Next Article in Journal
Classification of Maize Lodging Extents Using Deep Learning Algorithms by UAV-Based RGB and Multispectral Images
Next Article in Special Issue
The Hunt for Mungbean (Vigna radiata (L.) Wilczek) Genotypes and Breeding Lines Resistance to South Indian Bruchid Strain
Previous Article in Journal
Enhancing Zinc Biofortification of Wheat through Integration of Zinc, Compost, and Zinc-Solubilizing Bacteria
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats

by
Aleksandra Noweiska
,
Roksana Bobrowska
and
Michał Tomasz Kwiatek
*
Department of Genetics and Plant Breeding, Faculty of Agronomy, Horticulture and Bioengineering, Poznań University of Life Sciences, 11 Dojazd Str., 60-632 Poznań, Poland
*
Author to whom correspondence should be addressed.
Agriculture 2022, 12(7), 966; https://doi.org/10.3390/agriculture12070966
Submission received: 9 June 2022 / Revised: 29 June 2022 / Accepted: 2 July 2022 / Published: 5 July 2022
(This article belongs to the Special Issue Germplasm Resources Exploration and Genetic Breeding of Crops)

Abstract

:
Wheat is one of the world’s crucial staple food crops. In turn, einkorn wheat (Triticum monococcum L.) is considered a wild relative of wheat (Triticum aestivum L.) and can be used as a source of agronomically important genes for breeding purposes. Cultivated T. monococcum subsp. monococcum originated from T. monococcum subsp. aegilopoides (syn. T. boeticum). For the better utilization of valuable genes from these species, it is crucial to discern the genetic diversity at their cytological and molecular levels. Here, we used a fluorescence in situ hybridization toolbox and molecular markers linked to the leaf rust resistance gene Lr63 (located on the short arm of the 3Am chromosome—3AmS) to track the polymorphisms between T. monococcum subsp. monococcum, T. boeticum and T. urartu (A-genome donor for hexaploid wheat) accessions, which were collected in different regions of Europe, Asia, and Africa. We distinguished three groups of accessions based on polymorphisms of cytomolecular and leaf rust resistance gene Lr63 markers. We observed that the cultivated forms of T. monococcum revealed additional marker signals, which are characteristic for genomic alternations induced by the domestication process. Based on the structural analysis of the 3AmS chromosome arm, we concluded that the polymorphisms were induced by geographical dispersion and could be related to adaptation to local environmental conditions.

1. Introduction

Crop wild relatives (CWRs) are considered wild species that have sufficient levels of interfertility with other crops [1]. CWRs carry many beneficial traits for breeding, especially those, which have been lost during domestication and breeding selection, as well as novel adaptive alleles that can enhance crop diversity and productivity [2]. Initially, the classification for CWRs was established through the empirical crossing that resulted in four major germplasm categories: primary (no crossing barriers), secondary (benign crossing barriers), tertiary (requires special methods to obtain hybrid organisms, such as embryo rescue), and quaternary (genetic engineering technics are necessary to be performed) [1]. Triticum monococcum L. (2n = 2x = 14 chromosomes; AmAm) is closely related to Triticum urartu Thumanjan ex Gandilyan (2n = 2x = 14; AuAu), which has been reported as one of the primary gene pool ancestors of hexaploid wheat (Triticum aestivum L.; 2n = 6x = 42; BBAADD) from which the A-genome originated [3]. T. monococcum presents a high genetic variability, making it a significant gene pool for other species. Due to its close affinity to common wheat, it has been reported as a source of valuable genes, i.e., disease resistance genes, including leaf rust resistance genes [4]. Leaf rust (Lr) is a fungal disease caused by Puccinia triticina Eriksson. It is the most widespread of the wheat rust diseases, which occurs in almost all growing areas and limits wheat production worldwide. The disease can take the form of an epidemic, which can lead to severe economic losses [5]. Until now, over 80 Lr resistance genes have been identified within the Triticeae tribe [6]. Some of these genes have been used to develop resistance to leaf rust in wheat varieties [5], including the Lr63 gene, which is located on a short arm of chromosome 3Am (3AmS) of T. monococcum. It is the only mapped leaf rust resistance gene on the distal part of chromosome 3AmS, and is linked with microsatellites locus Xbarc321 and Xbarc57 markers (2.9 cM) [7].
Crop domestication is a process inseparably linked to the transition from hunter–gatherer societies to settled agriculture (the ‘Neolithic revolution’; [8]), which independently appeared over a dozen times in various regions around the world from 10,000 to 12,000 years ago (ya) ca., to as recently as 3000–4000 ya [9,10,11]. This process can be called a conscious artificial selection of plants used in order to enhance their relevance to human demands, such as flavor, harvest, preservation, and methods of breeding. However, this process has been reported to be unconscious as well [12]. It is claimed that the factors which are responsible for early domestication include (1) the relocation of plants to new environmental niches, (2) human migration, and (3) genetic and genomic alternations, which are specific to selection [12]. Demographic effects often associated with domestication resulted in conspicuous impacts on genomic architecture, such as reductions in ineffective population sizes, reductions in diversity, and changes in the mating system, as well as targeted selection of specific traits [13,14]. There are also a number of reports showing evidence of large-scale chromosomal structural changes [15], changes in repetitive sequence content [16], and changes in gene variations and their copy numbers [17]. Cultivated T. monococcum L. subsp. monococcum originated from T. boeticum (syn. T. monococcum subsp. aegilopoides), which was widespread in southern Europe and western Asia. Even before domestication, T. boeticum was divided by the strong genetic differentiation into three races: race α, race β, and race γ [18]. However, only one race (β) has been exploited by mankind [18]. Precisely, wild T. boeticum was domesticated in the Karacadag mountains in southeast Turkey [19] and spread to several locations of the Fertile Crescent as the first cultivated wheat, called einkorn (T. monococcum L. subsp. monococcum) (Kilian et al. 2007). The common name was derived from the German “Einkorn”, which means ‘single grain’, and relates to the occurrence of only a single grain per spikelet [20]. However, the name einkorn is used sometimes for both the wild (subsp. aegilopoides) and the cultivated (subsp. monococcum) forms. This cereal was important in the early Neolithic agriculture, but now is extensively grown in western Turkey, the Balkans, Switzerland, Germany, Spain, and the Caucasus [21]. During the last 5000 years, einkorn was eradicated and replaced by tetra- and hexaploid wheat. What is interesting is that both T. monococcum and T. boeticum (T. monococcum subsp. aegilopoides) are reproductively isolated from wild T. urartu (a progenitor of the A-genome of hexaploid wheat) with interspecific hybrids being sterile, although the two wild forms have comparable morphologies [22]. Cultivated einkorn is represented by a broad genetic variation [20]. This taxon includes nearly twenty identified botanical varieties [23] and six ecogeographical groups. The geographical diversification of T. monococcum from the domestication area was well restored through grain remains discovered in archaeological excavations [18,20], and is an example of well-documented speciation in the background of time and location.
What is interesting is that T. monococcum, T. boeticum, and T. urartu are karyotypically similar and have similar Giemsa C-banding patterns [24]. However, it was reported that fluorescence in situ hybridization (FISH), which allows for the direct localization of DNA sequences on chromosomes, revealed a number of intra- and interspecific divergence within diploid species of wheat [4,25,26,27,28]. FISH in plants commonly involves the application of probes containing conservative high-copy sequences. One of them is the Afa-family DNA probe, which is one of the most useful ones for the chromosome identification of diploid A-genome wheats. The Afa-family probe allowed for the recognition of the majority of chromosomes of cultivated einkorn [28] and T. urartu [4]. Other repeat DNA families, which were isolated from the bread wheat genome, among others, include pTa-86, pTa-465, pTa-535, and pTa-713 [29,30,31] which can also provide informative labelling patterns for wheat chromosome discrimination. Among them, the probe pTa-535 was reported to generate the largest number of signals on the A-genome chromosomes, which are chromosome-specific. This clone is a 342 bp tandemly repeated DNA sequence, showing ~80% homology with the clone pTa-173, a member of the Afa-family [29].
In this study, we used molecular cytogenetics to analyze the karyotypes of T. monococcum accessions originating from different regions of eastern Europe, western Asia, and North Africa. Precisely, we analyzed the structural changes of the short arm of chromosome 3Am, which were probably induced by geographical dispersion and adaptation to local environmental conditions using cytomolecular tools and molecular markers linked to the Lr63 locus.

2. Materials and Methods

2.1. Plant Material

Sixteen diploid wheat genotypes (Table 1) collected from different geographical regions were used in this study. One hexaploid wheat (Triticum aestivum L. subsp. aestivum) `was the reference for the presence of locus Lr63 (GSTR 444). Chinese Spring (CS) wheat was used as a standard control and for molecular probe generation as well. All accessions were provided by the National Small Grain Collection located at the Agricultural Research Station in Aberdeen, WA, USA.

2.2. Identification of Molecular Markers Linked to Lr63

GeneMATRIX Plant and Fungi DNA Purification Kit was used to perform DNA isolation from the leaves of 10-day-old seedlings (EURx Ltd., Gdansk, Poland). DNA quality and concentration were measured using a DeNovix spectrophotometer (DeNovix Inc., Wilmington, DE, USA) at the spectral length of 260 and 280 nm. The samples were diluted with Tris buffer (EURx Ltd., Gdansk, Poland) to attain a concentration of 50 ng/µL. To identify gene Lr63, the molecular markers Xbarc57 and Xbarc321 [7] were used. PCR reaction was carried out in 25 µL volumes, consisting of the following: 1µL of two primers (Sigma); 12.5 µL FastGene® Optima HotStart ReadyMix (NIPPON Genetics, Europe GmbH, Düren, Germany), which included FastGene® Optima DNA Polymerase blend (0.2 U per μL reaction), FastGene® Optima Buffer (1X), dNTPs (0.4 mM of each dNTP at 1X), MgCl2 (4 mM at 1X), and stabilizers; 2 µL of DNA templates; and PCR-grade water. A PCR procedure was adjusted based on the standard protocol. The primer annealing temperatures of the marker primers were 52 °C for Xbarc321 and 60 °C for Xbarc57 [7]. The PCR final reaction included an initial denaturation at 94 °C for 5 min, followed by 35 cycles (denaturation, 94 °C for 45 s; primer annealing, 52 or 60 °C for 30s; elongation, 72 °C for 1 min), followed by the final extension for 7 min at 72 °C and storage at 4 °C. Polymerase chain reaction (PCR) was performed with the Labcycler thermocycler (SensoQuest GmbH, Göttingen, Germany). Amplification products were separated on 2% agarose gel (Bioshop, Canada Inc., Burlington, ON, Canada) in 1xTBE buffer (Bioshop, Canada Inc., Burlington, ON, Canada) for one and a half hours. Midori Green Advanced DNA Stain (Nippon Genetics Europe, Düren, Germany) was added to agarose gel. The UV Molecular Imager Gel Doc™ XR system with Biorad Bio Image™ software (Biorad, Berkeley, CA, USA) was used to visualize the amplification products.

2.3. Chromosome Preparation

Seeds were germinated in Petri dishes laid out with filter paper and flooded with water at room temperature (22 °C) for 4–6 days. After this time, root tips were cut off and stored in ice-cold water for 26 h. Fixation of the root tips was performed using ethanol and acetic acid (3:1, v/v). Mitotic preparations were created from root tips by digesting them with an enzyme mixture consisting of 20% (v/v) pectinase (Sigma), 1% (w/v) cellulose (Calbiochem), and 1% (w/v) cellulase ‘Onozuka R-10’ (Serva). By previously washing them with 0.01 M sodium citric buffer, slides were prepared according to the Kwiatek et al. [30] procedure.

2.4. DNA Molecular Probes

Genomic DNA from “CS” wheat was used to amplify the following repetitive sequences: pTa-86, pTa-535, and pTa-713, which were used as molecular probes (Table 2) [30]. According to Komuro et al. [30], two clones (pTa-535 and pTa-713) were determined to have especially valuable sequences for chromosome identification. In combination with pTa-86 (the pSc119 homologous sequence), these probes enabled the unambiguous discrimination of all wheat chromosomes, including orientation.
The PCR mixture contained 12.5 μL of TaqNovaHS Master Mix, 1 μL of forward/reverse primers, 2 μL of DNA, and 8.5 μL of nuclease-free water. PCR reactions were performed under conditions of 95 °C for 3 min, 34 cycles of 95 °C for 30 s, annealing temperature at 59 °C for 30 s, 72 °C for 60 s, and 72 °C for 5 min. Labeling of molecular probes was performed using the nick translation method using the Nick Translation Kit (Roche/Merck). The pTa-535 sequence was labeled with tetramethyl-5-dUTP-rhodamine (Roche), whereas pTa-713 was labeled with digoxigenin-11-dUTP (Roche), and pTa-86 was labeled with Atto647 (Jena Bioscience, Jena, Germany).

2.5. DNA Molecular Probes

According to Kwiatek et al. [30], FISH was carried out with modifications. The repeat sequences of pTa-86, pTa-535, and pTa-713 were used as molecular probes. The hybridization mixture (10 μL/slide) contained: 50% formamide, 20% dextran sulphate, 10% 20×SSC, and 5% salmon sperm DNA and molecular probes. It was denatured at 70 °C for 10 min, 75 °C for 3 min, and then stored on ice for 10 min. Chromosomal DNA was denatured for 4 min at 70 °C with a hybridization mix and allowed to hybridize for 24 h at 37 °C. Digoxigenin-11-dUTP detection was conducted using antidigoxigenin-fluorescein antibody (Roche). Specific chromosomes were identified by comparing signal patterns and by comparing them to Komuro’s et al. [29] work. Slides were analyzed at 1000× using a Delta Optical FMA050 microscope with a DLT-Cam PRO 12MP camera and DLT-Cam Viewer software. Image editing and karyotyping were performed using Adobe Photoshop C6 software.

3. Results

3.1. Intraspecific Polymorphism of Chromosome Markers

We performed a cytogenetic analysis based on the following probes: pTa-713, pTa-535, and pTa-86. All molecular probes provided signals on chromosomes of diploid wheat. FISH-painted chromosomes were categorized according to Komuro et al. [29]. The hybridization of the pTa-535 probe to chromosomes of einkorn species revealed clear and highly specific labeling patterns. All chromosomes carried 1–2 hybridization sites in chromosome-specific positions, although some intraspecific variation in signal localization and intensity has been observed. Hybridization patterns of pTa-86 in T. urartu, T. monococcum ssp. Aegilopides, and T. monococcum ssp. Monococcum were absent. In the T. urartu hybridization patterns of pTa-535, only two genotypes (CLTR17664 and PI487265) were observed on chromosome 3Au in distal regions of long arms (Figure 1). The hybridization of the pTa-535 probe on the T. monococcum ssp. Aegilopoides chromosome revealed one very small signal in the subtelomeric region of the long arm in accession PI614649. A similar pattern was observed in the distal part of the short arm in genotype PI428011 of T. boeticum, and the additional hybridization sites of pTa-713 were found in the pericentromeric region (Figure 1).
Similar signal distributions of pTa-535 were observed in four accessions of T. monococcum ssp. monococcum (PI290508, PI591871, PI668147, and PI277130); one signal in the pericentromeric region of chromosome 3A in the hexaploid wheat overlap with sites of these accessions and the other pattern was noticed in the distal part of the short arms of chromosome 3Amm. Two accessions (PI170196 and PI326317) contained signals located in the subtelomeric region of the short arm. A weak signal was found in genotype PI225164 of einkorn in the subtelomeric region of chromosome 3AmmL (Figure 1). In accessions CLTR17667, PI428316 (T. urartu); PI554513, PI662221 (T. monococcum ssp. aegilopoides), and PI307984 (T. monococcum ssp. monococcum), we observed a lack of hybridization patterns of pTa-535 and pTa-713 (Figure 1).

3.2. Polymorphism of Lr63 Loci

In parallel to the cytogenetic analysis, we analyzed the allelic variation in the Lr63 leaf rust resistance loci at chromosome 3A (Figure 2). The expected specific product for marker Xbarc321 was 191 bp according to Kolmer et al. [7]. In this experiment, 11 genotypes (PI 225164, PI 428011, PI 554513, PI 668147, PI 277130, PI 614649, PI 290508, PI 662221, PI 170196, PI 326317, and PI 591871) revealed PCR products, which were identical to one specific to GSTR 444 (reference genotype to locus Lr63) (Table 1 and Figure 2). Moreover, Xbarc57 was used as the second marker in order to analyze the Lr63 locus. Compared to the reference genotype (GSTR 444), the expected 240 bp products were identified in 11 genotypes (CLTR 17667, PI 428316, PI 428011, PI 668147, PI 277130, PI 290508, PI 307984, PI 170196, PI 326317, PI 591871, and PI 487265) (Table 1, Figure 2). The comparison of Xbarc321 and Xbarc57 marker analyses showed that both markers allowed to identify the Lr63 gene locus in seven genotypes. Among them, six genotypes were considered as domesticated forms (Triticum monocococcum subsp. monococcum) (PI 668147, PI 277130, PI 290508, PI 170196, PI 326317, and PI 591871) and one was a nondomestication form (PI 428011) (Triticum monocococcum subsp. aegilopoides).

3.3. Rearrangements of Short Arm of 3A Chromosome

Taking into consideration the presence of molecular markers (Xbarc321 and Xbarc57) and the signals of the pTa-535 probe on chromosome 3A of the short arm, it was possible to divide the accessions into three groups (Figure 3). The first group included seven genotypes carrying Lr63 markers and possessed hybridization patterns on chromosome 3A. These accessions were as follows: PI 428011, PI 668147, PI 277130, PI 290508, PI 170196, PI 326317, and PI 591871, originating from Azerbaijan, Czechoslovakia, Albania, Hungary, Turkey, Azerbaijan, and Georgia (Figure 3). The genotypes in the second group were characterized by the presence of one marker (Xbarc321 or Xbarc57) and the absence of the pTa-535 probe signal, including CLTR 17667, PI 428316, PI 225164, PI 554513, PI 614649, PI 662221, PI 307984, and PI 487265, originating from Turkey, Iran, Greece, the Soviet Union, Ukraine, Greece, Morocco, and Syria (Figure 3). One accession (CLTR 17664 from Lebanon), included in the last group, revealed the absence of Lr63 markers and hybridization signals (Figure 3).

4. Discussion

Revealing how domestication and selection impact disease-related genes is one of the crucial issues in plant genetics connected to resistance breeding. It has been reported that hexaploid wheat originated due to two hybridization events [32]. First, two wild species, Triticum urartu (A-genome donor) and an extinct species from the Sitopsis section (B-genome donor), hybridized and formed wild tetraploid wheat (T. turgidum ssp. dicoccoides). After the domestication of this wild form to cultivated tetraploid wheat (T. turgidum ssp. dicoccum), a second hybridization occurred with the wild grass Ae. tauschii (D-genome donor) resulting in the hexaploid wheat. The evolution of the resistance genes of wheat can be determined with comparative analyses and the allele mining of diverse germplasms. For example, the leaf rust resistance gene Lr10 (located on chromosome arm 1AS) was cloned from bread cv. Thatcher Lr10 [33]. It was reported that diploid (T. urartu; A-genome donor) and tetraploid (wild and domesticated) wheats carry a homologous sequence of Lr10, which has two haplotypes at the Lr10 locus [34]. What is more, [35] suggested a balanced polymorphism and maintenance of both haplotypes of the Lr10 gene sequence in the wheat gene pool, which is similar to the evolutionary pathway of genes in other species, such as Rpm1 in Arabidopsis.
It is known that T. monococcum subsp. aegilopoides, T. monococcum subsp. Monococcum, and T. urartu carry the genome A, which is the axial subgenome for all wheats (Triticum sp.) [32]. Genes from these species can be introduced into wheat using direct crossing and chromosomal recombination. Diversified collections of these species are present in nature, widely distributed in different regions. The domestication of the diploid wheat T. monococcum ssp. aegilopoides was located in the geographical region of the Karaca Dağ (Karacadag) volcanic mountain, located in present-day south-eastern Turkey [18]. The wild form was first harvested and then transported to different geographical areas and cultivated there. Transport involved migrating farmers or exchanging seeds for other material goods, because not all soils in the “Fertile Crescent” area were adjusted to cultivate crops. The directions of the early spread of diploid wheat included areas of present-day Turkey, Iraq, Syria, and Iran. In the later phase of agricultural expansion, crops were transported in an already nascent state of domestication [18,36]. According to Kolmer et al. [7], only one gene resistant to leaf rust (Lr63) has been mapped on the short arm of chromosome 3Am. The short arm of the 3Am chromosome is also a region, where the main QTL for seed dormancy [37] FLOWERING LOCUS T (FT)-like, TERMINAL FLOWER1 (TFL1)-like, and MFT-like [38] is located. Those loci are considered to be the most agronomically important traits considering crop domestication. It could, therefore, be stated that the selection pressure could alter this chromosome region with particular intensity. After all, it is known that in the transition from gathering to cultivation, early farmers selected CWRs with useful genetic modifications and developed improved populations with desirable traits [39]. The abovementioned traits, as well as the loss of seed dispersal mechanisms, increased grain size, the loss of vulnerability to environmental factors for germination and flowering, synchronous ripening, and a compact growth habit are included in the “domestication syndrome” characters, which are the most important adaptive traits selected by mankind [40]. In this research, we observed the presence of two markers (Xbarc321 and Xbarc57) and hybridization patterns of probe pTa-535 on chromosome 3A accessions, which strongly indicated intra- and interspecific polymorphisms. The direction of the expansion of the first group of accessions proved the later phase of agricultural spread. The second group allowed to prove the early spread of einkorn, through directions of expansion and intra- and interspecific polymorphisms. The third group (T. urartu) was never domesticated and located near the Fertile Crescent. According to our cytogenetic observations, it could be stated that a similar organization of the 3Am chromosome (lack of pTa-535 signals and lack of one or two SSR markers) of T. monococcum spp. monococcum and T. monococcum spp. aegilopoides compared to T. urartu was observed only in accessions collected from the regions which were located closely to the domestication centers of einkorn wheat (Turkey, Azerbaijan, Greece, and Ukraine). Additional pTa-535 signals which appeared on the short arm of the 3Am chromosome were observed in the accessions, which revealed both markers linked to Lr63 loci. Interestingly, those accessions were collected near the domestication center of T. monococcum (Turkey), as well as in central Europe (Hungary, former Czechoslovakia, and Albania), and Georgia. Hence, it could be stated that forms belonging to the first and second groups were more prone to be selected and perform desirable domestication traits. Both repetitive sequence redundancies and proximities to genes were reported to vary between cultivated and wild genotypes [41,42]. Such differences suggest the potential function of repetitive sequences in crop domestication. For example, differences in the proximity of retrotransposons to genes could contribute to the significant phenotypic differences between wild and cultivated sunflowers [43]. Recently, Ebrahizadegan et al. [44] reported that different classes of repetitive DNA sequences have differentially accumulated between Aegilops tauschii subsp. strangulata and the other two subspecies of Ae. tauschii that were in parallel with spike morphology, implying that factors affecting the so called “repeatome” evolution are variable even among highly closely related lineages. In our study, we observed that both markers linked with Lr63 loci were present only in those accessions which revealed one or two additional pTa-535 sites. This chromosome organization pattern was characteristic to most of the T. monococcum subsp. monococcum accessions. Anker et al. [45] proposed that Triticum monococcum has a nonhost status to the pathogens responsible for leaf rust, and showed that Triticum monococcum subsp. monococcum is more rust-resistant compared to Triticum monococcum subp. aegilopoides and Triticum urartu [45].

5. Conclusions

Considering that new virulence pathotypes and races keep on appearing constantly, one of the key challenges for wheat breeders is the systematic development of new, elite varieties carrying effective resistance genes. In the description of the domestication model of diploid wheat, Kilian et al. [36] reported that einkorn wheat retained a high level of genetic diversity in the domesticated lines, which can be used to improve common wheat. Alterations and reorganization of the repetitive DNA sequences are the strongest indications of evolution and speciation processes. Therefore, the identification of polymorphisms in chromosome structures of different accessions of einkorn wheat may be helpful in further basic and application research.

Author Contributions

M.T.K. initiated the project. A.N. conducted the experiments and analyses. A.N. and R.B. wrote the first draft of the manuscript. M.T.K. revised the draft and improved the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This publication was co-financed by the framework of the Ministry of Science and Higher Education program as “Regional Initiative Excellence” in years 2019–2022, project No. 005/RID/2018/19.

Informed Consent Statement

Not applicable.

Acknowledgments

The authors would like to acknowledge Harrold Bockelman at the USDA/ARS Small Grains Laboratory, (Aberdeen, ID, USA), for providing the seed samples.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Harlan, J.R.; de Wet, J.M.J. Toward a Rational Classification of Cultivated Plants. TAXON 1971, 20, 509–517. [Google Scholar] [CrossRef]
  2. Dempewolf, H.; Baute, G.; Anderson, J.; Kilian, B.; Smith, C.; Guarino, L. Past and Future Use of Wild Relatives in Crop Breeding. Crop Sci. 2017, 57, 1070–1082. [Google Scholar] [CrossRef]
  3. Feldman, M.; Levy, A.A. Origin and Evolution of Wheat and Related Triticeae Species. In Alien Introgression in Wheat; Molnár-Láng, M., Ceoloni, C., Doležel, J., Eds.; Springer International Publishing: Cham, Switzerland, 2015; pp. 21–76. ISBN 978-3-319-23493-9. [Google Scholar]
  4. Badaeva, E.D.; Amosova, A.V.; Goncharov, N.P.; Macas, J.; Ruban, A.S.; Grechishnikova, I.V.; Zoshchuk, S.A.; Houben, A. A Set of Cytogenetic Markers Allows the Precise Identification of All A-Genome Chromosomes in Diploid and Polyploid Wheat. Cytogenet Genome Res. 2015, 146, 71–79. [Google Scholar] [CrossRef]
  5. Prasad, P.; Savadi, S.; Bhardwaj, S.C.; Gupta, P.K. The Progress of Leaf Rust Research in Wheat. Fungal Biol. 2020, 124, 537–550. [Google Scholar] [CrossRef] [PubMed]
  6. McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Xia, X.C. Catalogue of Gene Symbols For Wheat: 2017 Supplement. 20. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/macgene/supplement2017.pdf (accessed on 30 March 2022).
  7. Kolmer, J.A.; Anderson, J.A.; Flor, J.M. Chromosome Location, Linkage with Simple Sequence Repeat Markers, and Leaf Rust Resistance Conditioned by Gene Lr63 in Wheat. Crop Sci. 2010, 50, 2392–2395. [Google Scholar] [CrossRef] [Green Version]
  8. Childe, V.G. The Origin of Neolithic Culture in Northern Europe. Antiquity 1949, 23, 129–135. [Google Scholar] [CrossRef]
  9. Diamond, J. Evolution, Consequences and Future of Plant and Animal Domestication. Nature 2002, 418, 700–707. [Google Scholar] [CrossRef]
  10. Diamond, J.; Bellwood, P. Farmers and Their Languages: The First Expansions. Science 2003, 300, 597–603. [Google Scholar] [CrossRef]
  11. Skoglund, P.; Malmström, H.; Raghavan, M.; Storå, J.; Hall, P.; Willerslev, E.; Gilbert, M.T.P.; Götherström, A.; Jakobsson, M. Origins and Genetic Legacy of Neolithic Farmers and Hunter-Gatherers in Europe. Science 2012, 336, 466–469. [Google Scholar] [CrossRef]
  12. Meyer, R.S.; DuVal, A.E.; Jensen, H.R. Patterns and Processes in Crop Domestication: An Historical Review and Quantitative Analysis of 203 Global Food Crops. New Phytol. 2012, 196, 29–48. [Google Scholar] [CrossRef]
  13. Beissinger, T.M.; Wang, L.; Crosby, K.; Durvasula, A.; Hufford, M.B.; Ross-Ibarra, J. Recent Demography Drives Changes in Linked Selection across the Maize Genome. Nat. Plants 2016, 2, 16084. [Google Scholar] [CrossRef] [PubMed]
  14. Kantar, M.B.; Nashoba, A.R.; Anderson, J.E.; Blackman, B.K.; Rieseberg, L.H. The Genetics and Genomics of Plant Domestication. BioScience 2017, 67, 971–982. [Google Scholar] [CrossRef] [Green Version]
  15. Yang, L.; Koo, D.-H.; Li, Y.; Zhang, X.; Luan, F.; Havey, M.J.; Jiang, J.; Weng, Y. Chromosome Rearrangements during Domestication of Cucumber as Revealed by High-Density Genetic Mapping and Draft Genome Assembly. Plant. J. 2012, 71, 895–906. [Google Scholar] [CrossRef] [PubMed]
  16. Chia, J.-M.; Song, C.; Bradbury, P.J.; Costich, D.; de Leon, N.; Doebley, J.; Elshire, R.J.; Gaut, B.; Geller, L.; Glaubitz, J.C.; et al. Maize HapMap2 Identifies Extant Variation from a Genome in Flux. Nat. Genet. 2012, 44, 803–807. [Google Scholar] [CrossRef]
  17. Wang, Y.; Xiong, G.; Hu, J.; Jiang, L.; Yu, H.; Xu, J.; Fang, Y.; Zeng, L.; Xu, E.; Xu, J.; et al. Copy Number Variation at the GL7 Locus Contributes to Grain Size Diversity in Rice. Nat. Genet. 2015, 47, 944–948. [Google Scholar] [CrossRef]
  18. Kilian, B.; Ozkan, H.; Walther, A.; Kohl, J.; Dagan, T.; Salamini, F.; Martin, W. Molecular Diversity at 18 Loci in 321 Wild and 92 Domesticate Lines Reveal No Reduction of Nucleotide Diversity during Triticum Monococcum (Einkorn) Domestication: Implications for the Origin of Agriculture. Mol. Biol. Evol. 2007, 24, 2657–2668. [Google Scholar] [CrossRef] [Green Version]
  19. Heun, M.; Schäfer-Pregl, R.; Klawan, D.; Castagna, R.; Accerbi, M.; Borghi, B.; Salamini, F. Site of Einkorn Wheat Domestication Identified by DNA Fingerprinting. Science 1997, 278, 1312–1314. [Google Scholar] [CrossRef] [Green Version]
  20. Zaharieva, M.; Monneveux, P. Cultivated Einkorn Wheat (Triticum Monococcum L. Subsp. Monococcum): The Long Life of a Founder Crop of Agriculture. Genet. Resour. Crop Evol. 2014, 61, 677–706. [Google Scholar] [CrossRef]
  21. Nesbitt, M. From Staple Crop to Extinction? The Archaeology and History of Hulled Wheat. In Hulled Wheats. Promoting the Conservation and Use of Underutilized and Neglected Crops; IPRGI: Serdang, Malaysia, 1996; pp. 1–100. [Google Scholar]
  22. Nevo, E. Triticum. In Wild Crop Relatives: Genomic and Breeding Resources; Kole, C., Ed.; Springer: Berlin/Heidelberg, Germany, 2011; pp. 407–456. ISBN 978-3-642-14227-7. [Google Scholar]
  23. Filatenko, A.; Hammer, K. New Descriptions of Hulled Wheats on the Infraspecific Level. Genet. Resour. Crop Evol. 1997, 44, 285–288. [Google Scholar] [CrossRef]
  24. Gill, B.S.; Friebe, B. Plant Cytogenetics at the Dawn of the 21st Century. Curr. Opin. Plant. Biol. 1998, 1, 109–115. [Google Scholar] [CrossRef]
  25. Pedersen, C.; Langridge, P. Identification of the Entire Chromosome Complement of Bread Wheat by Two-Colour FISH. Genome 1997, 40, 589–593. [Google Scholar] [CrossRef] [PubMed]
  26. Cuadrado, A.; Schwarzacher, T.; Jouve, N. Identification of Different Chromatin Classes in Wheat Using In Situ Hybridization with Simple Sequence Repeat Oligonucleotides. Theor. Appl. Genet. 2000, 101, 711–717. [Google Scholar] [CrossRef]
  27. Cuadrado, A.; Cardoso, M.; Jouve, N. Physical Organisation of Simple Sequence Repeats (SSRs) in Triticeae: Structural, Functional and Evolutionary Implications. Cytogenet Genome Res. 2008, 120, 210–219. [Google Scholar] [CrossRef] [PubMed]
  28. Megyeri, M.; Farkas, A.; Varga, M.; Kovács, G.; Molnár-Láng, M.; Molnár, I. Karyotypic Analysis of Triticum Monococcum Using Standard Repetitive DNA Probes and Simple Sequence Repeats. Acta Agron. Hung. 2012, 60, 87–95. [Google Scholar] [CrossRef]
  29. Komuro, S.; Endo, R.; Shikata, K.; Kato, A. Genomic and Chromosomal Distribution Patterns of Various Repeated DNA Sequences in Wheat Revealed by a Fluorescence In Situ Hybridization Procedure. Genome 2013, 56, 131–137. [Google Scholar] [CrossRef] [PubMed]
  30. Kwiatek, M.; Majka, M.; Majka, J.; Belter, J.; Suchowilska, E.; Wachowska, U.; Wiwart, M.; Wiśniewska, H. Intraspecific Polymorphisms of Cytogenetic Markers Mapped on Chromosomes of Triticum Polonicum L. PLoS ONE 2016, 11, e0158883. [Google Scholar] [CrossRef] [Green Version]
  31. Goriewa-Duba, K.; Duba, A.; Kwiatek, M.; Wiśniewska, H.; Wachowska, U.; Wiwart, M. Correction: Chromosomal Distribution of PTa-535, PTa-86, PTa-713, 35S RDNA Repetitive Sequences in Interspecific Hexaploid Hybrids of Common Wheat (Triticum Aestivum L.) and Spelt (Triticum Spelta L.). PLoS ONE 2018, 13, e0203162. [Google Scholar] [CrossRef]
  32. Venske, E.; Schreinert dos Santos, R.; Busanello, C.; Gustafson, P.; Costa de Oliveira, A. Bread Wheat: A Role Model for Plant Domestication and Breeding. Hereditas 2019, 156, 16. [Google Scholar] [CrossRef] [Green Version]
  33. Feuillet, C.; Travella, S.; Stein, N.; Albar, L.; Nublat, A.; Keller, B. Map-Based Isolation of the Leaf Rust Disease Resistance Gene Lr10 from the Hexaploid Wheat (Triticum Aestivum L.) Genome. Proc. Natl. Acad. Sci. USA 2003, 100, 15253–15258. [Google Scholar] [CrossRef] [Green Version]
  34. Loutre, C.; Wicker, T.; Travella, S.; Galli, P.; Scofield, S.; Fahima, T.; Feuillet, C.; Keller, B. Two different CC-NBS-LRR genes are required for Lr10-mediated leaf rust resistance in tetraploid and hexaploid wheat. Plant J. 2009, 60, 1043–1054. [Google Scholar] [CrossRef] [Green Version]
  35. Tian, D.; Traw, M.B.; Chen, J.Q.; Kreitman, M.; Bergelson, J. Fitness costs of R-gene-mediated resistance in Arabidopsis thaliana. Nature 2003, 423, 74–77. [Google Scholar] [CrossRef] [PubMed]
  36. Muehlbauer, G.J.; Feuillet, C. (Eds.) Genetics and Genomics of the Triticeae; Springer: New York, NY, USA, 2009; ISBN 978-0-387-77488-6. [Google Scholar]
  37. Zhang, L.; Wang, S.; Li, H.; Deng, Q.; Zheng, A.; Li, S.; Li, P.; Li, Z.; Wang, J. Effects of Missing Marker and Segregation Distortion on QTL Mapping in F2 Populations. Appl. Genet. 2010, 121, 1071–1082. [Google Scholar] [CrossRef] [PubMed]
  38. Nakamura, S.; Abe, F.; Kawahigashi, H.; Nakazono, K.; Tagiri, A.; Matsumoto, T.; Utsugi, S.; Ogawa, T.; Handa, H.; Ishida, H.; et al. A Wheat Homolog of Mother of FT and TFL1 Acts in the Regulation of Germination. Plant. Cell. 2011, 23, 3215–3229. [Google Scholar] [CrossRef] [Green Version]
  39. Vaughan, D.A.; Balázs, E.; Heslop-Harrison, J.S. From Crop Domestication to Super-Domestication. Ann. Bot. 2007, 100, 893–901. [Google Scholar] [CrossRef]
  40. Gao, L.; Zhao, G.; Huang, D.; Jia, J. Candidate Loci Involved in Domestication and Improvement Detected by a Published 90K Wheat SNP Array. Sci. Rep. 2017, 7, 44530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Ramírez-González, R.H.; Borrill, P.; Lang, D.; Harrington, S.A.; Brinton, J.; Venturini, L.; Davey, M.; Jacobs, J.; van Ex, F.; Pasha, A.; et al. The Transcriptional Landscape of Polyploid Wheat. Science 2018, 361, eaar6089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Bariah, I.; Keidar-Friedman, D.; Kashkush, K. Where the Wild Things Are: Transposable Elements as Drivers of Structural and Functional Variations in the Wheat Genome. Front. Plant Sci. 2020, 11, 585515. [Google Scholar] [CrossRef]
  43. Mascagni, F.; Barghini, E.; Giordani, T.; Rieseberg, L.H.; Cavallini, A.; Natali, L. Repetitive DNA and Plant Domestication: Variation in Copy Number and Proximity to Genes of LTR-Retrotransposons among Wild and Cultivated Sunflower (Helianthus Annuus) Genotypes. Genome Biol. Evol. 2015, 7, 3368–3382. [Google Scholar] [CrossRef] [Green Version]
  44. Ebrahimzadegan, R.; Orooji, F.; Ma, P.; Mirzaghaderi, G. Differentially Amplified Repetitive Sequences Among Aegilops Tauschii Subspecies and Genotypes. Front. Plant Sci. 2021, 12, 716750. [Google Scholar] [CrossRef]
  45. Anker, C.C.; Niks, R.E. Prehaustorial Resistance to the Wheat Leaf Rust Fungus, Puccinia Triticina, in Triticum Monococcum. Euphytica 2001, 117, 209–215. [Google Scholar] [CrossRef]
Figure 1. Chromosomes 3A after FISH with pTa-713 (green) and pTa-535 (red) probes of CLTR17664, CLTR17667, PI428316, PI487265, PI554513, PI614649, PI662221, PI428011, PI225164, PI290508, PI591871, PI668147, PI170196, PI277130, PI307984, and PI326317.
Figure 1. Chromosomes 3A after FISH with pTa-713 (green) and pTa-535 (red) probes of CLTR17664, CLTR17667, PI428316, PI487265, PI554513, PI614649, PI662221, PI428011, PI225164, PI290508, PI591871, PI668147, PI170196, PI277130, PI307984, and PI326317.
Agriculture 12 00966 g001
Figure 2. PCR amplification products of wheat genotypes with xbarc321 and xbarc57 markers linked to Lr63 locus. M-50 bp DNA Ladder (NIPPON Genetics EUROPE GmbH); 1–17—wheat genotypes.
Figure 2. PCR amplification products of wheat genotypes with xbarc321 and xbarc57 markers linked to Lr63 locus. M-50 bp DNA Ladder (NIPPON Genetics EUROPE GmbH); 1–17—wheat genotypes.
Agriculture 12 00966 g002
Figure 3. Geographical distribution of the studied accessions divided into three groups according pTa-535 signal location, as well as molecular markers, the presence of a particular amplification product.
Figure 3. Geographical distribution of the studied accessions divided into three groups according pTa-535 signal location, as well as molecular markers, the presence of a particular amplification product.
Agriculture 12 00966 g003
Table 1. Origin and presence of Xbarc321 and Xbarc57 markers linked to Lr63 locus in tested diploid wheat. “+”—presence of marker; “-”—absence of marker.
Table 1. Origin and presence of Xbarc321 and Xbarc57 markers linked to Lr63 locus in tested diploid wheat. “+”—presence of marker; “-”—absence of marker.
No.Plant IDCultivarSpeciesOriginXbarc321Xbarc57
1.GSTR 444Lr63Triticum aestivum subsp. aestivumCanada++
2.CLTR17667-Triticum urartuTurkey-+
3.PI428316G3220Triticum urartuIran-+
4.PI225164KaploutrasTriticum monococcum subsp. monococcumGreece+-
5.PI428011G3224Triticum monococcum subsp. aegilopoidesAzerbaijan++
6.PI55451384TK154-028.00Triticum monococcum subsp. aegilopoidesSoviet Union+-
7.PI668147KromerizTriticum monococcum subsp. monococcumFormer Czechoslovakia++
8.PI277130A TRI 613/59Triticum monococcum subsp. monococcumAlbania++
9.PI614649UKR-99-075Triticum monococcum subsp. aegilopoidesUkraine+-
10.PI290508V.J. 388Triticum monococcum subsp. monococcumHungary++
11.PI662221GR05-052Triticum monococcum subsp. aegilopoidesGreece+-
12.PI307984K930Triticum monococcum subsp. monococcumMorocco-+
13.CLTR17664-Triticum urartuLebanon--
14.PI1701962498Triticum monococcum subsp. monococcumTurkey++
15.PI326317WIR 18140Triticum monococcum subsp. monococcumAzerbaijan++
16.PI591871 SN-264 Triticum monococcum subsp. monococcum Georgia + +
17.PI487265 SY 20033 Triticum urartu Syria - +
Table 2. Primer sequence and PCR terms for amplification of wheat repetitive sequences [29,30].
Table 2. Primer sequence and PCR terms for amplification of wheat repetitive sequences [29,30].
CloneNCBI GenBank Sequence NumberPrimer Sequences (5′ to 3′)Annealing Temperature (°C)
pTa-86KC290896ACGATTGACCAATCTCGGGG
ACCGACCCAAATTACGAGAGT
58.5
pTa-535KC290894GCATAGCATGTGCGAAAGAG
TCGTCCGAAACCCTGATAC
59
pTa-535KC290894GGGGCGGACGTCGTTG
CCGTAAGATAGACAGGGTGGG
59
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Noweiska, A.; Bobrowska, R.; Kwiatek, M.T. Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats. Agriculture 2022, 12, 966. https://doi.org/10.3390/agriculture12070966

AMA Style

Noweiska A, Bobrowska R, Kwiatek MT. Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats. Agriculture. 2022; 12(7):966. https://doi.org/10.3390/agriculture12070966

Chicago/Turabian Style

Noweiska, Aleksandra, Roksana Bobrowska, and Michał Tomasz Kwiatek. 2022. "Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats" Agriculture 12, no. 7: 966. https://doi.org/10.3390/agriculture12070966

APA Style

Noweiska, A., Bobrowska, R., & Kwiatek, M. T. (2022). Structural Polymorphisms of Chromosome 3Am Containing Lr63 Leaf Rust Resistance Loci Reflect the Geographical Distribution of Triticum monococcum L. and Related Diploid Wheats. Agriculture, 12(7), 966. https://doi.org/10.3390/agriculture12070966

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop