenic plants can enhance stress tolerance under controlled conditions in laboratories and greenhouses. Despite the significance of multiple environmental stressors on plants in natural paddy fields, there is still a lack of research regarding the contribution of HSP genes to stress tolerance and crop yield. In this study, we cloned and characterized the function of OsHSP 17.9, an HSP gene from Oryza sativa, in rice plants grown under diverse conditions. Our results showed that overexpressing OsHSP 17.9 in rice plants enhanced the activity of antioxidant enzymes under high-temperature and salinity stresses. Moreover, transgenic rice plants overexpressing OsHSP 17.9 exhibited significantly improved adaptability after transplantation from greenhouses to natural paddy fields. In particular, OsHSP 17.9-overexpressing transgenic rice plants established improved agronomic traits and increased grain yields even under unfavorable natural-paddy-field conditions. These results suggest that OsHSP 17.9 transgenic plants can be a promising strategy for cultivating crops in adverse environmental conditions.

1. Introduction

Throughout their life cycles, crop plants are naturally exposed to environmental stresses such as extreme temperatures, drought, and high salinity in cultivated and irrigated land [1,2,3]. These stresses result in the loss of plant growth and development, and limitations to crop productivity, with serious agroeconomic impacts [4,5]. These stresses lead to the generation of reactive oxygen species (ROS) such as superoxide radicals (O2−), hydrogen peroxide (H2O2), and hydroxyl radicals (OH−), which cause oxidative stress, peroxidation of unsaturated fatty acids within membranes, enzymatic denaturation, and DNA strand breakage [6,7,8].
Plants activate a complex stress-response mechanism to cope with various stressors, leading to the production of a diverse range of biomolecules. Among these biomolecules, heat shock proteins (HSPs) play a significant role as molecular chaperones in protecting cells from stress [9]. HSPs can help fold newly synthesized proteins or keep them from misfolding, preventing the loss of potential functional conformation under stress conditions [10,11]. Numerous abiotic and biotic stresses stimulate the expression of HSPs, including high temperatures, heavy metal exposure, oxidative stress, drought, and salinity, emphasizing the significant role of HSPs to plant adaptation to stress [12]. Furthermore, the study of HSPs has become increasingly important in the field of plant biotechnology, where they are being used to improve stress tolerance in crops, ultimately resulting in better crop yields and food security [13].
Small heat shock proteins (sHSP) have a lower molecular weight than other HSPs, typically in the range of 15–22 kDa. One of their distinguishing features is the presence of an α-crystallin domain, a conserved amino-acid sequence of 80–100 residues in their C-terminal domain [14]. sHSP are known for their complex diversity in DNA sequence variation, copy numbers, and cellular localization, which contribute to their remarkable diversity of function in cellular responses to abiotic stress and disease [15,16]. They possess the ability to form homo- and hetero-oligomers depending on the number of subunits and the degree of flexibility in the complex [17,18]. Like other HSPs, sHSPs also play a critical role in preventing protein damage during high-temperature and salinity stress by associating with partially denatured proteins to form stable complexes and preventing their irreversible aggregation in an ATP-independent manner. Moreover, sHSPs transfer denatured proteins to the HSP 70/90 chaperone system for performing continuous ATP-dependent refolding of these proteins, preventing protein misfolding and aggregation [19,20].
As their name implies, sHSPs were previously recognized as being produced under heat stress. More recent research has demonstrated that the production of these biomolecules is elicited in response to diverse biotic and abiotic stressors. The expression of HSPs is upregulated or downregulated in response to stresses [20,21,22]. The defensive role of sHSPs against various stresses has been reported in several crops, including rice, soybeans, peppers, and wheat [23,24,25,26]. Previous studies have reported that the expression of different types of sHSPs in transgenic plants improved tolerance against various stresses. In transgenic rice, overexpression of OsHSP 17.0 and OsHSP 23.7 enhanced drought and salt tolerance, and sHSP 17.7 conferred drought tolerance and heat and UV-B resistance [27,28,29]. In addition, overexpression of OsHSP 40 induced tolerance to salt stress [30].
On the basis of these previous studies, we anticipate that overexpression of sHSP 17.9 in transgenic rice will improve tolerance to a range of environmental stresses, including high temperatures, salinity, and drought. In this study, we present the characterization of transgenic rice plants that express high levels of OsHSP 17.9 under controlled laboratory settings and in natural paddy fields, where multiple environmental stresses exist simultaneously, and we describe the agronomic traits, grain yield, and phenotypic analysis.
We hypothesized that overexpression of sHSP 17.9, a gene that has not yet been thoroughly investigated, in transgenic rice will result in improved tolerance to various abiotic stresses, such as extreme temperatures, salinity, and drought. To explore this hypothesis, we conducted experiments in which we examined transgenic rice plants overexpressing OsHSP 17.9 under laboratory and natural paddy conditions and exposed them to high-temperature and salinity stress conditions. We present a comprehensive analysis of the agronomic traits, grain yield, and phenotypic alterations in transgenic rice plants, with a focus on the effects of the overexpression of OsHSP 17.9 under both laboratory and natural paddy-field conditions.

2. Materials and Methods

2.1. Plant Material and Stress Treatments

The Ilmi variety of Oryza sativa L. was used as a host for the overexpression of OsHSP 17.9. A single wild-type (WT) plant and the T2 (2013), T3 (2017), and T4 (2018) generations of three independent homozygous transgenic plants were used to investigate the genotypes and phenotypes. Prior to transplantation, the seeds were treated with disinfectant and soaked in distilled water at 28 °C in darkness. After 4 weeks, the seedlings were transplanted into soil pots and grown in a greenhouse at temperatures ranging from 28 °C to 30 °C. Subsequently, the plants were transplanted into a natural paddy field located at Kyungpook National University in Republic of Korea, where they were cultivated for a period of 2 years, beginning in 2017.
For the evaluation of salt stress tolerance, 4-week-old transgenic and WT seedlings were treated with 150 mM NaCl solution for 7 days. To evaluate high-temperature stress tolerance, seeds were transplanted and placed in a growth chamber maintained at 30 °C for 4 weeks (16 h light/8 h dark cycle) and then exposed to 42 °C for 3 days. The leaves of transgenic and WT plants were collected at specific time points after treatment (0, 2, 6, 12, and 24 h), rapidly frozen using liquid nitrogen, and preserved at −70 °C for further analysis. Each experiment was performed at least three times.

2.2. Genomic DNA Isolation and PCR Analysis

Approximately 0.1 g of samples were ground using liquid nitrogen and micropestles as described in previous reports [31]. The supernatant was used as the template for PCR that was performed using a PCR premix (Bioneer, Daejeon, Republic of Korea) and the primer set of OsHSP-F1 (5’-CATCTTCATAGTTACGAGTTTAAGATGGAT-3’) and OsHSP-R1 (5’-CCAAGCAAATAAATAGCGTATGAAGGC-3’) under the following conditions: an initial denaturation step for 5 min at 94 °C, followed by 35 cycles of 50 s at 94 °C, 50 s at 56 °C, 1 min at 72 °C, and then a final extension step of 5 min at 72 °C.

2.3. Analysis of Semi-Quantitative RT-PCR

OsHSP-overexpressing transgenic and WT plants were incubated in a greenhouse for 4 weeks at approximately 30 °C. For salt-tolerance phenotype analysis, 4-week-old transgenic and WT plants were treated with 150 mM NaCl for 7 days and allowed to recover for 7 days. For high-temperature-tolerance phenotype analysis, transgenic and WT plants were exposed to 42 °C for 1 day in the growth chamber and then allowed to recover at 30 °C for 7 days.
After 12 h of stress treatment, total RNA was extracted from the leaves of WT and transgenic plants using RNAiso plus (TaKaRa Bio, Kusatsu, Japan), following the manufacturer’s protocol. The extracted RNA was used for reverse transcription with the SuperScript III First-Strand Synthesis System (Invitrogen, Waltham, MA, USA) with 2 µg of the extracted RNA. The OsHSP-F2 and OsHSP-R4 primer set was used for confirming the expression of OsHSP 17.9 after stress treatment. Furthermore, OsHSP-26.7-F and OsHSP-26.7-R, OsHSP-23.2-F and OsHSP-23.2-R, OsHSP-18.1-F and OsHSP-18.1-R, OsHSP-17.7-F and OsHSP-17.7-R, and OsHSP-16.9-F and OsHSP-16.9-R primer sets were used for confirming the expression of the sHSP that formed hetero-oligomers with OsHSP 17.9 (Table 1). A positive housekeeping control was established using the Tub-F and Tub-R primer set to amplify the rice tubulin (Tub) gene. Semi-quantitative RT-PCR was performed with the following cycle conditions: 28 cycles of denaturation at 94 °C for 5 min, annealing at 54 °C for 30 s, and extension at 72 °C for 50 s, followed by a final extension step at 72 °C for 5 min.

2.4. Measurement of Accumulative ROS Content

The amount of malondialdehyde (MDA), which indicates oxidized unsaturated fatty acids of lipid membranes, was determined based on a colorimetric assay as described previously [32]. To measure lipid peroxidation levels, 0.1 g of leaf samples were ground with liquid nitrogen and then mixed with a solution containing 20% (w/v) trichloroacetic acid (TCA) and 0.65% thiobarbituric acid. This mixture was heated in a boiling bath for 30 min while the tube cap was opened every 5 min. The MDA concentration of the sample was measured at 532 nm using a spectrophotometer (Optimizer 2120 UV spectrophotometer, Mecasys, Republic of Korea).
The FOX assay was conducted to quantify the presence of lipid hydroperoxide in the samples. Approximately 0.1 g of plant leaves were ground in liquid nitrogen followed by the addition of 1 mL of protein extraction buffer containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 10% glycerol, and 0.1% SDS; the samples was then vortexed and left to stand for 5 min in ice. After centrifugation at 12,000 rpm and 4 °C for 10 min, the protein concentration of the supernatant was measured using a BCA protein assay reagent with bovine serum albumin as a standard. The concentration of hydroperoxide was determined by a method previously reported, using H2O2 and a standard curve [32]. Specifically, 50 μL of extracted protein sample was mixed with FOX assay reagent containing 250 μM ferrous ammonium sulfate, 100 M sorbitol, 100 mM xylenol orange, and 25 mM sulfuric acid, and then incubated for 30 min at 38 °C in the dark. The H2O2 concentration was determined using a spectrophotometer at 560 nm [32,33].

2.5. Evaluation of Early Growth in a Natural Paddy Field and Ion Leakage in Response to Methyl Viologen (MV)

To investigate early growth and environmental adaptation, four independent lines of WT control and transgenic plants (TG1-TG4) were transplanted into a paddy field. The root length, moisture content, and number of tillers of four plants per independent line were measured after 4 weeks of transplantation.
The leaves of transgenic and WT plants were sprayed with a solution of 50 μM MV containing 1% Tween-20 and 30% of acetone and then cut followed by the addition of nitro blue tetrazolium (NBT) and 3,3-diaminobenzidine (DAB) to detect O2– and H2O2 production, respectively.
A total of 10 leaf disks collected from plants grown in a natural paddy field for 4 weeks were submerged in 10 μM MV solution and incubated at 25 °C for 12 h in the dark. An ion conductivity meter (455C, Isteck Co., Seoul, Republic of Korea) was used to measure the ion leakage of solution at 24, 48, and 72 h after treatment. Upon completion of the measurement, the samples were autoclaved for 15 min at 121 °C to achieve 100% ion leakage.

2.6. Antioxidant Enzyme Assay

Using the leaves of transgenic and WT rice plants grown for 4 weeks in a natural paddy field, the enzyme activities were determined. As described previously [34], the activity of ascorbate peroxidase (APX) was measured based on the decrease in absorbance. Using the protocol included in a Glutathione Assay Kit, the activity of glutathione peroxidase (GPX) was measured (Sigma-Aldrich, St. Louis, MO, USA). As described previously, the catalase (CAT) activity was determined based on the decomposition of H2O2 [35]. The peroxiredoxin (POX) activity was measured on the basis of the peroxide decomposition rate, according to a previous study [36]. All enzyme assays were conducted every 15 s for 5 min.

2.7. Evaluation of Early Growth and Agronomic Traits in a Natural Paddy Field

To evaluate the agricultural characteristics of transgenic and WT plants under natural paddy-field conditions, we transplanted three independent lines of transgenic plants and five WT plants to a natural paddy field located at the experimental field of Kyungpook National University in Gunwi. Following a 28-day growth period in a greenhouse, a fully randomized block design was utilized, with each plot consisting of 30 plants arranged in two rows per line, spaced 0.2 m apart, and with 0.3 m between plots. Agronomic traits were estimated for 10 rice plants per plot. Transgenic rice plants were harvested and threshed by hand when they had reached maturity, and seeds from the vegetative parts of the plant were separated. The agronomic traits of both transgenic and WT plants were assessed such as total plant weight (TPW), culm weight (CW), root weight (RW), number of tillers (NT), number of panicles per hill (NP), gross grain weight (GGW), 1000-grain weight (TGW), number of spikelets per panicle (NSP), and number of total grain (NTG). TGW was established by weighing 1000 rice seeds that were chosen randomly from 10 plants.

2.8. Statistical Analysis

Biochemical measurements were conducted at least in triplicate, and values were calculated relative to those of WT plants, which were defined as 100%. Statistical analysis was performed using the SPSS software. Statistical comparisons between individual data points were performed using Student’s t-test, with statistical significance set at p < 0.05. The data are presented as mean values, and error bars indicate standard deviations.

3. Results

3.1. Production of OsHSP 17.9 Gene Transgenic Plants

To confirm the abiotic stress tolerance conferred by OsHSP 17.9 expression, we generated transgenic plants by introducing the gene under the control of the maize ubiquitin promoter using the Agrobacterium-mediated transformation method (Figure 1A). The progeny of the selected transformants demonstrated the inheritance of the transgene in accordance with Mendelian genetics. In T1 transgenic rice, a 3:1 segregation ratio indicated that the gene was integrated into a single locus in the rice genome. In order to obtain homozygous lines of OsHSP 17.9 transgenic plants, 24 lines of T2 and 20 lines of T3 were cultivated in a greenhouse for a period of 4 weeks. Subsequently, their DNA was extracted and analyzed via PCR (Figure 1B) using Ubi-F and Ubi-R primers. Seven independent lines were identified through this process, out of which three were chosen for further antioxidative and agricultural assessments.

3.2. Comparison of Phenotype and OsHSP 17.9 Gene Expression Levels in Salt and High-Temperature Stress

The OsHSP 17.9-overexpressing transgenic plants exhibited enhanced salt and high-temperature tolerance and recovered more rapidly than WT plants (Figure 2). The transgenic plants exhibited less salinity-induced damage compared with WT plants, including leaf rolling and dry ends caused by insufficient moisture, after exposure to salt stress. The survival rate of transgenic plants was higher than that of WT plants. According to the results of semi-quantitative RT-PCR, the expression level of OsHSP 17.9 after 12 h of stress treatment was higher in transgenic plants than in WT plants, along with four other hetero-oligomeric genes (Figure 3).

3.3. Analysis of Oxidative Stress Tolerance through Accumulated MDA and H2O2 Content

To quantify the damage caused by ROS under abiotic stress, the MDA content of WT and transgenic plants was determined. The MDA content of wild-type plants was substantially greater than that of transgenic plants, with wild-type plants exhibiting 1.1 and 1.2 times greater MDA content under normal and stress conditions, respectively (Figure 4A). The results indicate that the transgenic plants’ cell membrane was more protective than WT plants from oxidizing by stress conditions.
Under high-temperature and salinity duress, plants produce ROS, which can cause cell damage. In order to prevent this destruction, cells convert ROS to hydrogen peroxide (H2O2). We measured the amount of H2O2 in transgenic and wild-type (WT) plants under normal and stressful conditions using the FOX assay. Transgenic plants accumulated 23% less H2O2 than wild-type plants under normal conditions, 10% less under salinity stress, and 14% less under high-temperature stress, according to our findings. This suggests that the reduced accumulation of reactive oxygen species (ROS) in transgenic plants increases their tolerance to salinity stress compared to WT plants. These findings have important implications for developing crop varieties that can better withstand environmental stresses (Figure 4B).

3.4. Early Growth and Environmental Adaptability in a Natural Paddy Field and Ion Leakage in Response to MV

After 4 weeks of transplantation into a natural paddy field with various abiotic stresses, the dry weight, root length, and number of tillers were measured to examine the early growth and environmental adaptability of transgenic and WT plants. Transgenic plants showed 23% longer root length, higher fresh weight, and higher dry weight than WT plants (Figure 5A–D). Moreover, the NT was specifically different between transgenic plants and WT plants (Figure 5E).
MV-induced cell-membrane destruction was measured visually by DAB and NBT staining. Leaf disks of WT plants exhibited more distinguished reddish-brown and purple-blue colors, respectively, than those of transgenic plants (Figure 6A). After MV treatment, the MDA and H2O2 contents were also measured, which revealed that the average contents in transgenic plants were 19% and 23% lower than those in WT plants, respectively (Figure 6B,C).
MV-induced ion leakage was measured for 3 days, which showed significant differences after 24 h of MV treatment. An 80% ion leakage was observed in WT plants after 72 h of MV treatment, whereas a 64% ion leakage was observed in transgenic plants at the same time point (Figure 7).

3.5. Enhanced Antioxidant Enzyme Activity of Transgenic Plants Grown in a Natural Paddy Field

Plants cells utilize different forms of antioxidant enzymes to mitigate ROS-induced damage, including APX, GPX, CAT, and POX. To evaluate the activity of these antioxidant enzymes under stress conditions, we conducted an enzyme assay using the leaves of transgenic and WT plants after 4 weeks of transplantation into a natural paddy field with various abiotic stresses. The results demonstrated that the enzyme activity was higher in the transgenic plants compared to the WT plants in all assays, including 88% higher CAT activity, 33% higher GPX activity, 54% higher APX activity, and 66% higher POX activity (Figure 8A,B). These findings suggest that the accumulation of ROS is decreased in stressed OsHSP 17.9 transgenic plants due to the enhanced enzymatic activity of antioxidants compared to WT plants.

3.6. Grain Yield and Agronomic Analysis in Natural Paddy-Field Conditions

Comparing the phenotypes of OsHSP 17.9-overexpressing transgenic plants and wild-type plants growing in natural paddy fields revealed significant growth differences. The agronomic traits of transgenic plants were evaluated under varying climatic conditions in natural paddy fields over two successive growing seasons (2017–2018) to investigate if the observed physiological difference between transgenic and WT plants was sustained through the reproductive stage. This analysis focused on yield components. During the 2017 and 2018 growing seasons, three distinct homozygous lines of OsHSP 17.9-overexpressing plants and WT plants were grown to maturity in paddy fields.
Regarding the agronomic traits, transgenic plants exhibited higher values for all traits than WT plants during 2 years of cultivation in the natural paddy field (Figure 9). The results showed that the transgenic plants had significantly higher values for all traits compared to the WT plants. Specifically, the transgenic plants had a 28% increase in TPW and NP, and a 13% increase in TGW and NTG, compared to the wild-type plants. Notably, the HSP-3 line exhibited fewer panicles than other transgenic lines, but still had higher TGW and NTG than the WT plants. These findings suggest that the overexpression of OsHSP genes may contribute to improving rice yield and productivity under natural field conditions.

4. Discussion

Under unfavorable environmental circumstances, such as heat stress, heavy-metal exposure, salt exposure, cold exposure, drought, and floods, plant growth and development are typically stunted. These stressors might decrease the output of important crops such as rice and maize by almost 50% [37]. Thus, to increase the amount of plant matter that can be harvested, it is necessary to produce transgenic rice plants that can tolerate a range of environmental challenges. The presence of ROS can be harmful to the growth, development, and yield of plants when environmental conditions are unfavorable [38]. Recent research has shown that increasing a plant’s resistance to abiotic stress through modulation of ROS homeostasis might be beneficial [39].
Salt stress has the potential to induce both the generation of ROS and the denaturation of proteins in plant cells. Cells suffer damage and ultimately die as a direct consequence of these conditions. Transgenic rice plants overexpressing OsHSP were shown to have less leaf damage and fewer injuries than WT rice plants after exposure to salt and high-temperature stress. Furthermore, the expression of OsHSP 17.9 and its associated sHSP genes increased when the plant was subjected to both high salt concentrations and high temperatures. These findings are consistent with those of previous studies which showed that transgenic plants overexpressing MsHSP 17.7 [40] and other sHSP genes exhibited increased tolerance to abiotic stress [30,41].
The production of ROS in response to abiotic stress can damage lipids, proteins, and DNA, ultimately causing the death of the plant [42]. HSPs are essential to preventing the denaturation of damaged proteins and promote their refolding. The FOX and MDA assays were used in our study to determine the total quantity of accumulated ROS, which showed that under stressful conditions, transgenic plants accumulated approximately 20% less ROS than WT plants. Plants generate H2O2 as a byproduct as part of their defense strategy against the cell damage that can be caused by oxidative stress. Through the FOX assay, we could confirm the increase in H2O2 production and evaluate ROS production in response to stress. According to our study, the cell membranes of transgenic plants can better withstand the damaging effects of oxidative stress than the cell membranes of nontransgenic plants.
Antioxidant enzymes are responsible for the removal of ROS that are produced as a result of oxidative stress. We measured the activities of the peroxidase enzymes CAT, APX, GPX, and PRX to determine the level of peroxidase activity in OsHSP-overexpressing transgenic plants and WT plants. We found higher peroxidase activities in transgenic plants than in WT plants. This finding is consistent with that of previous research that suggested that plants overexpressing the HSP transcription factor exhibited higher levels of peroxidase activity and APX expression [43].
To determine the agricultural impact of transgenic plants when exposed to abiotic stresses under natural paddy-field condition, we examined their early adaptability and agronomic properties. Similar to a recent study that used transgenic plants overexpressing OsECS, a gene involved in antioxidant synthesis, we also observed that transgenic plants overexpressing HSP exhibited greater tolerance to abiotic stresses than WT plants [39]. We hypothesized that transgenic plants would have an especially high level of resistance to the nonselective permeability of the herbicide MV, based on previous studies on antioxidants. The non-selective herbicide MV is known to cause cell death by destroying cell membranes. In this study, we compared the level of leaf damage between WT and transgenic plants that overexpressed OsHSP 17.9 after being treated with MV. The leaves of WT plants exhibited significant damage, while those of transgenic plants were less affected. These findings suggest that OsHSP 17.9 overexpression enhances the resistance of transgenic plants to oxidative stress compared to WT plants. The results of this experiment suggest that overexpressing OsHSP 17.9 in plants can potentially improve their ability to withstand oxidative stress and promote overall growth and development.
The presence of ion leakage is an indication that ROS have damaged the membrane. To determine the degree to which injured cells release ions into the surrounding environment, leaf disks were submerged in MV solution. Compared with their non-transgenic counterparts, transgenic plants exhibited significantly reduced ion leakage and significantly higher tolerance to MV stress. At 4 weeks after implantation, we measured the root length as well as phenotypic and plant mass to confirm early adaptation Although there were no visible differences in the shoot characteristics of transgenic plants, they did exhibit greater tiller number, longer root length, and higher fresh weight than WT plants. Therefore, based on our findings, transgenic plants overexpressing OsHSP can more easily respond to a variety of environmental stresses. Another study reported similar findings which provided evidence for the environmental adaptation of transgenic plants overexpressing OsGS, which is responsible for generating glutathione [33].
Upon harvest, we evaluated the phenotypic alterations of the plants grown in the natural paddy field. We found that both the T2 and T3 generations of transgenic plants were longer and heavier than their corresponding WT counterparts, despite the significant variations in environmental factors throughout the two seasons (Table S1). This result was established by comparing the transgenic plants with their WT counterparts. Several agronomic parameters, including TPW, CW, RW, and NP, were investigated to validate these findings, and the results showed that transgenic plants were superior to WT plants in every trait. Our results suggest that an upregulation of HSP promotes faster growth of vegetative tissues. We also investigated yield-analysis aspects such as GGW, TGW, NSP, and NTG and found that transgenic plants were generally superior to WT plants. Our findings imply that transgenic-plant seed production and rice cultivation can be improved due to the advantages conferred by the overexpression of HSP.
In this study, we found that the overexpression of OsHSP in transgenic plants results in increased tolerance to salt and high-temperature stress, leading to a more robust phenotype. This is due to a reduction in ROS accumulation, which, in turn, results in fewer damaged cells and increased activity of antioxidant enzymes. Moreover, transgenic plants demonstrated better initial adaptability, growth rate, and reproductive function than WT plants in the natural paddy-field experiment, which involved various complicated environmental stresses. The increased yield and enhanced tolerance to different stresses could exert a positive impact on the economic feasibility of rice production.

5. Conclusions

Plants are susceptible to damage from ROS when subjected to a variety of environmental stressors. HSPs are crucial for protecting cells against stress, particularly by preventing the loss of functional conformation and ensuring that newly generated proteins are properly folded. We generated four independent transgenic rice plants (TG1–TG4) in which OsHSP 17.9 was overexpressed. OsHSP 17.9 overexpression led to resistance to high-temperature and salt stress by decreasing ROS accumulation by 20%. Moreover, the early growth rates of transgenic plants under natural paddy-field conditions were superior to those of WT plants. OsHSP 17.9 overexpression also improved the redox equilibrium by decreasing lipid peroxidation and H2O2-mediated membrane damage and increasing the antioxidant enzyme activity. Consequently, the enhanced tolerance to environmental stress resulted in improved agronomic characteristics in both 2017 and 2018 despite distinct seasonal climate fluctuations. Overall, our findings indicate that overexpressing OsHSP 17.9 in rice increases its redox homeostasis, improving its tolerance to environmental stresses in paddy fields.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture13050931/s1, Table S1. Summary of major meteorological factors in the paddy field in 2017 and 2018 (Values shown are 10-day means).

Author Contributions

J.-M.D. was involved in data curation, writing of the manuscript and editing of the manuscript; H.-J.K. was involved in the conceptualization, laboratory work, data analysis, and writing of the manuscript; S.-Y.S., S.-I.P. and J.-J.K. were involved in data analysis; H.-S.Y. was involved in the conceptualization and editing of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (Grant Number 2021R1I1A2055517). This research was also funded by the Ministry of Oceans and Fisheries, Republic of Korea (grant no. 20220027).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Radhakrishnan, R. Magnetic Field Regulates Plant Functions, Growth and Enhances Tolerance against Environmental Stresses. Physiol. Mol. Biol. Plants 2019, 25, 1107–1119. [Google Scholar] [CrossRef] [PubMed]
  2. Singh, S.; Kumar, V.; Kapoor, D.; Kumar, S.; Singh, S.; Dhanjal, D.S.; Datta, S.; Samuel, J.; Dey, P.; Wang, S.; et al. Revealing on Hydrogen Sulfide and Nitric Oxide Signals Co-Ordination for Plant Growth under Stress Conditions. Physiol. Plant. 2020, 168, 301–317. [Google Scholar] [CrossRef] [PubMed]
  3. Cohen, I.; Zandalinas, S.I.; Huck, C.; Fritschi, F.B.; Mittler, R. Meta-Analysis of Drought and Heat Stress Combination Impact on Crop Yield and Yield Components. Physiol. Plant. 2021, 171, 66–76. [Google Scholar] [CrossRef] [PubMed]
  4. Shah, F.; Wu, W. Soil and Crop Management Strategies to Ensure Higher Crop Productivity within Sustainable Environments. Sustainability 2019, 11, 1485. [Google Scholar] [CrossRef]
  5. El-Esawi, M.A.; Alayafi, A.A. Overexpression of Rice Rab7 Gene Improves Drought and Heat Tolerance and Increases Grain Yield in Rice (Oryza sativa L.). Genes 2019, 10, 56. [Google Scholar] [CrossRef]
  6. Verma, S.; Dubey, R.S. Lead Toxicity Induces Lipid Peroxidation and Alters the Activities of Antioxidant Enzymes in Growing Rice Plants. Plant Sci. 2003, 164, 645–655. [Google Scholar] [CrossRef]
  7. Gechev, T.; Petrov, V. Reactive Oxygen Species and Abiotic Stress in Plants. Int. J. Mol. Sci. 2020, 21, 7433. [Google Scholar] [CrossRef]
  8. Devireddy, A.R.; Tschaplinski, T.J.; Tuskan, G.A.; Muchero, W.; Chen, J.G. Role of Reactive Oxygen Species and Hormones in Plant Responses to Temperature Changes. Int. J. Mol. Sci. 2021, 22, 8843. [Google Scholar] [CrossRef]
  9. Mishra, D.; Shekhar, S.; Singh, D.; Chakraborty, S.; Chakraborty, N. Heat Shock Proteins and Abiotic Stress Tolerance in Plants; Springer: New York, NY, USA, 2018; pp. 41–69. [Google Scholar] [CrossRef]
  10. Balchin, D.; Hayer-Hartl, M.; Hartl, F.U. In Vivo Aspects of Protein Folding and Quality Control. Science 2016, 353, aac4354. [Google Scholar] [CrossRef]
  11. Khan, S.; Jabeen, R.; Deeba, F.; Waheed, U.; Khanum, P.; Iqbal, N. Heat Shock Proteins: Classification, Functions and Expressions in Plants during Environmental Stresses. J. Bioresour. Manag. 2021, 8, 85–97. [Google Scholar] [CrossRef]
  12. Singh, L.P.; Gill, S.S.; Tuteja, N. Unraveling the Role of Fungal Symbionts in Plant Abiotic Stress Tolerance. Plant Signal. Behav. 2011, 6, 175–191. [Google Scholar] [CrossRef]
  13. Vermeulen, S.J.; Aggarwal, P.K.; Ainslie, A.; Angelone, C.; Campbell, B.M.; Challinor, A.J.; Hansen, J.W.; Ingram, J.S.I.; Jarvis, A.; Kristjanson, P.; et al. Options for Support to Agriculture and Food Security under Climate Change. Environ. Sci. Policy 2012, 15, 136–144. [Google Scholar] [CrossRef]
  14. Bakthisaran, R.; Tangirala, R.; Rao, C.M. Small Heat Shock Proteins: Role in Cellular Functions and Pathology. Biochim. Biophys. Acta Proteins Proteom. 2015, 1854, 291–319. [Google Scholar] [CrossRef]
  15. Sun, X.; Zhu, J.; Li, X.; Li, Z.; Han, L.; Luo, H. Heat Shock Protein Integrates Different Signaling Pathways to Modulate Plant Abiotic Stress Response. BMC Plant Biol. 2020, 20, 184. [Google Scholar] [CrossRef]
  16. Wu, J.; Gao, T.; Hu, J.; Zhao, L.; Yu, C.; Ma, F. Research Advances in Function and Regulation Mechanisms of Plant Small Heat Shock Proteins (sHSPs) under Environmental Stresses. Sci. Total Environ. 2022, 825, 154054. [Google Scholar] [CrossRef]
  17. Collier, M.P.; Benesch, J.L.P. Small Heat-Shock Proteins and Their Role in Mechanical Stress. Cell Stress Chaperones 2020, 25, 601–613. [Google Scholar] [CrossRef]
  18. Waters, E.R.; Vierling, E. Plant Small Heat Shock Proteins—Evolutionary and Functional Diversity. New Phytol. 2020, 227, 24–37. [Google Scholar] [CrossRef]
  19. Park, C.J.; Seo, Y.S. Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity. Plant Pathol. J. 2015, 31, 323–333. [Google Scholar] [CrossRef]
  20. Hu, C.; Yang, J.; Qi, Z.; Wu, H.; Wang, B.; Zou, F.; Mei, H.; Liu, J.; Wang, W.; Liu, Q. Heat Shock Proteins: Biological Functions, Pathological Roles, and Therapeutic Opportunities. MedComm 2022, 3, e161. [Google Scholar] [CrossRef]
  21. Ul Haq, S.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.X.; Zhang, H.X.; Wei, A.M.; Gong, Z.H. Heat Shock Proteins: Dynamic Biomolecules to Counter Plant Biotic and Abiotic Stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef]
  22. Firmansyah, F.; Argosubekti, N. A Review of Heat Stress Signaling in Plants. IOP Conf. Ser. Earth Environ. Sci. 2020, 484, 012041. [Google Scholar] [CrossRef]
  23. Guo, L.M.; Li, J.; He, J.; Liu, H.; Zhang, H.M. A Class I Cytosolic HSP20 of Rice Enhances Heat and Salt Tolerance in Different Organisms. Sci. Rep. 2020, 10, 1383. [Google Scholar] [CrossRef]
  24. Lopes-Caitar, V.S.; de Carvalho, M.C.C.G.; Darben, L.M.; Kuwahara, M.K.; Nepomuceno, A.L.; Dias, W.P.; Abdelnoor, R.V.; Marcelino-Guimarães, F.C. Genome-Wide Analysis of the Hsp20 Gene Family in Soybean: Comprehensive Sequence, Genomic Organization and Expression Profile Analysis under Abiotic and Biotic Stresses. BMC Genom. 2013, 14, 577. [Google Scholar] [CrossRef] [PubMed]
  25. Sun, J.T.; Cheng, G.X.; Huang, L.J.; Liu, S.; Ali, M.; Khan, A.; Yu, Q.H.; Yang, S.B.; Luo, D.X.; Gong, Z.H. Modified Expression of a Heat Shock Protein Gene, CaHSP22.0, Results in High Sensitivity to Heat and Salt Stress in Pepper (Capsicum annuum L.). Sci. Hortic. 2019, 249, 364–373. [Google Scholar] [CrossRef]
  26. Kumar, A.; Sharma, S.; Chunduri, V.; Kaur, A.; Kaur, S.; Malhotra, N.; Kumar, A.; Kapoor, P.; Kumari, A.; Kaur, J.; et al. Genome-Wide Identification and Characterization of Heat Shock Protein Family Reveals Role in Development and Stress Conditions in Triticum aestivum L. Sci. Rep. 2020, 10, 7858. [Google Scholar] [CrossRef]
  27. Zou, J.; Liu, C.; Liu, A.; Zou, D.; Chen, X. Overexpression of OsHsp17.0 and OsHsp23.7 Enhances Drought and Salt Tolerance in Rice. J. Plant Physiol. 2012, 169, 628–635. [Google Scholar] [CrossRef]
  28. Sato, Y.; Yokoya, S. Enhanced Tolerance to Drought Stress in Transgenic Rice Plants Overexpressing a Small Heat-Shock Protein, SHSP17.7. Plant Cell Rep. 2008, 27, 329–334. [Google Scholar] [CrossRef]
  29. Murakami, T.; Matsuba, S.; Funatsuki, H.; Kawaguchi, K.; Saruyama, H.; Tanida, M.; Sato, Y. Over-Expression of a Small Heat Shock Protein, SHSP17.7, Confers Both Heat Tolerance and UV-B Resistance to Rice Plants. Mol. Breed. 2004, 13, 165–175. [Google Scholar] [CrossRef]
  30. Wang, X.; Zhang, H.; Shao, L.Y.; Yan, X.; Peng, H.; Ouyang, J.X.; Li, S.B. Expression and Function Analysis of a Rice OsHSP40 Gene under Salt Stress. Genes Genom. 2019, 41, 175–182. [Google Scholar] [CrossRef]
  31. Bae, M.J.; Kim, Y.S.; Kim, I.S.; Choe, Y.H.; Lee, E.J.; Kim, Y.H.; Park, H.M.; Yoon, H.S. Transgenic Rice Overexpressing the Brassica Juncea Gamma-Glutamylcysteine Synthetase Gene Enhances Tolerance to Abiotic Stress and Improves Grain Yield under Paddy Field Conditions. Mol. Breed. 2013, 31, 931–945. [Google Scholar] [CrossRef]
  32. Gueta-Dahan, Y.; Yaniv, Z.; Zilinskas, B.A.; Ben-Hayyim, G. Salt and Oxidative Stress: Similar and Specific Responses and Their Relation to Salt Tolerance in Citrus. Planta 1997, 203, 460–469. [Google Scholar] [CrossRef]
  33. Park, S.I.; Kim, Y.S.; Kim, J.J.; Mok, J.E.; Kim, Y.H.; Park, H.M.; Kim, I.S.; Yoon, H.S. Improved Stress Tolerance and Productivity in Transgenic Rice Plants Constitutively Expressing the Oryza Sativa Glutathione Synthetase OsGS under Paddy Field Conditions. J. Plant Physiol. 2017, 215, 39–47. [Google Scholar] [CrossRef]
  34. Nakano, Y.; Asada, K. Hydrogen Peroxide Is Scavenged by Ascorbate-Specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
  35. Lee, D.H.; Kim, Y.S.; Lee, C.B. The Inductive Responses of the Antioxidant Enzymes by Salt Stress in the Rice (Oryza sativa L.). J. Plant Physiol. 2001, 158, 737–745. [Google Scholar] [CrossRef]
  36. Jebara, S.; Jebara, M.; Limam, F.; Aouani, M.E. Changes in Ascorbate Peroxidase, Catalase, Guaiacol Peroxidase and Superoxide Dismutase Activities in Common Bean (Phaseolus vulgaris) Nodules under Salt Stress. J. Plant Physiol. 2005, 162, 929–936. [Google Scholar] [CrossRef]
  37. Chen, T.H.H.; Murata, N. Enhancement of Tolerance of Abiotic Stress by Metabolic Engineering of Betaines and Other Compatible Solutes. Curr. Opin. Plant Biol. 2002, 5, 250–257. [Google Scholar] [CrossRef]
  38. Choe, Y.H.; Kim, Y.S.; Kim, I.S.; Bae, M.J.; Lee, E.J.; Kim, Y.H.; Park, H.M.; Yoon, H.S. Homologous Expression of γ-Glutamylcysteine Synthetase Increases Grain Yield and Tolerance of Transgenic Rice Plants to Environmental Stresses. J. Plant Physiol. 2013, 170, 610–618. [Google Scholar] [CrossRef]
  39. Hasanuzzaman, M.; Bhuyan, M.H.M.B.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Al Mahmud, J.; Fujita, M.; Fotopoulos, V. Reactive Oxygen Species and Antioxidant Defense in Plants under Abiotic Stress: Revisiting the Crucial Role of a Universal Defense Regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
  40. Li, Z.-Y.; Long, R.-C.; Zhang, T.-J.; Yang, Q.-C.; Kang, J.-M. Molecular Cloning and Characterization of the MsHSP17.7 Gene from Medicago sativa L. Mol. Biol. Rep. 2016, 43, 815–826. [Google Scholar] [CrossRef]
  41. Yang, R.; Yu, G.; Li, H.; Li, X.; Mu, C. Overexpression of Small Heat Shock Protein LimHSP16.45 in Arabidopsis hsp17.6II Mutant Enhances Tolerance to Abiotic Stresses. Russ. J. Plant Physiol. 2020, 67, 231–241. [Google Scholar] [CrossRef]
  42. Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzaman, M. Abiotic Stress and Reactive Oxygen Species: Generation, Signaling, and Defense Mechanisms. Antioxidants 2021, 10, 277. [Google Scholar] [CrossRef] [PubMed]
  43. Panchuk, I.I.; Volkov, R.A.; Schöffl, F. Heat Stress- and Heat Shock Transcription Factor-Dependent Expression and Activity of Ascorbate Peroxidase in Arabidopsis. Plant Physiol. 2002, 129, 838–853. [Google Scholar] [CrossRef] [PubMed]
Agriculture 13 00931 g001 550
Figure 1. Production and expression of OsHSP 17.9 in transgenic plants. (A) Schematic diagram of OsHSP vector construction. The HSP plasmid is expressed and terminated by a maize ubiquitin promoter and a nos terminator and consists of a hygromycin resistance gene. (B) Genomic DNA of transgenic rice plants was detected by PCR. Tubulin was used as a housekeeping control gene.
Figure 1. Production and expression of OsHSP 17.9 in transgenic plants. (A) Schematic diagram of OsHSP vector construction. The HSP plasmid is expressed and terminated by a maize ubiquitin promoter and a nos terminator and consists of a hygromycin resistance gene. (B) Genomic DNA of transgenic rice plants was detected by PCR. Tubulin was used as a housekeeping control gene.
Agriculture 13 00931 g001
Agriculture 13 00931 g002 550
Figure 2. Phenotypic analysis of stress tolerance in WT and transgenic plants. (A) Four-week-old WT and transgenic plants were treated with 150 mM NaCl for 7 days and recovered for 7 days. (B) WT and transgenic plants were grown for 4 weeks at 30 °C, exposed to 42 °C for 1 day (high temperature), and then recovered at 30 °C for 7 days.
Figure 2. Phenotypic analysis of stress tolerance in WT and transgenic plants. (A) Four-week-old WT and transgenic plants were treated with 150 mM NaCl for 7 days and recovered for 7 days. (B) WT and transgenic plants were grown for 4 weeks at 30 °C, exposed to 42 °C for 1 day (high temperature), and then recovered at 30 °C for 7 days.
Agriculture 13 00931 g002
Agriculture 13 00931 g003 550
Figure 3. Semi-quantitative RT-PCR of transgenic and WT plant leaf after 12 h of each stress treatment. The expression levels of OsHSP 17.9 and other sHSPs which formed hetero-oligomeric with OsHSP 17.9.
Figure 3. Semi-quantitative RT-PCR of transgenic and WT plant leaf after 12 h of each stress treatment. The expression levels of OsHSP 17.9 and other sHSPs which formed hetero-oligomeric with OsHSP 17.9.
Agriculture 13 00931 g003
Agriculture 13 00931 g004 550
Figure 4. Comparison of ROS content under oxidative stress. (A) Comparative analysis of MDA content under normal, salt, and high-temperature stress conditions using the TBARS method. (B) Comparative analysis of H2O2 content under normal, salt, and high-temperature stress conditions. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Figure 4. Comparison of ROS content under oxidative stress. (A) Comparative analysis of MDA content under normal, salt, and high-temperature stress conditions using the TBARS method. (B) Comparative analysis of H2O2 content under normal, salt, and high-temperature stress conditions. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Agriculture 13 00931 g004
Agriculture 13 00931 g005 550
Figure 5. Comparative analysis of early growth and environment adaptability in a natural paddy field after 4 weeks of transplantation. (A,B) Phenotype of WT and transgenic plants. (C) Relative total plant weight (TPW), culm weight (CW), and root weight (RW) of WT and transgenic plants. (D) Root length of WT and transgenic plants at different time points. (E) Number of tillers from 4 to 8 weeks in WT and transgenic plants. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Figure 5. Comparative analysis of early growth and environment adaptability in a natural paddy field after 4 weeks of transplantation. (A,B) Phenotype of WT and transgenic plants. (C) Relative total plant weight (TPW), culm weight (CW), and root weight (RW) of WT and transgenic plants. (D) Root length of WT and transgenic plants at different time points. (E) Number of tillers from 4 to 8 weeks in WT and transgenic plants. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Agriculture 13 00931 g005
Agriculture 13 00931 g006 550
Figure 6. Oxidative stress tolerance test in a natural paddy field in response to 50 μM MV solution. (A) DAB and NBT staining of leaves of WT and transgenic plants. (B) Comparison of MDA contents of WT and transgenic plants. (C) Relative H2O2 contents of WT and transgenic plants. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Figure 6. Oxidative stress tolerance test in a natural paddy field in response to 50 μM MV solution. (A) DAB and NBT staining of leaves of WT and transgenic plants. (B) Comparison of MDA contents of WT and transgenic plants. (C) Relative H2O2 contents of WT and transgenic plants. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Agriculture 13 00931 g006
Agriculture 13 00931 g007 550
Figure 7. Analysis of ion leakage in leaf disks of WT and transgenic plants treated with 10 μM MV.
Figure 7. Analysis of ion leakage in leaf disks of WT and transgenic plants treated with 10 μM MV.
Agriculture 13 00931 g007
Agriculture 13 00931 g008 550
Figure 8. Antioxidant enzyme activities in WT and transgenic plants grown in a natural paddy field. (A) Schematic image of antioxidant enzyme activity in rice plants. (B) Relative enzyme activities in WT and transgenic plants. APX, ascorbate peroxidase; PRX, peroxiredoxin; CAT, catalase; GPX, glutathione peroxidase. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Figure 8. Antioxidant enzyme activities in WT and transgenic plants grown in a natural paddy field. (A) Schematic image of antioxidant enzyme activity in rice plants. (B) Relative enzyme activities in WT and transgenic plants. APX, ascorbate peroxidase; PRX, peroxiredoxin; CAT, catalase; GPX, glutathione peroxidase. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Agriculture 13 00931 g008
Agriculture 13 00931 g009 550
Figure 9. Agronomic traits of WT and transgenic plants grown in under natural paddy-field conditions for 2 years (2017–2018). (A) Phenotypes of late-reproductive-stage plants and relative agronomic traits in 2017. (B) Phenotypes of late-reproductive-stage plants and relative agronomic traits in 2018. TPW, total plant weight; CW, culm weight; RW, root weight; NT, number of tillers; NP, number of panicles per hill; GGW, gross grain weight; TGW, 1000-grain weight; NSP, number of spikelets per panicle; NTG, number of total grain. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Figure 9. Agronomic traits of WT and transgenic plants grown in under natural paddy-field conditions for 2 years (2017–2018). (A) Phenotypes of late-reproductive-stage plants and relative agronomic traits in 2017. (B) Phenotypes of late-reproductive-stage plants and relative agronomic traits in 2018. TPW, total plant weight; CW, culm weight; RW, root weight; NT, number of tillers; NP, number of panicles per hill; GGW, gross grain weight; TGW, 1000-grain weight; NSP, number of spikelets per panicle; NTG, number of total grain. Asterisk (*) indicates statistical significance as determined by Student’s t test (p < 0.05).
Agriculture 13 00931 g009
Table
Table 1. Primer set for semi-qRT-PCR.
Table 1. Primer set for semi-qRT-PCR.
Primer Set5′-3′
OsHSP-F2AGCATCTTCCCGTCCTTCC
OsHSP-R4TGACCTCCTCCTTCTTCAGC
OsHSP-26.7-FCAGGAGAACAGGGACAACAC
OsHSP-26.7-RCCATCGTGTCCAGCATCT
OsHSP-23.2-FATGGCGTCGATGAGAACT
OsHSP-23.2-RAGGTCCTCCTTCCTCATCC
OsHSP-18.1-FAAGGAGCAGGAGGAGAAGAC
OsHSP-18.1-RTAACCTGGATGGACTTGACG
OsHSP-17.7-FAGGAGGAGAAGTCGGACAAG
OsHSP-17.7-RAGATCTGGATGGACTTGACG
OsHSP-16.9-FGAAGGAGGACAAGAACGACA
OsHSP-16.9-RTTAACCGGAGATCTCAATGG
Tub-FGAGTACCCTGACCGCATGAT
Tub-RGTGGTCAGCTTGAGAGTCCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Do, J.-M.; Kim, H.-J.; Shin, S.-Y.; Park, S.-I.; Kim, J.-J.; Yoon, H.-S. OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants. Agriculture 2023, 13, 931. https://doi.org/10.3390/agriculture13050931

AMA Style

Do J-M, Kim H-J, Shin S-Y, Park S-I, Kim J-J, Yoon H-S. OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants. Agriculture. 2023; 13(5):931. https://doi.org/10.3390/agriculture13050931

Chicago/Turabian Style

Do, Jeong-Mi, Hee-Jin Kim, Sun-Young Shin, Seong-Im Park, Jin-Ju Kim, and Ho-Sung Yoon. 2023. "OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants" Agriculture 13, no. 5: 931. https://doi.org/10.3390/agriculture13050931

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop