Transcriptome Analysis of Propylaea quatuordecimpunctata L. (Coleoptera: Coccinellidae) under High Temperature Stress
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Heat Stress Treatments
2.3. RNA Extraction and Transcriptome Sequencing
2.4. Quality Control, Analysis, and Functional Annotation
2.5. Differentially Expressed Genes (DEGs) and Functional Enrichment Analysis
2.6. Quantitative Real-Time PCR (qRT-PCR)
2.7. Data Analysis
3. Results
3.1. Transcriptome Sequencing Quality Assessment and Functional Annotation
3.2. Differentially Expressed Genes (DEGs)
3.3. GO Enrichment Analysis of DEGs
3.4. KEGG Enrichment Analysis of DEGs
3.5. Real-Time Fluorescence Quantitative PCR Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Michel, D.K.; Fiaboe, K.K.M.; Kekeunou, S.; Nanga, S.N.; Kuate, A.F.; Tonnang, H.E.Z.; Gnanvossou, D.; Hanna, R. Temperature-based phenology model to predict the development, survival, and reproduction of the Oriental fruit fly Bactrocera dorsalis. J. Therm. Biol. 2021, 97, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Keena, M.A.; Moore, P.M.; Bradford, G. Effects of temperature on Anoplophora chinensis (Coleoptera: Cerambycidae) adult survival, reproduction, and egg hatch. Forests 2021, 12, 432. [Google Scholar] [CrossRef]
- Luis, A.; Xavier, P. Effect of high temperature on the growth and reproduction of corn aphids (Homoptera: Aphididae) and implications for their population dynamics on the Northeastern Iberian Peninsula. Environ. Entomol. 2001, 6, 1127–1134. [Google Scholar]
- Liu, X.D.; Zhang, A.M. High temperature determines the ups and downs of small brown planthopper Laodelphax striatellus population. Insect Sci. 2013, 20, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, C.M.D.; Silvatorres, C.S.A.D.; Torres, J.B.; Silva, G.D.S. Estimation of population growth for two species of lady beetles (Coleoptera: Coccinellidae) under different temperatures. Biocontrol Sci. Technol. 2022, 32, 74–89. [Google Scholar] [CrossRef]
- Vanhanen, H.; Veleli, T.O.; Paivinen, S.; Kellomaki, S.; Niemela, P. Climate change and range shifts in two insect defoliators: Gypsy moth and moth-a model study. Silva Fenni. 2007, 41, 621–638. [Google Scholar] [CrossRef] [Green Version]
- Jiang, F.Z.; Zheng, L.Y.; Guo, J.X.; Zhang, G.R. Effects of temperature stress on insect fertility and its physiological and biochemical mechanisms. J. Environ. Entomol. 2015, 37, 653–663. [Google Scholar]
- Zhang, Q.L.; Yuan, M.L. Progress in insect transcriptomics based on the next-generation sequencing technique. Acta Entomol. Sin. 2013, 56, 1489–1508. [Google Scholar]
- Liu, Y.C.; Su, H.; Li, R.Q.; Li, X.T.; Xu, Y.S.; Dai, X.P.; Zhou, Y.Y.; Wang, H.B. Comparative transcriptome analysis of Glyphodes pyloalis Walker (Lepidoptera: Pyralidae) reveals novel insights into heat stress tolerance in insects. BMC Genom. 2017, 18, 974. [Google Scholar] [CrossRef]
- Neven, L.G. Physiological responses of insects to heat. Postharvest Biol. Technol. 2000, 21, 103–111. [Google Scholar] [CrossRef]
- Ma, C.S.; Ma, G.; Pincebourde, S. Survive a warming climate: Insect Responses to Extreme High Temperatures. Annu. Rev. Entomol. 2021, 66, 163–184. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.H.; Cai, T.W.; Ren, Z.J.; Liu, Y.; Yuan, M.J.; Cai, Y.F.; Yu, C.; Shu, R.H.; He, S.; Li, J.H.; et al. Decline in symbiont-dependent host detoxification metabolism contributes to increased insecticide susceptibility of insects under high temperature. ISME J. 2021, 15, 3693–3703. [Google Scholar] [CrossRef] [PubMed]
- Du, R.; Ma, C.S.; Zhao, Q.H.; Ma, G.; Yang, H.P. Effects of heat stress on physiological and biochemical mechanisms of insects: A literature review. Acta Ecol. Sin. 2007, 4, 1565–1572. [Google Scholar]
- Mutz, K.O.; Heilkenbrinker, A.; Lönne, M.; Walter, J.G.; Stahl, F. Transcriptome analysis using next-generation sequencing. Curr. Opin. Biotechnol. 2013, 24, 22–30. [Google Scholar] [CrossRef]
- Guo, H.Z.; Huang, C.L.; Jiang, L.; Cheng, T.C.; Feng, T.S.; Xia, Q.Y. Transcriptome analysis of the response of silkworm to drastic changes in ambient temperature. Appl. Microbiol. Biot. 2018, 102, 10161–10170. [Google Scholar] [CrossRef] [PubMed]
- Ran, L.Y.; Jiang, C.X.; Yang, Q.F.; Wang, H.J.; Bai Ma, T.Z.; Chen, L.; Kuang, J.K.; Huang, T.T.; Li, Q. Comparative transcriptome analysis of Locusta migratoria tibetensis Chen (Orthoptera: Oedipodidae) under high- and low-temperature stress. J. Appl. Entomol. 2020, 144, 181–190. [Google Scholar] [CrossRef]
- Shen, H.Y.; He, H.; Lu, C.D.; Liang, Y.; Wu, H.M.; Zheng, L.Z.; Wang, X.Y.; Liang, G.H. Comparative transcriptome analysis of two populations of Dastarcus helophoroides (Fairmaire) under high temperature stress. Forests 2022, 13, 13. [Google Scholar] [CrossRef]
- Yuan, J.W.; Qin, J.; Wei, R.; Xie, H.F.; Du, Y.Z. Transcriptome analysis of responses of western flower thrips Frankliniella occidentalis to high and low temperature stresses. J. Plant Protec. 2021, 48, 1400–1410. [Google Scholar]
- Vatanparast, M.; Park, Y. Differential transcriptome analysis reveals genes related to low- and high-temperature stress in the Fall Armyworm, Spodoptera frugiperda. Front. Physiol. 2022, 12, 827077. [Google Scholar] [CrossRef]
- Wyckhuys, K.A.G.; Lu, Y.H.; Morales, H.; Vazquez, L.L.; Legaspi, J.C.; Eliopoulos, P.A.; Hernandez, L.M. Current status and potential of conservation biological control for agriculture in the developing world. Biol. Control 2013, 65, 152–167. [Google Scholar] [CrossRef]
- Wyckhuys, K.A.G.; Lu, Y.H.; Zhou, W.W.; Cock, M.J.W.; Naranjo, S.E.; Fereti, A.; Williams, F.E.; Furlong, M.J. Ecological pest control fortifies agricultural growth in Asia-Pacific economies. Nat. Ecol. Evol. 2020, 4, 1522–1530. [Google Scholar] [CrossRef] [PubMed]
- Obrycki, J.J.; Orr, D.B.; Orr, C.J.; Wallendorf, M.; Flanders, R.V. Comparative developmental and reproductive biology of three populations of Propylea quatuordecimpunctata (Coleoptera: Coccinellidae). Biol. Control 1993, 3, 27–33. [Google Scholar] [CrossRef]
- Kalushkov, P.; Hodek, I. The effect of six species of aphids on some life history parameters of the ladybird Propylea quatuordecimpunctata (Coleoptera: Coccinellidae). Eur. J. Entomol. 2005, 102, 449–452. [Google Scholar] [CrossRef] [Green Version]
- Papanikolaou, N.E.; Martinou, A.F.; Kontodimas, D.C.; Matsinos, Y.G.; Milonas, P.G. Functional responses of immature stages of Propylea quatuordecimpunctata (Coleoptera: Coccinellidae) to Aphis fabae (Hemiptera: Aphididae). Eur. J. Entomol. 2011, 108, 391–395. [Google Scholar] [CrossRef] [Green Version]
- Kontodimas, D.C.; Milonas, P.G.; Stathas, G.J.; Papanikolaou, N.E.; Skourti, A.; Matsinos, Y.G. Life table parameters of the aphid predators Coccinella septempunctata, Ceratomegilla undecimnotata and Propylea quatuordecimpunctata (Coleoptera: Coccinellidae). Eur. J. Entomol. 2008, 105, 427–430. [Google Scholar] [CrossRef] [Green Version]
- Pervez, A.; Omkar. Ecology of aphidophagous ladybird Propylea species: A review. J. Asia-Pac. Entomol. 2011, 14, 357–365. [Google Scholar] [CrossRef]
- Lu, Y.H.; Wu, K.M.; Jiang, Y.Y.; Guo, Y.Y.; Desneux, N. Widespread adoption of Bt cotton and insecticide decrease promotes biocontrol services. Nature 2012, 487, 362–365. [Google Scholar] [CrossRef]
- Papanikolaou, N.E.; Milonas, P.G.; Kontodimas, D.C.; Demiris, N.; Matsinos, Y.G. Temperature-dependent development, survival, longevity, and fecundity of Propylea quatuordecimpunctata (Coleoptera: Coccinellidae). Ann. Entomol. Soc. Am. 2013, 106, 228–234. [Google Scholar] [CrossRef] [Green Version]
- Yang, Q.; Liu, J.P.; Wyckhuys, K.A.G.; Yang, Y.Z.; Lu, Y.H. Impact of heat stress on the predatory ladybugs Hippodamia variegata and Propylaea quatuordecimpunctata. Insects 2022, 13, 306. [Google Scholar] [CrossRef]
- Ren, S.X.; Wang, X.M.; Pang, H.; Peng, Z.Q.; Zeng, T. Colored Pictorial Handbook of Ladybird Beetles in China; Science Press: Beijing, China, 2009. [Google Scholar]
- Li, G.Y. Cotton Diseases and Pests in Xinjiang, 1st ed.; China Agricultural Press: Beijing, China, 2017; Volume 4, p. 168. [Google Scholar]
- Gambino, G.; Perrone, I.; Gribaudo, I. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 2008, 19, 520–525. [Google Scholar] [CrossRef]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.D. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pertea, G.; Huang, X.Q.; Liang, F.; Antonescu, V.; Sultana, R.; Karamycheva, S.; Lee, Y.; White, J.; Cheung, F.; Parvizi, B.; et al. TIGR Gene Indices clustering tools (TGICL): A software system for fast clustering of large EST datasets. Bioinformatics 2003, 19, 651–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.X.; Liu, T.H.; Khashaveh, A.; Yi, C.Q.; Liu, X.X.; Zhang, Y.J. Identification and evaluation of suitable reference genes for RT-qPCR analysis in Hippodamia variegata (Coleoptera: Coccinellidae) under different biotic and abiotic conditions. Front. Physiol. 2021, 12, 669510. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101. [Google Scholar] [CrossRef]
- Abram, P.K.; Boivin, G.; Moiroux, J.; Brodeur, J. Behavioural effects of temperature on ectothermic animals: Unifying thermal physiology and behavioural plasticity. Biol. Rev. 2017, 92, 1859–1876. [Google Scholar] [CrossRef]
- Hensen, M.C.; Hernandez, M.I.M.; da Silva, P.G.; Amore, V.; Lobo, J.M. Distribution of Canthon rutilans rutilans and Canthon rutilans cyanescens along spatio-temporal and temperature gradients. Insects 2018, 9, 124. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Huang, L.F.; Wang, W.L.; Chen, E.H.; Chen, H.S.; Jiang, J.J. Effects of temperature on growth and development of the brown planthopper, Nilaparvata lugens (Homoptera: Delphacidae). Environ. Entomol. 2021, 50, 1–11. [Google Scholar] [CrossRef]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Quan, N.; Palfreyman, R.W.; Chan, L.C.L.; Steven, R.; Nielsen, L.K. Transcriptome sequencing of and microarray development for a Helicoverpa zea cell line to investigate in vitro insect cell–baculovirus interactions. PLoS ONE 2012, 7, e36324. [Google Scholar]
- Qin, J.M.; Luo, S.D.; He, S.Y.; Wu, J. Researching in characters and functions of trehalose and trehalase in insects. J. Environ. Entomol. 2015, 37, 163–169. [Google Scholar]
- Liu, Q.N.; Zhu, B.J.; Dai, L.S.; Fu, W.W.; Lin, K.Z.; Liu, C.L. Overexpression of small heat shock protein 21 protects the Chinese oak silkworm Antheraea pernyi against thermal stress. J. Insect Physiol. 2013, 59, 848–854. [Google Scholar] [CrossRef]
- Bühler, A.; Lanzrein, B.; Wille, H. Influence of temperature and carbon dioxide concentration on juvenile hormone titre and dependent parameters of adult worker honey bees (Apis mellifera L.). J. Insect Physiol. 1983, 29, 885–893. [Google Scholar] [CrossRef]
- Claudianos, C.; Ranson, H.; Johnson, R.M.; Biswas, S.; Schuler, M.A.; Berenbaum, M.R.; Feyereisen, R.; Oakeshott, J.G. A deficit of detoxification enzymes: Pesticide sensitivity and environmental response in the honeybee. Insect Mol. Biol. 2006, 15, 615–636. [Google Scholar] [CrossRef] [Green Version]
- Green, D.R.; Reed, J.C. Mitochondria and apoptosis. Science 1998, 281, 1309–1312. [Google Scholar] [CrossRef]
- Wang, Y.C.; Chang, Y.W.; Bai, J.; Zhang, X.X.; Iqbal, J.; Lu, M.X.; Hu, J.; Du, Y.Z. High temperature stress induces expression of CYP450 genes and contributes to insecticide tolerance in Liriomyza trifolii. Pestic. Biochem. Phys. 2021, 174, 104826. [Google Scholar] [CrossRef] [PubMed]
- Carranco, R.; Almoguera, C.; Jordano, J. A plant small heat shock protein gene expressed during zygotic embryogenesis but noninducible by heat stress. J. Biol. Chem. 1997, 272, 27470–27475. [Google Scholar] [CrossRef] [Green Version]
- Gu, L.L.; Li, M.Z.; Wang, G.R.; Liu, X.D. Multigenerational heat acclimation increases thermal tolerance and expression levels of Hsp70 and Hsp90 in the rice leaf folder larvae. J. Therm. Biol. 2019, 81, 103–109. [Google Scholar] [CrossRef]
- Zhou, C.; Yang, X.B.; Yang, H.; Long, G.Y.; Wang, Z.; Jin, D.C. Effects of abiotic stress on the expression of Hsp70 genes in Sogatella furcifera (Horvath). Cell Stress Chaperones 2020, 25, 119–131. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.; Liu, X.N.; Lu, M.X.; Du, Y.Z. Transcriptional profiling of MED Bemisia tabaci exposed to thermal stress and verification of HSP70 expression. Entomol. Res. 2021, 51, 251–262. [Google Scholar] [CrossRef]
- Jin, J.S.; Zhao, M.; Wang, Y.; Zhou, Z.S. Induced thermotolerance and expression of three key Hsp genes (Hsp70, Hsp21, and sHsp21) and their roles in the high temperature tolerance of Agasicles hygrophila. Front. Physiol. 2020, 10, 1593. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.Y.; Liu, Y.L.; Guo, X.L.; Li, Y.L.; Gao, H.R.; Guo, X.Q.; Xu, B.H. sHsp22.6, an intronless small heat shock protein gene, is involved in stress defense and development in Apis cerana cerana. Insect Biochem. Mol. 2014, 53, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Zhu, K.Y.; Palli, S.R. Mechanisms, applications, and challenges of insect RNA interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.X.; Li, Y.; Zheng, X.F.; Guo, H.W. Modern Molecular Biology, 5th ed.; Higher Education Press: Beijing, China, 2019. [Google Scholar]
- Nelson, D.L.; Cox, M.M. Lehninger Principles of Biochemistry, 7th ed.; W. H. Freeman and Company: New York, NY, USA, 2017. [Google Scholar]





| Gene | Left Primer (5′–3′) | Right Primer (5′–3′) | E | R2 |
|---|---|---|---|---|
| P450-01 | ACCCAGAATTGCTCAGAACCT | TGGATCTTTGGTGTTGGGCA | 1.9210 | 99.35% |
| P450-02 | AGTCATTGTTACTGCAGGCCA | ACGTGCAGAAGAGGCTTCAA | 2.0330 | 99.95% |
| P450-03 | CAGTTGGTGGACGATGACGA | GTCTCAAACCCAGCCTCGAA | 1.9168 | 99.69% |
| P450-04 | ATGAAGTTGTCGCCCAAGCT | TGTCTTCGTTTGCAGCACAC | 2.0464 | 99.84% |
| P450-05 | AGTGGGCAGTCGTCTTCATG | AATGGTGGCCTCGGTTACAG | 1.9914 | 99.61% |
| P450-06 | CGTTGTGGGCTATGCAATCG | AACACTGGAAGGACATGCGT | 1.9745 | 99.73% |
| P450-07 | TACGTACCATTCAGTGCCGG | TCCACCGGTTCGAGGGTATA | 2.0112 | 99.91% |
| P450-08 | GCCGTTCTTTGCCCTCAAAA | CAACGGTTTGCAATGCTGGA | 1.9404 | 99.90% |
| P450-09 | TTTTGACGCCTGCTTTCCAC | TCTGGTCTCCCTTTTCTGCC | 1.9166 | 99.54% |
| P450-10 | TACCCATTGCAGTCTCGCAG | AAAAGTGGCACGAGAGGAGG | 1.9318 | 99.77% |
| P450-11 | CTTGGCTCCGAAATTGGTGC | CCGCTCCCTCATCATCTTCC | 1.9753 | 99.95% |
| Hsp70 | CTGCGGTCTCAATTCCCAGT | AACCCAGACGAAGCAGTAGC | 1.9345 | 99.83% |
| EF1α | AGCCAACATTACCACTGA | GTATCCACGACGCAATTC | 1.9966 | 99.43% |
| ID | Raw Reads | Clean Reads | Error Rate | Q20 | Q30 | GC Content |
|---|---|---|---|---|---|---|
| 32 °C-1 | 25,235,610 | 24,026,561 | 0.02% | 98.17% | 94.72% | 39.42% |
| 32 °C-2 | 24,910,423 | 23,518,017 | 0.02% | 98.09% | 94.58% | 39.94% |
| 32 °C-3 | 24,097,717 | 22,845,954 | 0.02% | 97.96% | 94.36% | 39.61% |
| 35 °C-1 | 20,599,841 | 19,503,434 | 0.03% | 97.89% | 94.15% | 39.55% |
| 35 °C-2 | 21,320,532 | 20,101,279 | 0.03% | 97.83% | 94.09% | 40.18% |
| 35 °C-3 | 25,480,195 | 23,663,296 | 0.03% | 97.94% | 94.31% | 40.31% |
| 38 °C-1 | 24,799,340 | 23,308,522 | 0.02% | 98.04% | 94.51% | 40.16% |
| 38 °C-2 | 24,572,507 | 23,104,949 | 0.03% | 97.88% | 93.91% | 40.23% |
| 38 °C-3 | 25,639,042 | 24,214,786 | 0.02% | 98.10% | 94.62% | 40.29% |
| Database | Number of Annotations | Percentage (%) |
|---|---|---|
| Annotated in NR | 24,304 | 32.86 |
| Annotated in NT | 9604 | 12.98 |
| Annotated in KO | 2293 | 3.10 |
| Annotated in SwissProt | 14,643 | 19.80 |
| Annotated in Pfam | 21,620 | 29.23 |
| Annotated in GO | 9926 | 13.42 |
| Annotated in KOG | 13,490 | 18.24 |
| Annotated in all Databases | 741 | 1.00 |
| Annotated in at least one Database | 31,199 | 42.18 |
| Total Unigenes | 73,966 | 100 |
| Gene ID | Temperature (FPKM Value) | F2,6 | p | ||
|---|---|---|---|---|---|
| 32 °C | 35 °C | 38 °C | |||
| cytochrome P450 (P450-01) | 0.92 ± 0.05 | 2.32 ± 0.20 | 4.32 ± 0.08 | 195.72 | <0.001 |
| cytochrome P450 (P450-02) | 3.53 ± 0.50 | 12.62 ± 1.77 | 22.45 ± 1.65 | 62.96 | <0.001 |
| cytochrome P450 (P450-03) | 2.15 ± 0.24 | 2.17 ± 0.12 | 6.99 ± 0.07 | 331.16 | <0.001 |
| cytochrome P450 (P450-04) | 0.65 ± 0.10 | 0.74 ± 0.07 | 1.25 ± 0.05 | 22.95 | 0.002 |
| cytochrome P450 (P450-05) | 0.77 ± 0.18 | 1.93 ± 0.39 | 8.56 ± 0.43 | 178.20 | <0.001 |
| cytochrome P450 (P450-06) | 1.83 ± 0.09 | 1.87 ± 0.13 | 4.53 ± 0.49 | 31.28 | 0.001 |
| cytochrome P450 (P450-07) | 1.43 ± 0.36 | 1.43 ± 0.10 | 14.35 ± 0.24 | 1267.51 | <0.001 |
| cytochrome P450 (P450-08) | 1.82 ± 0.08 | 1.86 ± 0.09 | 7.93 ± 0.72 | 1495.79 | <0.001 |
| cytochrome P450 (P450-09) | 1.23 ± 0.13 | 1.22 ± 0.10 | 2.08 ± 0.21 | 25.89 | 0.002 |
| cytochrome P450 (P450-10) | 0.42 ± 0.05 | 0.45 ± 0.01 | 1.45 ± 0.14 | 174.71 | <0.001 |
| cytochrome P450 (P450-11) | 0.57 ± 0.05 | 0.60 ± 0.07 | 1.41 ± 0.19 | 28.15 | 0.001 |
| Heat shock protein 70 (Hsp 70) | 2.40 ± 0.34 | 7.17 ± 0.59 | 7.19 ± 0.18 | 51.51 | <0.001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Q.; Liu, J.; Yang, Y.; Lu, Y. Transcriptome Analysis of Propylaea quatuordecimpunctata L. (Coleoptera: Coccinellidae) under High Temperature Stress. Agriculture 2022, 12, 1088. https://doi.org/10.3390/agriculture12081088
Yang Q, Liu J, Yang Y, Lu Y. Transcriptome Analysis of Propylaea quatuordecimpunctata L. (Coleoptera: Coccinellidae) under High Temperature Stress. Agriculture. 2022; 12(8):1088. https://doi.org/10.3390/agriculture12081088
Chicago/Turabian StyleYang, Qing, Jinping Liu, Yizhong Yang, and Yanhui Lu. 2022. "Transcriptome Analysis of Propylaea quatuordecimpunctata L. (Coleoptera: Coccinellidae) under High Temperature Stress" Agriculture 12, no. 8: 1088. https://doi.org/10.3390/agriculture12081088
APA StyleYang, Q., Liu, J., Yang, Y., & Lu, Y. (2022). Transcriptome Analysis of Propylaea quatuordecimpunctata L. (Coleoptera: Coccinellidae) under High Temperature Stress. Agriculture, 12(8), 1088. https://doi.org/10.3390/agriculture12081088

