OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Stress Treatments
2.2. Genomic DNA Isolation and PCR Analysis
2.3. Analysis of Semi-Quantitative RT-PCR
2.4. Measurement of Accumulative ROS Content
2.5. Evaluation of Early Growth in a Natural Paddy Field and Ion Leakage in Response to Methyl Viologen (MV)
2.6. Antioxidant Enzyme Assay
2.7. Evaluation of Early Growth and Agronomic Traits in a Natural Paddy Field
2.8. Statistical Analysis
3. Results
3.1. Production of OsHSP 17.9 Gene Transgenic Plants
3.2. Comparison of Phenotype and OsHSP 17.9 Gene Expression Levels in Salt and High-Temperature Stress
3.3. Analysis of Oxidative Stress Tolerance through Accumulated MDA and H2O2 Content
3.4. Early Growth and Environmental Adaptability in a Natural Paddy Field and Ion Leakage in Response to MV
3.5. Enhanced Antioxidant Enzyme Activity of Transgenic Plants Grown in a Natural Paddy Field
3.6. Grain Yield and Agronomic Analysis in Natural Paddy-Field Conditions
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Radhakrishnan, R. Magnetic Field Regulates Plant Functions, Growth and Enhances Tolerance against Environmental Stresses. Physiol. Mol. Biol. Plants 2019, 25, 1107–1119. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Kumar, V.; Kapoor, D.; Kumar, S.; Singh, S.; Dhanjal, D.S.; Datta, S.; Samuel, J.; Dey, P.; Wang, S.; et al. Revealing on Hydrogen Sulfide and Nitric Oxide Signals Co-Ordination for Plant Growth under Stress Conditions. Physiol. Plant. 2020, 168, 301–317. [Google Scholar] [CrossRef] [PubMed]
- Cohen, I.; Zandalinas, S.I.; Huck, C.; Fritschi, F.B.; Mittler, R. Meta-Analysis of Drought and Heat Stress Combination Impact on Crop Yield and Yield Components. Physiol. Plant. 2021, 171, 66–76. [Google Scholar] [CrossRef] [PubMed]
- Shah, F.; Wu, W. Soil and Crop Management Strategies to Ensure Higher Crop Productivity within Sustainable Environments. Sustainability 2019, 11, 1485. [Google Scholar] [CrossRef]
- El-Esawi, M.A.; Alayafi, A.A. Overexpression of Rice Rab7 Gene Improves Drought and Heat Tolerance and Increases Grain Yield in Rice (Oryza sativa L.). Genes 2019, 10, 56. [Google Scholar] [CrossRef]
- Verma, S.; Dubey, R.S. Lead Toxicity Induces Lipid Peroxidation and Alters the Activities of Antioxidant Enzymes in Growing Rice Plants. Plant Sci. 2003, 164, 645–655. [Google Scholar] [CrossRef]
- Gechev, T.; Petrov, V. Reactive Oxygen Species and Abiotic Stress in Plants. Int. J. Mol. Sci. 2020, 21, 7433. [Google Scholar] [CrossRef]
- Devireddy, A.R.; Tschaplinski, T.J.; Tuskan, G.A.; Muchero, W.; Chen, J.G. Role of Reactive Oxygen Species and Hormones in Plant Responses to Temperature Changes. Int. J. Mol. Sci. 2021, 22, 8843. [Google Scholar] [CrossRef]
- Mishra, D.; Shekhar, S.; Singh, D.; Chakraborty, S.; Chakraborty, N. Heat Shock Proteins and Abiotic Stress Tolerance in Plants; Springer: New York, NY, USA, 2018; pp. 41–69. [Google Scholar] [CrossRef]
- Balchin, D.; Hayer-Hartl, M.; Hartl, F.U. In Vivo Aspects of Protein Folding and Quality Control. Science 2016, 353, aac4354. [Google Scholar] [CrossRef]
- Khan, S.; Jabeen, R.; Deeba, F.; Waheed, U.; Khanum, P.; Iqbal, N. Heat Shock Proteins: Classification, Functions and Expressions in Plants during Environmental Stresses. J. Bioresour. Manag. 2021, 8, 85–97. [Google Scholar] [CrossRef]
- Singh, L.P.; Gill, S.S.; Tuteja, N. Unraveling the Role of Fungal Symbionts in Plant Abiotic Stress Tolerance. Plant Signal. Behav. 2011, 6, 175–191. [Google Scholar] [CrossRef]
- Vermeulen, S.J.; Aggarwal, P.K.; Ainslie, A.; Angelone, C.; Campbell, B.M.; Challinor, A.J.; Hansen, J.W.; Ingram, J.S.I.; Jarvis, A.; Kristjanson, P.; et al. Options for Support to Agriculture and Food Security under Climate Change. Environ. Sci. Policy 2012, 15, 136–144. [Google Scholar] [CrossRef]
- Bakthisaran, R.; Tangirala, R.; Rao, C.M. Small Heat Shock Proteins: Role in Cellular Functions and Pathology. Biochim. Biophys. Acta Proteins Proteom. 2015, 1854, 291–319. [Google Scholar] [CrossRef]
- Sun, X.; Zhu, J.; Li, X.; Li, Z.; Han, L.; Luo, H. Heat Shock Protein Integrates Different Signaling Pathways to Modulate Plant Abiotic Stress Response. BMC Plant Biol. 2020, 20, 184. [Google Scholar] [CrossRef]
- Wu, J.; Gao, T.; Hu, J.; Zhao, L.; Yu, C.; Ma, F. Research Advances in Function and Regulation Mechanisms of Plant Small Heat Shock Proteins (sHSPs) under Environmental Stresses. Sci. Total Environ. 2022, 825, 154054. [Google Scholar] [CrossRef]
- Collier, M.P.; Benesch, J.L.P. Small Heat-Shock Proteins and Their Role in Mechanical Stress. Cell Stress Chaperones 2020, 25, 601–613. [Google Scholar] [CrossRef]
- Waters, E.R.; Vierling, E. Plant Small Heat Shock Proteins—Evolutionary and Functional Diversity. New Phytol. 2020, 227, 24–37. [Google Scholar] [CrossRef]
- Park, C.J.; Seo, Y.S. Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity. Plant Pathol. J. 2015, 31, 323–333. [Google Scholar] [CrossRef]
- Hu, C.; Yang, J.; Qi, Z.; Wu, H.; Wang, B.; Zou, F.; Mei, H.; Liu, J.; Wang, W.; Liu, Q. Heat Shock Proteins: Biological Functions, Pathological Roles, and Therapeutic Opportunities. MedComm 2022, 3, e161. [Google Scholar] [CrossRef]
- Ul Haq, S.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.X.; Zhang, H.X.; Wei, A.M.; Gong, Z.H. Heat Shock Proteins: Dynamic Biomolecules to Counter Plant Biotic and Abiotic Stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef]
- Firmansyah, F.; Argosubekti, N. A Review of Heat Stress Signaling in Plants. IOP Conf. Ser. Earth Environ. Sci. 2020, 484, 012041. [Google Scholar] [CrossRef]
- Guo, L.M.; Li, J.; He, J.; Liu, H.; Zhang, H.M. A Class I Cytosolic HSP20 of Rice Enhances Heat and Salt Tolerance in Different Organisms. Sci. Rep. 2020, 10, 1383. [Google Scholar] [CrossRef]
- Lopes-Caitar, V.S.; de Carvalho, M.C.C.G.; Darben, L.M.; Kuwahara, M.K.; Nepomuceno, A.L.; Dias, W.P.; Abdelnoor, R.V.; Marcelino-Guimarães, F.C. Genome-Wide Analysis of the Hsp20 Gene Family in Soybean: Comprehensive Sequence, Genomic Organization and Expression Profile Analysis under Abiotic and Biotic Stresses. BMC Genom. 2013, 14, 577. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.T.; Cheng, G.X.; Huang, L.J.; Liu, S.; Ali, M.; Khan, A.; Yu, Q.H.; Yang, S.B.; Luo, D.X.; Gong, Z.H. Modified Expression of a Heat Shock Protein Gene, CaHSP22.0, Results in High Sensitivity to Heat and Salt Stress in Pepper (Capsicum annuum L.). Sci. Hortic. 2019, 249, 364–373. [Google Scholar] [CrossRef]
- Kumar, A.; Sharma, S.; Chunduri, V.; Kaur, A.; Kaur, S.; Malhotra, N.; Kumar, A.; Kapoor, P.; Kumari, A.; Kaur, J.; et al. Genome-Wide Identification and Characterization of Heat Shock Protein Family Reveals Role in Development and Stress Conditions in Triticum aestivum L. Sci. Rep. 2020, 10, 7858. [Google Scholar] [CrossRef]
- Zou, J.; Liu, C.; Liu, A.; Zou, D.; Chen, X. Overexpression of OsHsp17.0 and OsHsp23.7 Enhances Drought and Salt Tolerance in Rice. J. Plant Physiol. 2012, 169, 628–635. [Google Scholar] [CrossRef]
- Sato, Y.; Yokoya, S. Enhanced Tolerance to Drought Stress in Transgenic Rice Plants Overexpressing a Small Heat-Shock Protein, SHSP17.7. Plant Cell Rep. 2008, 27, 329–334. [Google Scholar] [CrossRef]
- Murakami, T.; Matsuba, S.; Funatsuki, H.; Kawaguchi, K.; Saruyama, H.; Tanida, M.; Sato, Y. Over-Expression of a Small Heat Shock Protein, SHSP17.7, Confers Both Heat Tolerance and UV-B Resistance to Rice Plants. Mol. Breed. 2004, 13, 165–175. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, H.; Shao, L.Y.; Yan, X.; Peng, H.; Ouyang, J.X.; Li, S.B. Expression and Function Analysis of a Rice OsHSP40 Gene under Salt Stress. Genes Genom. 2019, 41, 175–182. [Google Scholar] [CrossRef]
- Bae, M.J.; Kim, Y.S.; Kim, I.S.; Choe, Y.H.; Lee, E.J.; Kim, Y.H.; Park, H.M.; Yoon, H.S. Transgenic Rice Overexpressing the Brassica Juncea Gamma-Glutamylcysteine Synthetase Gene Enhances Tolerance to Abiotic Stress and Improves Grain Yield under Paddy Field Conditions. Mol. Breed. 2013, 31, 931–945. [Google Scholar] [CrossRef]
- Gueta-Dahan, Y.; Yaniv, Z.; Zilinskas, B.A.; Ben-Hayyim, G. Salt and Oxidative Stress: Similar and Specific Responses and Their Relation to Salt Tolerance in Citrus. Planta 1997, 203, 460–469. [Google Scholar] [CrossRef]
- Park, S.I.; Kim, Y.S.; Kim, J.J.; Mok, J.E.; Kim, Y.H.; Park, H.M.; Kim, I.S.; Yoon, H.S. Improved Stress Tolerance and Productivity in Transgenic Rice Plants Constitutively Expressing the Oryza Sativa Glutathione Synthetase OsGS under Paddy Field Conditions. J. Plant Physiol. 2017, 215, 39–47. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen Peroxide Is Scavenged by Ascorbate-Specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Lee, D.H.; Kim, Y.S.; Lee, C.B. The Inductive Responses of the Antioxidant Enzymes by Salt Stress in the Rice (Oryza sativa L.). J. Plant Physiol. 2001, 158, 737–745. [Google Scholar] [CrossRef]
- Jebara, S.; Jebara, M.; Limam, F.; Aouani, M.E. Changes in Ascorbate Peroxidase, Catalase, Guaiacol Peroxidase and Superoxide Dismutase Activities in Common Bean (Phaseolus vulgaris) Nodules under Salt Stress. J. Plant Physiol. 2005, 162, 929–936. [Google Scholar] [CrossRef]
- Chen, T.H.H.; Murata, N. Enhancement of Tolerance of Abiotic Stress by Metabolic Engineering of Betaines and Other Compatible Solutes. Curr. Opin. Plant Biol. 2002, 5, 250–257. [Google Scholar] [CrossRef]
- Choe, Y.H.; Kim, Y.S.; Kim, I.S.; Bae, M.J.; Lee, E.J.; Kim, Y.H.; Park, H.M.; Yoon, H.S. Homologous Expression of γ-Glutamylcysteine Synthetase Increases Grain Yield and Tolerance of Transgenic Rice Plants to Environmental Stresses. J. Plant Physiol. 2013, 170, 610–618. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Bhuyan, M.H.M.B.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Al Mahmud, J.; Fujita, M.; Fotopoulos, V. Reactive Oxygen Species and Antioxidant Defense in Plants under Abiotic Stress: Revisiting the Crucial Role of a Universal Defense Regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
- Li, Z.-Y.; Long, R.-C.; Zhang, T.-J.; Yang, Q.-C.; Kang, J.-M. Molecular Cloning and Characterization of the MsHSP17.7 Gene from Medicago sativa L. Mol. Biol. Rep. 2016, 43, 815–826. [Google Scholar] [CrossRef]
- Yang, R.; Yu, G.; Li, H.; Li, X.; Mu, C. Overexpression of Small Heat Shock Protein LimHSP16.45 in Arabidopsis hsp17.6II Mutant Enhances Tolerance to Abiotic Stresses. Russ. J. Plant Physiol. 2020, 67, 231–241. [Google Scholar] [CrossRef]
- Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzaman, M. Abiotic Stress and Reactive Oxygen Species: Generation, Signaling, and Defense Mechanisms. Antioxidants 2021, 10, 277. [Google Scholar] [CrossRef] [PubMed]
- Panchuk, I.I.; Volkov, R.A.; Schöffl, F. Heat Stress- and Heat Shock Transcription Factor-Dependent Expression and Activity of Ascorbate Peroxidase in Arabidopsis. Plant Physiol. 2002, 129, 838–853. [Google Scholar] [CrossRef] [PubMed]
Primer Set | 5′-3′ |
---|---|
OsHSP-F2 | AGCATCTTCCCGTCCTTCC |
OsHSP-R4 | TGACCTCCTCCTTCTTCAGC |
OsHSP-26.7-F | CAGGAGAACAGGGACAACAC |
OsHSP-26.7-R | CCATCGTGTCCAGCATCT |
OsHSP-23.2-F | ATGGCGTCGATGAGAACT |
OsHSP-23.2-R | AGGTCCTCCTTCCTCATCC |
OsHSP-18.1-F | AAGGAGCAGGAGGAGAAGAC |
OsHSP-18.1-R | TAACCTGGATGGACTTGACG |
OsHSP-17.7-F | AGGAGGAGAAGTCGGACAAG |
OsHSP-17.7-R | AGATCTGGATGGACTTGACG |
OsHSP-16.9-F | GAAGGAGGACAAGAACGACA |
OsHSP-16.9-R | TTAACCGGAGATCTCAATGG |
Tub-F | GAGTACCCTGACCGCATGAT |
Tub-R | GTGGTCAGCTTGAGAGTCCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Do, J.-M.; Kim, H.-J.; Shin, S.-Y.; Park, S.-I.; Kim, J.-J.; Yoon, H.-S. OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants. Agriculture 2023, 13, 931. https://doi.org/10.3390/agriculture13050931
Do J-M, Kim H-J, Shin S-Y, Park S-I, Kim J-J, Yoon H-S. OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants. Agriculture. 2023; 13(5):931. https://doi.org/10.3390/agriculture13050931
Chicago/Turabian StyleDo, Jeong-Mi, Hee-Jin Kim, Sun-Young Shin, Seong-Im Park, Jin-Ju Kim, and Ho-Sung Yoon. 2023. "OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants" Agriculture 13, no. 5: 931. https://doi.org/10.3390/agriculture13050931
APA StyleDo, J.-M., Kim, H.-J., Shin, S.-Y., Park, S.-I., Kim, J.-J., & Yoon, H.-S. (2023). OsHSP 17.9, a Small Heat Shock Protein, Confers Improved Productivity and Tolerance to High Temperature and Salinity in a Natural Paddy Field in Transgenic Rice Plants. Agriculture, 13(5), 931. https://doi.org/10.3390/agriculture13050931