Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Identification of Molecular Markers Linked to Lr63
2.3. Chromosome Preparation
2.4. DNA Molecular Probes
2.5. DNA Molecular Probes
3. Results
3.1. Intraspecific Polymorphism of Chromosome Markers
3.2. Polymorphism of Lr63 Loci
3.3. Rearrangements of Short Arm of 3A Chromosome
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Harlan, J.R.; de Wet, J.M.J. Toward a Rational Classification of Cultivated Plants. TAXON 1971, 20, 509–517. [Google Scholar] [CrossRef]
- Dempewolf, H.; Baute, G.; Anderson, J.; Kilian, B.; Smith, C.; Guarino, L. Past and Future Use of Wild Relatives in Crop Breeding. Crop Sci. 2017, 57, 1070–1082. [Google Scholar] [CrossRef]
- Feldman, M.; Levy, A.A. Origin and Evolution of Wheat and Related Triticeae Species. In Alien Introgression in Wheat; Molnár-Láng, M., Ceoloni, C., Doležel, J., Eds.; Springer International Publishing: Cham, Switzerland, 2015; pp. 21–76. ISBN 978-3-319-23493-9. [Google Scholar]
- Badaeva, E.D.; Amosova, A.V.; Goncharov, N.P.; Macas, J.; Ruban, A.S.; Grechishnikova, I.V.; Zoshchuk, S.A.; Houben, A. A Set of Cytogenetic Markers Allows the Precise Identification of All A-Genome Chromosomes in Diploid and Polyploid Wheat. Cytogenet Genome Res. 2015, 146, 71–79. [Google Scholar] [CrossRef]
- Prasad, P.; Savadi, S.; Bhardwaj, S.C.; Gupta, P.K. The Progress of Leaf Rust Research in Wheat. Fungal Biol. 2020, 124, 537–550. [Google Scholar] [CrossRef] [PubMed]
- McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Xia, X.C. Catalogue of Gene Symbols For Wheat: 2017 Supplement. 20. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/macgene/supplement2017.pdf (accessed on 30 March 2022).
- Kolmer, J.A.; Anderson, J.A.; Flor, J.M. Chromosome Location, Linkage with Simple Sequence Repeat Markers, and Leaf Rust Resistance Conditioned by Gene Lr63 in Wheat. Crop Sci. 2010, 50, 2392–2395. [Google Scholar] [CrossRef] [Green Version]
- Childe, V.G. The Origin of Neolithic Culture in Northern Europe. Antiquity 1949, 23, 129–135. [Google Scholar] [CrossRef]
- Diamond, J. Evolution, Consequences and Future of Plant and Animal Domestication. Nature 2002, 418, 700–707. [Google Scholar] [CrossRef]
- Diamond, J.; Bellwood, P. Farmers and Their Languages: The First Expansions. Science 2003, 300, 597–603. [Google Scholar] [CrossRef]
- Skoglund, P.; Malmström, H.; Raghavan, M.; Storå, J.; Hall, P.; Willerslev, E.; Gilbert, M.T.P.; Götherström, A.; Jakobsson, M. Origins and Genetic Legacy of Neolithic Farmers and Hunter-Gatherers in Europe. Science 2012, 336, 466–469. [Google Scholar] [CrossRef]
- Meyer, R.S.; DuVal, A.E.; Jensen, H.R. Patterns and Processes in Crop Domestication: An Historical Review and Quantitative Analysis of 203 Global Food Crops. New Phytol. 2012, 196, 29–48. [Google Scholar] [CrossRef]
- Beissinger, T.M.; Wang, L.; Crosby, K.; Durvasula, A.; Hufford, M.B.; Ross-Ibarra, J. Recent Demography Drives Changes in Linked Selection across the Maize Genome. Nat. Plants 2016, 2, 16084. [Google Scholar] [CrossRef] [PubMed]
- Kantar, M.B.; Nashoba, A.R.; Anderson, J.E.; Blackman, B.K.; Rieseberg, L.H. The Genetics and Genomics of Plant Domestication. BioScience 2017, 67, 971–982. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Koo, D.-H.; Li, Y.; Zhang, X.; Luan, F.; Havey, M.J.; Jiang, J.; Weng, Y. Chromosome Rearrangements during Domestication of Cucumber as Revealed by High-Density Genetic Mapping and Draft Genome Assembly. Plant. J. 2012, 71, 895–906. [Google Scholar] [CrossRef] [PubMed]
- Chia, J.-M.; Song, C.; Bradbury, P.J.; Costich, D.; de Leon, N.; Doebley, J.; Elshire, R.J.; Gaut, B.; Geller, L.; Glaubitz, J.C.; et al. Maize HapMap2 Identifies Extant Variation from a Genome in Flux. Nat. Genet. 2012, 44, 803–807. [Google Scholar] [CrossRef]
- Wang, Y.; Xiong, G.; Hu, J.; Jiang, L.; Yu, H.; Xu, J.; Fang, Y.; Zeng, L.; Xu, E.; Xu, J.; et al. Copy Number Variation at the GL7 Locus Contributes to Grain Size Diversity in Rice. Nat. Genet. 2015, 47, 944–948. [Google Scholar] [CrossRef]
- Kilian, B.; Ozkan, H.; Walther, A.; Kohl, J.; Dagan, T.; Salamini, F.; Martin, W. Molecular Diversity at 18 Loci in 321 Wild and 92 Domesticate Lines Reveal No Reduction of Nucleotide Diversity during Triticum Monococcum (Einkorn) Domestication: Implications for the Origin of Agriculture. Mol. Biol. Evol. 2007, 24, 2657–2668. [Google Scholar] [CrossRef] [Green Version]
- Heun, M.; Schäfer-Pregl, R.; Klawan, D.; Castagna, R.; Accerbi, M.; Borghi, B.; Salamini, F. Site of Einkorn Wheat Domestication Identified by DNA Fingerprinting. Science 1997, 278, 1312–1314. [Google Scholar] [CrossRef] [Green Version]
- Zaharieva, M.; Monneveux, P. Cultivated Einkorn Wheat (Triticum Monococcum L. Subsp. Monococcum): The Long Life of a Founder Crop of Agriculture. Genet. Resour. Crop Evol. 2014, 61, 677–706. [Google Scholar] [CrossRef]
- Nesbitt, M. From Staple Crop to Extinction? The Archaeology and History of Hulled Wheat. In Hulled Wheats. Promoting the Conservation and Use of Underutilized and Neglected Crops; IPRGI: Serdang, Malaysia, 1996; pp. 1–100. [Google Scholar]
- Nevo, E. Triticum. In Wild Crop Relatives: Genomic and Breeding Resources; Kole, C., Ed.; Springer: Berlin/Heidelberg, Germany, 2011; pp. 407–456. ISBN 978-3-642-14227-7. [Google Scholar]
- Filatenko, A.; Hammer, K. New Descriptions of Hulled Wheats on the Infraspecific Level. Genet. Resour. Crop Evol. 1997, 44, 285–288. [Google Scholar] [CrossRef]
- Gill, B.S.; Friebe, B. Plant Cytogenetics at the Dawn of the 21st Century. Curr. Opin. Plant. Biol. 1998, 1, 109–115. [Google Scholar] [CrossRef]
- Pedersen, C.; Langridge, P. Identification of the Entire Chromosome Complement of Bread Wheat by Two-Colour FISH. Genome 1997, 40, 589–593. [Google Scholar] [CrossRef] [PubMed]
- Cuadrado, A.; Schwarzacher, T.; Jouve, N. Identification of Different Chromatin Classes in Wheat Using In Situ Hybridization with Simple Sequence Repeat Oligonucleotides. Theor. Appl. Genet. 2000, 101, 711–717. [Google Scholar] [CrossRef]
- Cuadrado, A.; Cardoso, M.; Jouve, N. Physical Organisation of Simple Sequence Repeats (SSRs) in Triticeae: Structural, Functional and Evolutionary Implications. Cytogenet Genome Res. 2008, 120, 210–219. [Google Scholar] [CrossRef] [PubMed]
- Megyeri, M.; Farkas, A.; Varga, M.; Kovács, G.; Molnár-Láng, M.; Molnár, I. Karyotypic Analysis of Triticum Monococcum Using Standard Repetitive DNA Probes and Simple Sequence Repeats. Acta Agron. Hung. 2012, 60, 87–95. [Google Scholar] [CrossRef]
- Komuro, S.; Endo, R.; Shikata, K.; Kato, A. Genomic and Chromosomal Distribution Patterns of Various Repeated DNA Sequences in Wheat Revealed by a Fluorescence In Situ Hybridization Procedure. Genome 2013, 56, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Kwiatek, M.; Majka, M.; Majka, J.; Belter, J.; Suchowilska, E.; Wachowska, U.; Wiwart, M.; Wiśniewska, H. Intraspecific Polymorphisms of Cytogenetic Markers Mapped on Chromosomes of Triticum Polonicum L. PLoS ONE 2016, 11, e0158883. [Google Scholar] [CrossRef] [Green Version]
- Goriewa-Duba, K.; Duba, A.; Kwiatek, M.; Wiśniewska, H.; Wachowska, U.; Wiwart, M. Correction: Chromosomal Distribution of PTa-535, PTa-86, PTa-713, 35S RDNA Repetitive Sequences in Interspecific Hexaploid Hybrids of Common Wheat (Triticum Aestivum L.) and Spelt (Triticum Spelta L.). PLoS ONE 2018, 13, e0203162. [Google Scholar] [CrossRef]
- Venske, E.; Schreinert dos Santos, R.; Busanello, C.; Gustafson, P.; Costa de Oliveira, A. Bread Wheat: A Role Model for Plant Domestication and Breeding. Hereditas 2019, 156, 16. [Google Scholar] [CrossRef] [Green Version]
- Feuillet, C.; Travella, S.; Stein, N.; Albar, L.; Nublat, A.; Keller, B. Map-Based Isolation of the Leaf Rust Disease Resistance Gene Lr10 from the Hexaploid Wheat (Triticum Aestivum L.) Genome. Proc. Natl. Acad. Sci. USA 2003, 100, 15253–15258. [Google Scholar] [CrossRef] [Green Version]
- Loutre, C.; Wicker, T.; Travella, S.; Galli, P.; Scofield, S.; Fahima, T.; Feuillet, C.; Keller, B. Two different CC-NBS-LRR genes are required for Lr10-mediated leaf rust resistance in tetraploid and hexaploid wheat. Plant J. 2009, 60, 1043–1054. [Google Scholar] [CrossRef] [Green Version]
- Tian, D.; Traw, M.B.; Chen, J.Q.; Kreitman, M.; Bergelson, J. Fitness costs of R-gene-mediated resistance in Arabidopsis thaliana. Nature 2003, 423, 74–77. [Google Scholar] [CrossRef] [PubMed]
- Muehlbauer, G.J.; Feuillet, C. (Eds.) Genetics and Genomics of the Triticeae; Springer: New York, NY, USA, 2009; ISBN 978-0-387-77488-6. [Google Scholar]
- Zhang, L.; Wang, S.; Li, H.; Deng, Q.; Zheng, A.; Li, S.; Li, P.; Li, Z.; Wang, J. Effects of Missing Marker and Segregation Distortion on QTL Mapping in F2 Populations. Appl. Genet. 2010, 121, 1071–1082. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, S.; Abe, F.; Kawahigashi, H.; Nakazono, K.; Tagiri, A.; Matsumoto, T.; Utsugi, S.; Ogawa, T.; Handa, H.; Ishida, H.; et al. A Wheat Homolog of Mother of FT and TFL1 Acts in the Regulation of Germination. Plant. Cell. 2011, 23, 3215–3229. [Google Scholar] [CrossRef] [Green Version]
- Vaughan, D.A.; Balázs, E.; Heslop-Harrison, J.S. From Crop Domestication to Super-Domestication. Ann. Bot. 2007, 100, 893–901. [Google Scholar] [CrossRef]
- Gao, L.; Zhao, G.; Huang, D.; Jia, J. Candidate Loci Involved in Domestication and Improvement Detected by a Published 90K Wheat SNP Array. Sci. Rep. 2017, 7, 44530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramírez-González, R.H.; Borrill, P.; Lang, D.; Harrington, S.A.; Brinton, J.; Venturini, L.; Davey, M.; Jacobs, J.; van Ex, F.; Pasha, A.; et al. The Transcriptional Landscape of Polyploid Wheat. Science 2018, 361, eaar6089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bariah, I.; Keidar-Friedman, D.; Kashkush, K. Where the Wild Things Are: Transposable Elements as Drivers of Structural and Functional Variations in the Wheat Genome. Front. Plant Sci. 2020, 11, 585515. [Google Scholar] [CrossRef]
- Mascagni, F.; Barghini, E.; Giordani, T.; Rieseberg, L.H.; Cavallini, A.; Natali, L. Repetitive DNA and Plant Domestication: Variation in Copy Number and Proximity to Genes of LTR-Retrotransposons among Wild and Cultivated Sunflower (Helianthus Annuus) Genotypes. Genome Biol. Evol. 2015, 7, 3368–3382. [Google Scholar] [CrossRef] [Green Version]
- Ebrahimzadegan, R.; Orooji, F.; Ma, P.; Mirzaghaderi, G. Differentially Amplified Repetitive Sequences Among Aegilops Tauschii Subspecies and Genotypes. Front. Plant Sci. 2021, 12, 716750. [Google Scholar] [CrossRef]
- Anker, C.C.; Niks, R.E. Prehaustorial Resistance to the Wheat Leaf Rust Fungus, Puccinia Triticina, in Triticum Monococcum. Euphytica 2001, 117, 209–215. [Google Scholar] [CrossRef]



| No. | Plant ID | Cultivar | Species | Origin | Xbarc321 | Xbarc57 |
|---|---|---|---|---|---|---|
| 1. | GSTR 444 | Lr63 | Triticum aestivum subsp. aestivum | Canada | + | + |
| 2. | CLTR17667 | - | Triticum urartu | Turkey | - | + |
| 3. | PI428316 | G3220 | Triticum urartu | Iran | - | + |
| 4. | PI225164 | Kaploutras | Triticum monococcum subsp. monococcum | Greece | + | - |
| 5. | PI428011 | G3224 | Triticum monococcum subsp. aegilopoides | Azerbaijan | + | + |
| 6. | PI554513 | 84TK154-028.00 | Triticum monococcum subsp. aegilopoides | Soviet Union | + | - |
| 7. | PI668147 | Kromeriz | Triticum monococcum subsp. monococcum | Former Czechoslovakia | + | + |
| 8. | PI277130 | A TRI 613/59 | Triticum monococcum subsp. monococcum | Albania | + | + |
| 9. | PI614649 | UKR-99-075 | Triticum monococcum subsp. aegilopoides | Ukraine | + | - |
| 10. | PI290508 | V.J. 388 | Triticum monococcum subsp. monococcum | Hungary | + | + |
| 11. | PI662221 | GR05-052 | Triticum monococcum subsp. aegilopoides | Greece | + | - |
| 12. | PI307984 | K930 | Triticum monococcum subsp. monococcum | Morocco | - | + |
| 13. | CLTR17664 | - | Triticum urartu | Lebanon | - | - |
| 14. | PI170196 | 2498 | Triticum monococcum subsp. monococcum | Turkey | + | + |
| 15. | PI326317 | WIR 18140 | Triticum monococcum subsp. monococcum | Azerbaijan | + | + |
| 16. | PI591871 | SN-264 | Triticum monococcum subsp. monococcum | Georgia | + | + |
| 17. | PI487265 | SY 20033 | Triticum urartu | Syria | - | + |
| Clone | NCBI GenBank Sequence Number | Primer Sequences (5′ to 3′) | Annealing Temperature (°C) |
|---|---|---|---|
| pTa-86 | KC290896 | ACGATTGACCAATCTCGGGG ACCGACCCAAATTACGAGAGT | 58.5 |
| pTa-535 | KC290894 | GCATAGCATGTGCGAAAGAG TCGTCCGAAACCCTGATAC | 59 |
| pTa-535 | KC290894 | GGGGCGGACGTCGTTG CCGTAAGATAGACAGGGTGGG | 59 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Noweiska, A.; Bobrowska, R.; Kwiatek, M.T. Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats. Agriculture 2022, 12, 966. https://doi.org/10.3390/agriculture12070966
Noweiska A, Bobrowska R, Kwiatek MT. Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats. Agriculture. 2022; 12(7):966. https://doi.org/10.3390/agriculture12070966
Chicago/Turabian StyleNoweiska, Aleksandra, Roksana Bobrowska, and Michał Tomasz Kwiatek. 2022. "Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats" Agriculture 12, no. 7: 966. https://doi.org/10.3390/agriculture12070966
APA StyleNoweiska, A., Bobrowska, R., & Kwiatek, M. T. (2022). Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats. Agriculture, 12(7), 966. https://doi.org/10.3390/agriculture12070966

