Comparative Transcriptome Profiling of Salinity-Induced Genes in Citrus Rootstocks with Contrasted Salt Tolerance
Abstract
:1. Introduction
2. Material and Methods
2.1. Plant Material and Salt Treatment
2.2. Identification and Sequence Analysis of Citrus Candidate Genes
2.3. RNA Extraction and Quantitative Real-Time RT-PCR Analysis
2.4. Data and Statistical Analysis
3. Results and Discussion
3.1. Ion Homeostasis Pathways
3.1.1. SOS1 Gene Expression
3.1.2. NHX1 Gene Expression
3.1.3. Vacuolar H+-Pump
3.1.4. HKT1 Gene Expression
3.1.5. Chloride Homeostasis
3.2. Tolerance Pathways to Oxidative Stress
3.3. Compatible Osmolyte Biosynthesis
3.4. Stress-Induced Proteins
3.4.1. Late Embryogenesis Abundant Protein Gene
3.4.2. Sucrose Phosphate Synthase Gene
3.4.3. Lipid Transfer Protein Gene
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Singh, A.; Sharma, P.C. Recent insights into physiological and molecular regulation of salt stress in fruit crops. Adv. Plants Agric. Res. 2018, 8, 171–183. [Google Scholar] [CrossRef]
- Chinnusamy, V.; Zhu, J.; Zhu, J.-K. Salt stress signaling and mechanisms of plant salt tolerance. In Genetic Engineering, Principles and Methods; Setlow, J.K., Hollaender, A., Eds.; Springer Science+Business Media, Inc.: New York, NY, USA, 2006; Volume 27, pp. 141–177. [Google Scholar]
- Syvertsen, J.P.; Garcia-Sanchez, F. Multiple abiotic stresses occurring with salinity stress in citrus. Environ. Exp. Bot. 2014, 103, 128–137. [Google Scholar] [CrossRef]
- Machado, R.M.A.; Serralheiro, R.P. Soil Salinity: Effect on Vegetable Crop Growth. Management Practices to Prevent and Mitigate Soil Salinization. Horticulturae 2017, 3, 30. [Google Scholar] [CrossRef]
- Ruiz, M.; Pensabene-Bellavia, G.; Quiñones, A.; García-Lor, A.; Morillon, R.; Ollitrault, P.; Primo-Millo, E.; Navarro, L.; Aleza, P. Molecular Characterization and Stress Tolerance Evaluation of New Allotetraploid Somatic Hybrids Between Carrizo Citrange and Citrus macrophylla W. rootstocks. Front. Plant Sci. 2018, 9, 901. [Google Scholar] [CrossRef]
- Najar, A.; Hamdi, I.; Mahmoud, S.; Medhioub, L.; Jaouadi, I.; Varsani, A.; Jemmali, A. First report of citrus tristeza virus in commercial citrus orchards in Tunisia. J. Plant Pathol. 2021, 103, 1051–1052. [Google Scholar] [CrossRef]
- Cimen, B.; Yesiloglu, T. Rootstock Breeding for Abiotic Stress Tolerance in Citrus. In Abiotic and Biotic Stress in Plants-Recent Advances and Future Perspectives; Shanker, A., Ed.; IntechOpen: London, UK, 2016; pp. 527–563. [Google Scholar]
- Liu, X.-Y.; Li, J.; Liu, M.-M.; Yao, Q.; Chen, J.-Z. Transcriptome Profiling to Understand the Effect of Citrus Rootstocks on the Growth of ‘Shatangju’ Mandarin. PLoS ONE 2017, 12, e0169897. [Google Scholar] [CrossRef] [Green Version]
- Domingues, A.R.; Marcolini, C.D.M.; da Silva Gonçalves, C.H.; de Resende, J.T.V.; Roberto, S.R.; Carlos, E.F. Rootstocks Genotypes Impact on Tree Development and Industrial Properties of ‘Valencia’ Sweet Orange Juice. Horticulturae 2021, 7, 141. [Google Scholar] [CrossRef]
- Liu, X.; Li, J.; Huang, M.; Chen, J. Mechanisms for the influence of citrus rootstocks on fruit size. J. Agric. Food Chem. 2015, 63, 2618–2627. [Google Scholar] [CrossRef]
- García-Muñoz, M.C.; Henao-Rojas, J.C.; Moreno-Rodríguez, J.M.; Botina-Azain, B.L.; Romero-Barrera, Y. Effect of rootstock and environmental factors on fruit quality of Persian lime (Citrus latifolia Tanaka) grown in tropical regions. J. Food Compos. Anal. 2021, 103, 104081. [Google Scholar] [CrossRef]
- Alfaro, J.M.; Bermejo, A.; Navarro, P.; Quiñones, A.; Salvador, A. Effect of Rootstock on Citrus Fruit Quality: A Review. Food Rev. Int. 2021, 1–9. [Google Scholar] [CrossRef]
- Storey, R.; Walker, R.R. Citrus and salinity. Sci. Hortic. 1999, 78, 39–81. [Google Scholar] [CrossRef]
- Ziogas, V.; Tanou, G.; Morianou, G.; Kourgialas, N. Drought and Salinity in Citriculture: Optimal Practices to Alleviate Salinity and Water Stress. Agronomy 2021, 11, 1283. [Google Scholar] [CrossRef]
- Levy, Y.; Syvertsen, J.P. Irrigation water quality and salinity effects in citrus trees. Hort. Rev. 2004, 30, 37–82. [Google Scholar]
- Camara-Zapata, J.M.; Garcίa-Sánchez, F.; Martinez, V.; Nieves, M.; Cerdá, A. Effect of NaCl on citrus cultivars. Agronomie 2004, 24, 155–160. [Google Scholar] [CrossRef]
- Balal, R.M.; Ashraf, M.Y.; Khan, M.M.; Jaskani, M.J.; Ashfaq, M. Influence of salt stress on growth and biochemical parameters of citrus rootstocks. Pak. J. Bot. 2011, 43, 2135–2141. [Google Scholar]
- Balal, R.M.; Khan, M.M.; Shahid, M.A.; Mattson, N.S.; Abbas, T.; Ashfaq, M.; Garcia-Sanchez, F.; Ghazanfer, U.; Gimeno, V.; Iqbal, Z. Comparative Studies on the Physiobiochemical, Enzymatic, and Ionic modifications in Salt-tolerant and Salt-sensitive Citrus Rootstocks under NaCl Stress. J. Am. Soc. Hort. Sci. 2012, 137, 86–95. [Google Scholar] [CrossRef] [Green Version]
- Yildiz, M.; Poyraz, I.; Çavdar, A.; Özgen, Y.; Beyaz, R. Plant Responses to Salt Stress. In Plant Breeding—Current and Future Views; Abdurakhmonov, I.Y., Ed.; IntechOpen: London, UK, 2020; pp. 1–18. [Google Scholar] [CrossRef]
- Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 2002, 25, 239–250. [Google Scholar] [CrossRef]
- Zhu, J.K. Plant Salt Stress. In Encyclopedia of Life Sciences; O’Daly, A., Ed.; Wiley: Chichester, UK, 2007; pp. 1–3. [Google Scholar]
- Carillo, P.; Annunziata, M.G.; Pontecorvo, G.; Fuggi, A.; Woodrow, P. Salinity Stress and Salt Tolerance. In Abiotic Stress in Plants—Mechanisms and Adaptations; Shanker, A., Venkateswarlu, B., Eds.; IntechOpen: London, UK, 2011; Chapter 2; pp. 1–21. [Google Scholar]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Ann. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [Green Version]
- Tanou, G.; Job, C.; Rajjou, L.; Arc, E.; Belghazi, M.; Diamantidis, G.; Molassiotis, A.; Job, D. Proteomics reveals the overlapping roles of hydrogen peroxide and nitric oxide in the acclimation of citrus plants to salinity. Plant J. 2009, 60, 795–804. [Google Scholar] [CrossRef]
- Hossain, M.A.; Bhattacharjee, S.; Armin, S.-M.; Qian, P.; Xin, W.; Li, H.-Y.; Burritt, D.J.; Fujita, M.; Tran, L.-S.P. Hydrogen peroxide priming modulates abiotic oxidative stress tolerance: Insights from ROS detoxification and scavenging. Front. Plant Sci. 2015, 6, 420. [Google Scholar] [CrossRef] [Green Version]
- de la Garma, J.G.; Fernandez-Garcia, N.; Bardisi, E.; Pallol, B.; Asensio-Rubio, J.S.; Bru, R.; Olmos, E. New insights into plant salt acclimation: The roles of vesicle trafficking and reactive oxygen species signalling in mitochondria and the endomembrane system. New Phytol. 2015, 205, 216–239. [Google Scholar] [CrossRef]
- Molassiotis, A.; Job, D.; Ziogas, V.; Tanou, G. Citrus Plants: A Model System for Unlocking the Secrets of NO and ROS-Inspired Priming Against Salinity and Drought. Front. Plant Sci. 2016, 7, 229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive Oxygen Species, Oxidative Damage, and Antioxidative Defense Mechanism in Plants under Stressful Conditions. J. Bot. 2012, 2012, 217037. [Google Scholar] [CrossRef] [Green Version]
- Krasensky, J.; Jonak, C. Drought, salt, and temperature stress-induced metabolic rearrangements and regulatory networks. J. Exp. Bot. 2012, 63, 1593–1608. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, R.; Zhang, J.; Ma, Y.; Pan, X.; Dong, C.; Pang, S.; He, S.; Deng, L.; Yi, S.; Zheng, Y.; et al. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots. Sci. Rep. 2017, 7, 42094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brumós, J.; Colmenero-Flores, J.M.; Conesa, A.; Izquierdo, P.; Sánchez, G.; Iglesias, D.J.; López-Climent, M.F.; Gómez-Cadenas, A.; Talón, M. Membrane transporters and carbon metabolism implicated in chloride homeostasis differentiate salt stress responses in tolerant and sensitive Citrus rootstocks. Funct. Integr. Genom. 2009, 9, 293–309. [Google Scholar] [CrossRef]
- López-Climent, M.F.; Arbona, V.; Pérez-Clemente, R.M.; Gómez-Cadenas, A. Relationship between salt tolerance and photosynthetic machinery performance in Citrus. Environ. Exp. Bot. 2008, 62, 176–184. [Google Scholar] [CrossRef]
- Apse, M.P.; Blumwald, E. Na+ transport in plants. FEBS Lett. 2007, 581, 2247–2254. [Google Scholar] [CrossRef] [Green Version]
- Colmenero-Flores, J.M.; Arbona, V.; Morillon, R.; Gomez-Cadenas, A. Salinity and water deficit. In The Genus Citrus, 1st ed.; Talon, M., Caruso, M., Gmitter, F.G., Jr., Eds.; Elsevier: Oxford, UK, 2020; Chapter 14; pp. 291–309. [Google Scholar]
- Colmenero-Flores, J.M.; Martínez, G.; Gamba, G.; Vázquez, N.; Iglesias, D.J.; Brumós, J.; Talón, M. Identification and functional characterization of cation–chloride cotransporters in plants. Plant J. 2007, 50, 278–292. [Google Scholar] [CrossRef]
- Brumós, J.; Talón, M.; Bouhlal, R.; Colmenero-Flores, J.M. Cl- homeostasis in includer and excluder citrus rootstocks: Transport mechanisms and identification of candidate genes. Plant Cell Environ. 2010, 33, 2012–2027. [Google Scholar] [CrossRef]
- Mahmoud, L.M.; Huyck, P.J.; Vincent, C.I.; Gmitter, F.G., Jr.; Grosser, J.W.; Dutt, M. Physiological Responses and Gene Expression Patterns in Open-Pollinated Seedlings of a Pummelo-Mandarin Hybrid Rootstock Exposed to Salt Stress and Huanglongbing. Plants 2021, 10, 1439. [Google Scholar] [CrossRef] [PubMed]
- Volkov, V.; Beilby, M.J. Editorial: Salinity Tolerance in Plants: Mechanisms and Regulation of Ion Transport. Front. Plant Sci. 2017, 8, 1795. [Google Scholar] [CrossRef] [PubMed]
- Şahin-Çevik, M.; Çevik, B.; Coşkan, A. Identification and Expression Analysis of Salinity-induced Genes in Rangpur lime (Citrus limonia). Hortic. Plant J. 2020, 6, 267–276. [Google Scholar] [CrossRef]
- Yang, Y.; Guo, Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol. 2018, 217, 523–539. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Li, Q. Effect of Environmental Salt Stress on Plants and the Molecular Mechanism of Salt Stress Tolerance. Int. J. Environ. Sci. Nat. Res. 2017, 7, 555714. [Google Scholar] [CrossRef]
- Munns, R. Genes and salt tolerance: Bringing them together. New Phytol. 2005, 167, 645–663. [Google Scholar] [CrossRef]
- Xie, R.; Pan, X.; Zhang, J.; Ma, Y.; He, S.; Zheng, Y.; Ma, Y. Effect of salt-stress on gene expression in citrus roots revealed by RNA-seq. Funct. Integr. Genom. 2018, 18, 155–173. [Google Scholar] [CrossRef]
- Chinnusamy, V.; Zhu, J.K. Plant salt tolerance. In Plant Responses to Abiotic Stress; Topics in Current Genetics; Hirt, H., Shinozaki, K., Eds.; Springer: Berlin/Heidelberg, Germany, 2003; Volume 4, pp. 241–270. [Google Scholar]
- Noreen, Z.; Ashraf, M. Assessment of variation in antioxidative defense system in salt-treated pea (Pisum sativum) cultivars and its putative use as salinity tolerance markers. J. Plant Physiol. 2009, 166, 1764–1774. [Google Scholar] [CrossRef]
- Khalid, M.F.; Morillon, R.; Anjum, M.A.; Ejaz, S.; Rao, M.J.; Ahmad, S.; Hussain, S. Volkamer Lemon Tetraploid Rootstock Transmits the Salt Tolerance When Grafted with Diploid Kinnow Mandarin by Strong Antioxidant Defense Mechanism and Efficient Osmotic Adjustment. J. Plant Growth Regul. 2021, 1–13. [Google Scholar] [CrossRef]
- Ashfaque, F.; Iqbal, M.; Khan, R.; Khan, N.A. Exogenously applied H2O2 promotes proline accumulation, water relations, photosynthetic efficiency and growth of wheat (Triticum aestivum L.) under salt stress. Annu. Res. Rev. Biol. 2014, 4, 105–120. [Google Scholar] [CrossRef]
- Nazar, R.; Iqbal, N.; Syeed, S.; Khan, N.A. Salicylic acid alleviates decreases in photosynthesis under salt stress by enhancing nitrogen and sulfur assimilation and antioxidant metabolism differentially in two mungbean cultivars. J. Plant Physiol. 2011, 168, 807–815. [Google Scholar] [CrossRef] [PubMed]
- AbdElgawad, H.; Zinta, G.; Hegab, M.M.; Pandey, R.; Asard, H.; Abuelsoud, W. High Salinity Induces Different Oxidative Stress and Antioxidant Responses in Maize Seedlings Organs. Front. Plant Sci. 2016, 7, 276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blumwald, E. Engineering salt tolerance in plants. Biotechnol. Genetic Eng. Rev. 2013, 20, 261–276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verslues, P.E.; Agarwal, M.; Katiyar-Agarwal, S.; Zhu, J.; Zhu, J.K. Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant J. 2006, 45, 523–539. [Google Scholar] [CrossRef]
- Hong, Z.; Lakkineni, K.; Zhang, Z.; Verma, D.P. Removal of feedback inhibition of D1-pyrroline-5-carboxylate synthetase results in increased proline accumulation and protection of plants from osmotic stress. Plant Physiol. 2000, 122, 1129–1136. [Google Scholar] [CrossRef] [Green Version]
- Székely, G.; Abraham, E.; Cséplo, A.; Rigó, G.; Zsigmond, L.; Csiszár, J.; Ayaydin, F.; Strizhov, N.; Jásik, J.; Schmelzer, E.; et al. Duplicated p5cs genes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis. Plant J. 2008, 53, 11–28. [Google Scholar] [CrossRef] [Green Version]
- Annunziata, M.G.; Ciarmiello, L.F.; Woodrow, P.; Dell’Aversana, E.; Carillo, P. Spatial and Temporal Profile of Glycine Betaine Accumulation in Plants under Abiotic Stresses. Front. Plant Sci. 2019, 10, 230. [Google Scholar] [CrossRef] [Green Version]
- Mäkelä, P.S.A.; Munns, R.; Colmer, T.D.; Condon, A.G.; Peltonen-Sainio, P. Effect of foliar applications of glycinebetaine on stomatal conductance, abscisic acid and solute concentrations in leaves of salt- or drought-stressed tomato. Funct. Plant Biol. 1998, 25, 655–663. [Google Scholar] [CrossRef]
- Guo, L.; Yang, H.; Xiaoyan, Z.; Yang, S. Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis. J. Exp. Bot. 2013, 64, 1755–1767. [Google Scholar] [CrossRef]
- Liu, F.; Zhang, X.; Lu, C.; Zeng, X.; Li, Y.; Fu, D.; Wu, G. Non-specific lipid transfer proteins in plants: Presenting new advances and an integrated functional analysis. J. Exp. Bot. 2015, 66, 5663–5681. [Google Scholar] [CrossRef] [Green Version]
- Solís-Guzmán, M.G.; Argüello-Astorga, G.; López-Bucio, J.; Ruiz-Herrera, L.F.; López-Meza, J.E.; Sánchez-Calderón, L.; Carreón-Abud, Y.; Martínez-Trujillo, M. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress. Gene Expr. Patterns 2017, 25–26, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Jang, C.S.; Lee, H.J.; Chang, S.J.; Seo, Y.W. Expression and promoter analysis of the TaLTP1 gene induced by drought and salt stress in wheat (Triticum aestivum L.). Plant Sci. 2004, 167, 995–1001. [Google Scholar] [CrossRef]
- Wang, H.; Kwon, H.; Yim, W.; Lim, S.; Moon, J.; Lee, B.; Seo, Y.; Kim, W.; Jang, C. Expressional diversity of wheat nsLTP genes: Evidence of subfunctionalization via cis-regulatory divergence. Genetica 2010, 138, 843–852. [Google Scholar] [CrossRef] [PubMed]
- Shih, M.D.; Hoekstra, F.A.; Hsing, Y.I.C. Late Embryogenesis Abundant Proteins. Adv. Bot. Res. 2008, 48, 211–255. [Google Scholar] [CrossRef]
- Battaglia, M.; Olvera-Carrillo, Y.; Garciarrubio, A.; Campos, F.; Covarrubias, A.A. The Enigmatic LEA Proteins and Other Hydrophilins. Plant Physiol. 2008, 148, 6–24. [Google Scholar] [CrossRef] [Green Version]
- Duan, J.; Cai, W. OsLEA3-2, an abiotic stress induced gene of rice plays a key role in salt and drought tolerance. PLoS ONE 2012, 7, e45117. [Google Scholar] [CrossRef] [Green Version]
- Ma, Y.; Dias, M.C.; Freitas, H. Drought and Salinity Stress Responses and Microbe-Induced Tolerance in Plants. Front. Plant Sci. 2020, 11, 591911. [Google Scholar] [CrossRef]
- Choi, A.M.; Lee, S.B.; Cho, S.H.; Hwang, I.; Hur, C.G.; Suh, M.C. Isolation and characterization of multiple abundant lipid transfer protein isoforms in developing sesame (Sesamum indicum L.) seeds. Plant Physiol. Biochem. 2008, 46, 127–139. [Google Scholar] [CrossRef]
- Singh, A.; Prakash, J.; Srivastav, M.; Singh, S.K.; Awasthi, O.P.; Singh, A.K.; Chaudhari, S.K.; Sharma, D.K. Physiological and biochemical responses of citrus rootstocks under salinity stress. Indian J. Hort. 2014, 71, 162–167. [Google Scholar]
- Cimen, B.; Yesiloglu, T.; Yilmaz, B.; Incesu, M. Effects of different salinity levels on photosynthetic performances of some citrus rootstocks. Res. J. Agric. Sci. 2013, 6, 13–18. [Google Scholar]
- Behboudian, M.; Torokfalvy, E.; Walker, R. Effects of salinity on ionic content, water relations and gas exchange parameters in some citrus scion—Rootstock combinations. Sci. Hortic. 1986, 28, 105–116. [Google Scholar] [CrossRef]
- Iglesias, D.J.; Cercós, M.; Colmenero-Flores, J.M.; Naranjo, M.A.; Ríos, G.; Carrera, E.; Ruiz-Rivero, O.; Lliso, I.; Morillon, R.; Tadeo, F.R.; et al. Physiology of citrus fruiting. Braz. J. Plant Physiol. 2007, 19, 333–362. [Google Scholar] [CrossRef]
- Rodríguez-Gamir, J.; Ancillo, G.; Legaz, F.; Primo-Millo, E.; Forner-Giner, M.A. Influence of salinity on pip gene expression in citrus roots and its relationship with root hydraulic conductance, transpiration and chloride exclusion from leaves. Environ. Exp. Bot. 2012, 78, 163–166. [Google Scholar] [CrossRef]
- Mahmoud, L.M.; Dutt, M.; Vincent, C.I.; Grosser, J.W. Salinity-induced physiological responses of three putative salt tolerant citrus rootstocks. Horticulturae 2020, 6, 90. [Google Scholar] [CrossRef]
- Romero-Aranda, R.; Moya, J.L.; Tadeo, F.R.; Legaz, F.; Primo-Millo, E.; Talon, M. Physiological and anatomical disturbances induced by chloride salts in sensitive and tolerant citrus: Beneficial and detrimental effects of cations. Plant Cell Environ. 1998, 21, 1243–1253. [Google Scholar] [CrossRef]
- Walker, R.R.; Douglas, T.J. Effect of salinity level on uptake and distribution of chloride, sodium and potassium ions in Citrus plants. Aust. J. Agric. Res. 1983, 34, 145–153. [Google Scholar] [CrossRef]
- Hussain, S.; Morillon, R.; Muhammad, A.A.; Ollitrault, P.; Costantino, G.; Luro, F. Genetic diversity revealed by physiological behavior of citrus genotypes subjected to salt stress. Acta Physiol. Plant. 2015, 37, 1740. [Google Scholar] [CrossRef]
- Moya, J.L.; Gómez-Cadenas, A.; Primo-Millo, E.; Talon, M. Chloride absorption in salt-sensitive Carrizo citrange and salt-tolerant Cleopatra mandarin citrus rootstocks is linked to water use. J. Exp. Bot. 2003, 54, 825–833. [Google Scholar] [CrossRef] [Green Version]
- Gonzalez, P.; Syvertsen, J.P.; Etxeberria, E. Sodium distribution in salt-stressed citrus rootstock seedlings. HortScience 2012, 47, 1504–1511. [Google Scholar] [CrossRef] [Green Version]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Calif. Agric. Exp. Stn. Circ. 1950, 347, 1–32. [Google Scholar]
- Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988, 16, 10881–10890. [Google Scholar] [CrossRef] [PubMed]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [Green Version]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Quintero, F.J.; Pardo, J.M.; Zhu, J.K. The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants. Plant Cell 2002, 14, 465–477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quintero, F.J.; Martinez-Atienza, J.; Villalta, I.; Jiang, X.; Kim, W.-Y.; Ali, Z.; Fujii, H.; Mendoza, I.; Yun, D.-J.; Zhu, J.; et al. Activation of the plasma membrane Na/H antiporter Salt-Overly-Sensitive 1 (SOS1) by phosphorylation of an auto-inhibitory C-terminal domain. Proc. Natl. Acad. Sci. USA 2011, 108, 2611–2616. [Google Scholar] [CrossRef] [Green Version]
- Yang, Q.; Chen, Z.Z.; Zhou, X.F.; Yin, H.B.; Li, X.; Xin, X.F.; Hong, X.H.; Zhu, J.K.; Gong, Z. Overexpression of SOS (Salt Overly Sensitive) genes increases salt tolerance in transgenic Arabidopsis. Mol. Plant 2009, 2, 22–31. [Google Scholar] [CrossRef] [Green Version]
- Ma, D.M.; Xu, W.R.; Li, H.W.; Jin, F.X.; Guo, L.N.; Wang, J.; Da, H.J.; Xu, X. Co-expression of the Arabidopsis SOS genes enhances salt tolerance in transgenic tall fescue (Festuca arundinacea Schreb.). Protoplasma 2014, 251, 219–231. [Google Scholar] [CrossRef] [Green Version]
- Khoshbakht, D.; Ramin, A.A.; Baninasab, B. Citrus rootstocks response to salinity: Physio-biochemical parameters changes. Res. J. Environ. Sci. 2014, 8, 29–38. [Google Scholar] [CrossRef] [Green Version]
- Grosser, J.W.; Omar, A.A.; Gmitter, J.A.; Syvertsen, J.P. Salinity Tolerance of ‘Valencia’ Orange Trees on Allotetraploid Rootstocks. Proc. Fla. State Hort. Soc. 2012, 125, 50–55. [Google Scholar]
- Pardo, J.M. Biotechnology of water and salinity stress tolerance. Curr. Opin. Biotechnol. 2010, 21, 185–196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Alcántara, B.; Martinez-Cuenca, M.R.; Quinones, A.; Iglesias, D.J.; Primo-Millo, E.; Forner-Giner, M.A. Comparative expression of candidate genes involved in sodium transport and compartmentation in citrus. Environ. Exp. Bot. 2015, 111, 52–62. [Google Scholar] [CrossRef]
- Ding, M.; Hou, P.; Shen, X.; Wang, M.; Deng, S.; Sun, J.; Xiao, F.; Wang, R.; Zhou, X.; Lu, C.; et al. Salt induced expression of genes related to Na+/K+ and ROS homeostasis in leaves of salt-resistant and salt sensitive poplar species. Plant Mol. Biol. 2010, 73, 251–269. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Jiang, X.; Zhan, K.; Cheng, X.; Chen, X.; Pardo, J.M.; Cui, D. Functional characterization of a wheat plasma membrane Na+/H+ antiporter in yeast. Arch. Biochem. Biophys. 2008, 473, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Brini, F.; Masmoudi, K. Ion Transporters and Abiotic Stress Tolerance in Plants. ISRN Mol. Biol. 2012, 3, 927436. [Google Scholar] [CrossRef]
- Blumwald, E. Sodium transport and salt tolerance in plants. Curr. Opin. Cell Biol. 2000, 12, 431–434. [Google Scholar] [CrossRef]
- Tian, N.; Wang, J.; Xu, Z.Q. Overexpression of Na+/H+ antiporter gene AtNHX1 from Arabidopsis thaliana improves the salt tolerance of kiwifruit (Actinidia deliciosa). S. Afr. J. Bot. 2011, 77, 160–169. [Google Scholar] [CrossRef] [Green Version]
- Zhao, F.Y.; Zhang, X.J.; Li, P.H.; Zhao, Y.X.; Zhang, H. Co-expression of the Suaeda salsa SsNHX1 and Arabidopsis AVP1 confer greater salt tolerance to transgenic rice than the single SsNHX1. Mol. Breed. 2006, 17, 341–353. [Google Scholar] [CrossRef]
- Leidi, E.O.; Barragán, V.; Rubio, L.; El-Hamdaoui, A.; Ruiz, M.T.; Cubero, B.; Fernández, J.A.; Bressan, R.A.; Hasegawa, P.M.; Quintero, F.J.; et al. The AtNHX1 exchanger mediates potassium compartmentation in vacuoles of transgenic tomato. Plant J. 2010, 61, 495–506. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.A.; Yang, G.D.; Meng, Q.W.; Zheng, C.C. The cotton GhNHX1 gene encoding a novel putative tonoplast Na+/H+ antiporter plays an important role in salt stress. Plant Cell Physiol. 2004, 45, 600–607. [Google Scholar] [CrossRef] [Green Version]
- Saqib, M.; Zorb, C.; Rengel, Z.; Schubert, S. The expression of the endogenous vacuolar Na+/H+ antiporters in roots and shoots correlates positively with the salt resistance of wheat (Triticum aestivum L.). Plant Sci. 2005, 169, 959–965. [Google Scholar] [CrossRef]
- Yokoi, S.; Quintero, F.J.; Cubero, B.; Ruiz, M.T.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J. 2002, 30, 529–539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, S.; Jiang, P.; Nie, L.; Chen, X.; Tai, F.; Wang, D.; Fan, P.; Feng, J.; Bao, H.; Wang, J.; et al. H+-pyrophosphatase from Salicornia europaea confers tolerance to simultaneously occurring salt stress and nitrogen deficiency in Arabidopsis and wheat. Plant Cell Environ. 2015, 38, 2433–2449. [Google Scholar] [CrossRef]
- Hasegawa, P.M. Sodium (Na+) homeostasis and salt tolerance of plants. Environ. Exp. Bot. 2013, 92, 19–31. [Google Scholar] [CrossRef]
- Fu, L.; Wu, D.; Zhang, X.; Xu, Y.; Kuang, L.; Cai, S.; Zhang, G.; Shen, Q. Vacuolar H+-pyrophosphatase HVP10 enhances salt tolerance via promoting Na+ translocation into root vacuoles. Plant Physiol. 2021, 188, 1248–1263. [Google Scholar] [CrossRef] [PubMed]
- Gaxiola, R.A.; Li, J.; Undurraga, S.; Dang, L.M.; Allen, G.J.; Alper, S.L.; Fink, G.R. Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proc. Natl. Acad. Sci. USA 2001, 98, 11444–11449. [Google Scholar] [CrossRef] [Green Version]
- Lv, S.; Zhang, K.; Gao, Q.; Lian, L.; Song, Y.; Zhang, J. Overexpression of an H+-PPase Gene from Thellungiella halophila in Cotton enhances Salt Tolerance and Improves Growth and Photosynthetic Performance. Plant Cell Physiol. 2008, 49, 1150–1164. [Google Scholar] [CrossRef] [Green Version]
- Schilling, R.K.; Marschner, P.; Shavrukov, Y.; Berger, B.; Tester, M.; Roy, S.J.; Plett, D.C. Expression of the Arabidopsis vacuolar H⁺-pyrophosphatase gene (AVP1) improves the shoot biomass of transgenic barley and increases grain yield in a saline field. Plant Biotechnol. J. 2014, 12, 378–386. [Google Scholar] [CrossRef]
- Yang, Y.; Tang, R.J.; Li, B.; Wang, H.H.; Jin, Y.L.; Jiang, C.M.; Bao, Y.; Su, H.Y.; Zhao, N.; Ma, X.J.; et al. Overexpression of a Populus trichocarpa H+-pyrophosphatase gene PtVP1. 1 confers salt tolerance on transgenic poplar. Tree Physiol. 2015, 35, 663–677. [Google Scholar] [CrossRef] [Green Version]
- Gao, F.; Gao, Q.; Duan, X.; Yue, G.; Yang, A.; Zhang, J. Cloning of an H+-PPase gene from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance. J. Exp. Bot. 2006, 57, 3259–3270. [Google Scholar] [CrossRef] [Green Version]
- Jha, D.; Shirley, N.; Tester, M.; Roy, S.J. Variation in salinity tolerance and shoot sodium accumulation in Arabidopsis ecotypes linked to differences in the natural expression levels of transporters involved in sodium transport. Plant Cell Environ. 2010, 33, 793–804. [Google Scholar]
- Zhang, M.; Cao, Y.; Wang, Z.; Wang, Z.Q.; Shi, J.; Liang, X.; Song, W.; Chen, Q.; Lai, J.; Jiang, C. A retrotransposon in an HKT1 family sodium transporter causes variation of leaf Na+ exclusion and salt tolerance in maize. New Phytol. 2018, 217, 1161–1176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Platten, J.D.; Cotsaftis, O.; Berthomieu, P.; Bohnert, H.; Davenport, R.J.; Fairbairn, D.J.; Horie, T.; Leigh, R.A.; Lin, H.-X.; Luan, S.; et al. Nomenclature for HKT transporters, key determinants of plant salinity tolerance. Trends Plant Sci. 2006, 11, 372–374. [Google Scholar] [CrossRef]
- Waters, S.; Gilliham, M.; Hrmova, M. Plant high-affinity potassium (HKT) transporters involved in salinity tolerance: Structural insights to probe differences in ion selectivity. Int. J. Mol. Sci. 2013, 14, 7660–7680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Møller, I.S.; Gilliham, M.; Jha, D.; Mayo, G.M.; Roy, S.J.; Coates, J.C.; Haseloff, J.; Tester, M. Shoot Na+ exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na+ transport in Arabidopsis. Plant Cell 2009, 21, 2163–2178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davenport, R.J.; Muñoz-Mayor, A.; Jha, D.; Essah, P.A.; Rus, A.; Tester, M. The Na+ transporter AtHKT1;1 controls retrieval of Na+ from the xylem in Arabidopsis. Plant Cell Environ. 2007, 30, 497–507. [Google Scholar] [CrossRef]
- Levy, Y.; Lifshitz, J.; De Malach, Y.; David, Y. The Response of Several Citrus Genotypes to High-salinity Irrigation Water. HortScience 1999, 34, 878–881. [Google Scholar] [CrossRef]
- García-Sánchez, F.; Syvertsen, J.P.; Martínez, V.; Melgar, J.C. Salinity tolerance of ‘Valencia’ orange trees on rootstocks with contrasting salt tolerance is not improved by moderate shade. J. Expt. Bot. 2006, 57, 3697–3706. [Google Scholar] [CrossRef]
- Gamba, G. Molecular physiology and pathophysiology of electroneutral cation-chloride cotransporters. Physiol. Rev. 2005, 85, 423–493. [Google Scholar] [CrossRef]
- Franco-Navarro, J.D.; Rosales, M.A.; Cubero-Font, P.; Calvo, P.; Álvarez, R.; Diaz-Espejo, A.; Colmenero-Flores, J.M. Chloride as macronutrient increases water use efficiency by anatomically-driven reduced stomatal conductance and increased mesophyll diffusion to CO2. Plant J. 2019, 99, 815–831. [Google Scholar]
- Martins, C.P.S.; Pedrosa, A.M.; Du, D.; Gonçalves, L.P.; Yu, Q.; Gmitter, F.G., Jr.; Costa, M.G.C. Genome-wide characterization and expression analysis of major intrinsic proteins during abiotic and biotic stresses in sweet orange (Citrus sinensis L. Osb.). PLoS ONE 2015, 10, e0138786. [Google Scholar] [CrossRef]
- Syvertsen, J.P.; Melgar, J.C.; García-Sánchez, F. Salinity Tolerance and Leaf Water Use Efficiency in Citrus. J. Am. Soc. Hortic. Sci. 2010, 135, 33–39. [Google Scholar] [CrossRef] [Green Version]
- Seday, U.; Gulsen, O.; Uzun, A.; Toprak, G. Response of citrus rootstocks to different salinity levels for morphological and antioxidative enzyme activites. J. Anim. Plant Sci. 2014, 24, 512–520. [Google Scholar]
- Mittova, V.; Tal, M.; Volokita, M.; Guy, M. Up-regulation of the leaf mitochondrial and peroxisomal antioxidative systems in response to salt-induced oxidative stress in the wild salt-tolerant tomato species Lycopersicon pennellii. Plant Cell Environ. 2003, 26, 845–856. [Google Scholar] [CrossRef] [PubMed]
- Sekmen, A.H.; Türkan, I.; Takio, S. Differential responses of antioxidative enzymes and lipid peroxidation to salt stress in salt-tolerant Plantago maritima and salt-sensitive Plantago Media. Physiol. Plant 2007, 131, 399–411. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.A.; Silva, J.A.T.d.; Fujita, M. Glyoxalase system and reactive oxygen species detoxification system in plant abiotic stress response and tolerance: An intimate relationship. In Abiotic Stress in Plants: Mechanisms and Adaptations; Shanker, A., Venkateswarlu, B., Eds.; IntechOpen: London, UK, 2011; Chapter 11; pp. 235–266. [Google Scholar]
- Hasanuzzaman, M.; Hossain, M.A.; Silva, J.A.T.D.; Fujita, M. Plant Response and Tolerance to Abiotic Oxidative Stress: Antioxidant Defense Is a Key Factor. In Crop Stress and Its Management: Perspectives and Strategies; Venkateswarlu, B., Shanker, A., Shanker, C., Maheswari, M., Eds.; Springer: Dordrecht, The Netherlands, 2012; pp. 261–315. [Google Scholar]
- Clegg, M.T.; Rawson, J.R.; Thomas, K. Chloroplast DNA variation in pearl millet and related species. Genetics 1984, 106, 449–461. [Google Scholar] [CrossRef]
- Acosta-Motos, J.R.; Ortuño, M.F.; Bernal-Vicente, A.; Diaz-Vivancos, P.; Sanchez-Blanco, M.J.; Hernandez, J.A. Plant Responses to Salt Stress: Adaptive Mechanisms. Agronomy 2017, 7, 18. [Google Scholar] [CrossRef] [Green Version]
- Balfagón, D.; Terán, F.; de Oliveira, T.D.R.; Santa-Catarina, C.; Gómez-Cadenas, A. Citrus rootstocks modify scion antioxidant system under drought and heat stress combination. Plant Cell Rep. 2021, 1–10. [Google Scholar] [CrossRef]
- Apse, M.P.; Blumwald, E. Engineering salt tolerance in plants. Curr. Opin. Biotechnol. 2002, 13, 146–150. [Google Scholar] [CrossRef]
- Shirasawa, K.; Takabe, T.; Takabe, T.; Kishitani, S. Accumulation of glycinebetaine in rice plants that overexpress choline monooxygenase from spinach and evaluation of their tolerance to abiotic stress. Ann. Bot. 2006, 98, 565–571. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Tan, W.; Yang, X.H.; Zhang, H.X. Plastid-expressed choline monooxygenase gene improves salt and drought tolerance through accumulation of glycine betaine in tobacco. Plant Cell Rep. 2008, 27, 1113–1124. [Google Scholar] [CrossRef] [PubMed]
- Surekha, C.; Kumari, K.N.; Aruna, L.V.; Suneetha, G.; Arundhati, A.; Kavi Kishor, P.B. Expression of the Vigna aconitifolia P5CSF129A gene in transgenic pigeonpea enhances proline accumulation and salt tolerance. Plant Cell Tissue Organ Cult. (PCTOC) 2014, 116, 27–36. [Google Scholar] [CrossRef]
- El-Habashy, S. In vitro Evaluation and Selection for Salinity Tolerance in Some Citrus Rootstock Seedlings. J. Hortic. Sci. Ornam. Plants 2018, 10, 17–27. [Google Scholar]
- Shafieizargar, A.; Awang, Y.; Ajamgard, F.; Juraimi, A.S.; Othman, R.; Ahmadi, A.K. Assessing Five Citrus Rootstocks for NaCl Salinity Tolerance Using Mineral Concentrations, Proline and Relative Water Contents as Indicators. Asian J. Plant Sci. 2015, 14, 20–26. [Google Scholar] [CrossRef]
- Ashraf, M.; Foolad, M.R. Roles of Glycine Betaine and Proline in Improving Plant Abiotic Stress Resistance. Environ. Exp. Bot. 2007, 59, 206–216. [Google Scholar] [CrossRef]
- Lv, X.; Chen, S.; Wang, Y. Advances in Understanding the Physiological and Molecular Responses of Sugar Beet to Salt Stress. Front. Plant Sci. 2019, 10, 1431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.; Li, C.; Zhang, B.; Yi, J.; Yang, Y.; Kong, C.; Lei, C.; Gong, M. The Role of the Late Embryogenesis-Abundant (LEA) Protein Family in Development and the Abiotic Stress Response: A Comprehensive Expression Analysis of Potato (Solanum Tuberosum). Genes 2019, 10, 148. [Google Scholar] [CrossRef] [Green Version]
- Hundertmark, M.; Hincha, D.K. LEA (late embryogenesis abundant) proteins and their encoding genes in Arabidopsis thaliana. BMC Genomics. 2008, 9, 118. [Google Scholar] [CrossRef] [Green Version]
- Dalal, M.; Tayal, D.; Chinnusamy, V.; Bansal, K.C. Abiotic stress and ABA-inducible Group 4 LEA from Brassica napus plays a key role in salt and drought tolerance. J. Biotechnol. 2009, 139, 137–145. [Google Scholar] [CrossRef]
- Magwanga, R.O.; Lu, P.; Kirungu, J.N.; Dong, Q.; Hu, Y.; Zhou, Z.; Cai, X.; Wang, X.; Hou, Y.; Wang, K.; et al. Cotton Late Embryogenesis Abundant (LEA2) Genes Promote Root Growth and Confer Drought Stress Tolerance in Transgenic Arabidopsis thaliana. Genes Genomes Genet. 2018, 8, 2781–2803. [Google Scholar] [CrossRef] [Green Version]
- He, S.; Tan, L.; Hu, Z.; Chen, G.; Wang, G.; Hu, T. Molecular characterization and functional analysis by heterologous expression in E. coli under diverse abiotic stresses for OsLEA5, the atypical hydrophobic LEA protein from Oryza sativa L. Mol. Genet. Genom. 2012, 287, 39–54. [Google Scholar] [CrossRef]
- Nylander, M.; Svensson, J.; Palva, E.T.; Welin, B.V. Stress-induced accumulation and tissue-specific localization of dehydrins in Arabidopsis thaliana. Plant Mol. Biol. 2001, 45, 263–279. [Google Scholar] [CrossRef] [PubMed]
- Hara, M.; Terashima, S.; Kuboi, T. Characterization and cryoprotective activity of cold-responsive dehydrin from Citrus unshiu. J. Plant Physiol. 2001, 58, 1333–1339. [Google Scholar] [CrossRef]
- Sivamani, E.; Bahieldin, A.; Wraith, J.M.; Al-Niemi, T.; Dyer, W.E.; Ho, T.D.; Qu, R. Improved biomass productivity and water use efficiency under water deficit conditions in transgenic wheat constitutively expressing the barley HVA1 gene. Plant Sci. 2000, 155, 1–9. [Google Scholar] [CrossRef]
- Jiang, S.Y.; Chi, Y.H.; Wang, J.Z.; Zhou, J.X.; Cheng, Y.S.; Zhang, B.L.; Ma, A.; Vanitha, J.; Ramachandran, S. Sucrose metabolism gene families and their biological functions. Sci. Rep. 2015, 5, 17583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lutfylla, L.L.; Xu, N.; D’Ordine, R.L.; Morrell, J.A.; Miller, P.W.; Duff, S.M. Phylogenetic and expression analysis of sucrose phosphate synthase isozymes in plants. J. Plant Physiol. 2007, 164, 923–933. [Google Scholar]
- Wang, D.; Zhao, J.; Hu, B.; Li, J.; Qin, Y.; Chen, L.; Qin, Y.; Hu, G. Identification and expression profile analysis of the sucrose phosphate synthase gene family in Litchi chinensis Sonn. PeerJ. 2018, 6, e4379. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Zhang, J.; Li, C.; Zhang, Z.; Ma, F.; Li, M. Response of sugar metabolism in apple leaves subjected to short-term drought stress. Plant Physiol. Biochem. 2019, 141, 164–171. [Google Scholar] [CrossRef]
- Duan, Y.; Yang, L.; Zhu, H.; Zhou, J.; Sun, H.; Gong, H. Structure and Expression Analysis of Sucrose Phosphate Synthase, Sucrose Synthase and Invertase Gene Families in Solanum lycopersicum. Int. J. Mol. Sci. 2021, 22, 4698. [Google Scholar] [CrossRef]
- Pitzschke, A.; Datta, S.; Persak, H. Salt stress in Arabidopsis: Lipid transfer protein AZI1 and its control by mitogen-activated protein kinase MPK3. Mol. Plant 2014, 7, 722–738. [Google Scholar] [CrossRef] [Green Version]
- Jülke, S.; Ludwig-Müller, J. Response of Arabidopsis thaliana Roots with Altered Lipid Transfer Protein (LTP) Gene Expression to the Clubroot Disease and Salt Stress. Plants 2016, 5, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, H.W.; Kim, W.; Hwang, B.K. Three pathogen-inducible genes encoding lipid transfer protein from pepper are differentially activated by pathogens, abiotic, and environmental stresses. Plant. Cell Environ. 2003, 26, 915–928. [Google Scholar] [CrossRef] [PubMed]
- Safi, H.; Saibi, W.; Alaoui, M.M.; Hmyene, A.; Masmoudi, K.; Hanin, M.; Brini, F. A wheat lipid transfer protein (TdLTP4) promotes tolerance to abiotic and biotic stress in Arabidopsis thaliana. Plant Physiol. Biochem. 2015, 89, 64–75. [Google Scholar] [CrossRef] [PubMed]
- Bitters, W.P. Citrus Rootstocks: Their characters and reactions. J. Citrus Pathol. 2021, 8, 239. [Google Scholar] [CrossRef]




| Gene Name | Protein Encoded by Targeted Gene | Sequence of Forward Primer (5′-3′) | Sequence of Reverse Primer (5′-3′) | mRNA Origin | Accession Number | Amplified Product Size (bp) |
|---|---|---|---|---|---|---|
| SOS1 | Plasma membrane Na+/H+ antiporter | GCTTTTGGGATTGCATCAGT | GCTTTGCTGACTTTCACCCT | Citrus clementina hort. ex Tanaka. | Ciclev10018329m a | 207 |
| NHX1 | Vacuolar Na+/H+ antiporter | ACACTCAATTGCGGGAAAAC | GCCCTCCTCAAGGAGTGGCT | Citrus sinensis (L.) Osbeck | orange1.1g023195m a | 194 |
| HKT1 | High-affinity K+ transporter/sodium transporter | AAACAATGGCCTCGAAAATG | ACTTGGAGCAAGGCTTGTGT | C. sinensis | orange1.1g045809m a | 160 |
| CCC1 | Cation-chloride co-transporter/Cl− transporter | TAAAGGAAAGGCTGGGGACT | TCTTCATGCAGTTGGCAAAG | C. sinensis | orange1.1g002018m a | 206 |
| APX | Ascorbate peroxidase | TCCATTCGGAACCATGAGGC | TTCTTGAGGTGGCTCAGCCT | C. sinensis | orange1.1g024615m a | 220 |
| CAT | Catalase | TTCCAGAACGTGTTGTCCAT | AAACTTGACCGCAAATCCTC | C. sinensis | orange1.1g042356m a | 203 |
| P5CS | Delta-1-pyrroline-5-carboxylate synthetase | AAGAAAACCCAGCTTGCAGA | CAACATTTTCCGGGATGACT | C. sinensis | orange1.1g005131m a | 220 |
| CMO | Choline monooxygenase | TTGCCCTTATCATGGATGGA | CCCAGCCACTCGTTCGCTAC | C. sinensis | orange1.1g039874m a | 210 |
| LEA2 | Group 2 late embryogenesis abundant protein | GTGATAGCGTCGGGAACAAT | GCCGATGATAGGGAGATCAA | C. sinensis | orange1.1g031863m a | 183 |
| SPS | Sucrose phosphate synthase | CCACAGAGATGCTGACTCCA | TTGCTCCCCTAGAACATTGG | C. clementina | Ciclev10007311m a | 200 |
| LTP | Lipid-transfer protein | CCCTATACCTGTGCCATGCT | CCGGACCTTAGAGCAGTCAG | C. clementina | XM_006429504.2 b | 211 |
| V-PPiase | Tonoplast H+-inorganic pyrophosphatase | GCATACAGCCCTGTGCAAGATG | CCTCCAGCATTGTCACTGATG | C. sinensis | JN580556 b | 241 |
| β- Actin | Actin-depolymerizing factor | TTAACCCCAAGGCCAACAGA | TCCCTCATAGATTGGTACAGTATGAGAC | C. sinensis | Cb250364 b | 128 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Snoussi, H.; Askri, H.; Nacouzi, D.; Ouerghui, I.; Ananga, A.; Najar, A.; El Kayal, W. Comparative Transcriptome Profiling of Salinity-Induced Genes in Citrus Rootstocks with Contrasted Salt Tolerance. Agriculture 2022, 12, 350. https://doi.org/10.3390/agriculture12030350
Snoussi H, Askri H, Nacouzi D, Ouerghui I, Ananga A, Najar A, El Kayal W. Comparative Transcriptome Profiling of Salinity-Induced Genes in Citrus Rootstocks with Contrasted Salt Tolerance. Agriculture. 2022; 12(3):350. https://doi.org/10.3390/agriculture12030350
Chicago/Turabian StyleSnoussi, Hager, Hend Askri, Diana Nacouzi, Imen Ouerghui, Anthony Ananga, Asma Najar, and Walid El Kayal. 2022. "Comparative Transcriptome Profiling of Salinity-Induced Genes in Citrus Rootstocks with Contrasted Salt Tolerance" Agriculture 12, no. 3: 350. https://doi.org/10.3390/agriculture12030350
APA StyleSnoussi, H., Askri, H., Nacouzi, D., Ouerghui, I., Ananga, A., Najar, A., & El Kayal, W. (2022). Comparative Transcriptome Profiling of Salinity-Induced Genes in Citrus Rootstocks with Contrasted Salt Tolerance. Agriculture, 12(3), 350. https://doi.org/10.3390/agriculture12030350

