Diets Fermented with Bacteria and Enzymes in China Improve Growth Performance and Health of Weaned Piglets

Simple Summary

Microbially fermented feed can improve the nutritional value and quality of the feed. Liquid feeding can increase feed intake and reduce the morbidity and mortality of piglets. Therefore, in this study, the integrated technology of a diet fermented with bacterial enzymes and liquid feeding was used to study its effects on the growth performance and intestinal health of weaned piglets. Compared with the control group (standard dry feed, control group), the diet of the liquid feeding group (liquid feeding group with fermented diet) was able to increase palatability, improve nutrient digestibility, and modulate metabolism, resulting in higher feed efficiency and better growth performance. The results of this study provide a reference for the development and utilization of antibiotic-free feed for weaned piglets.

Abstract

Microbial fermentation has been widely used to preserve or improve the nutritional properties of food. Liquid feeding can increase feed intake and reduce the morbidity of piglets. The objective of this study was to evaluate the effects of a diet fermented with bacteria and enzymes and liquid feeding on growth performance, nutrient digestibility, digestive enzyme activity, microflora, and expressions of intestinal development-related genes in weaning pigs. A total of 198 piglets (Duroc × Landrace × Yorkshire) with body weights of 8.70 ± 0.45 kg were assigned to three groups with six replicates per treatment, and 11 weaned piglets per replicate according to the initial body weight and sex. The three dietary treatments (all nonpelleted diets) were a standard dry feed as the control (CON), a control diet supplemented with antibiotics (AB), and a liquid feeding with a fermented diet (LFD). The liquid feeding diet, having the same composition and proportion of each ingredient as the control diet, was prepared by storing the dietary cereals (corn, soybeans, etc.) and water (1:0.5, wt/wt) in a closed tank at 26–30 °C with enzymes and bacteria, and then adding the remaining dietary ingredients immediately before feeding. The whole trial lasted 42 days. On days 11 to 14 and 39 to 42, fresh faecal samples were collected to evaluate the apparent total tract digestibility of nutrients. Performance, digestibility, serum physiochemical parameters, intestinal barrier function, microbiota, and microbial metabolites were measured. The experimental data were subjected to analysis of variance using the GLM procedure of SAS for a complete randomized block design, with a “pen” as the experimental unit. The results showed that the AB increased (p < 0.05) average daily gain and reduced (p < 0.05) feed conversion (F/G) over the course of 1–14 days compared to the control. The liquid feeding group significantly increased (p < 0.05) average daily gain, average daily feed intake, and final body weight compared to the other two dietary groups. The digestibility of crude protein, ether extract, ash, gross energy, Ca, and P also improved in the liquid feeding group. Moreover, the liquid feeding group significantly decreased (p < 0.05) serum urea nitrogen and D-lactate concentrations, as well as the activity of diamine oxidase, and increased (p < 0.05) serum total protein and glucose concentrations on day 14. Furthermore, the liquid feeding group significantly increased (p < 0.05) mRNA expressions of zonula occludens-2 (ZO-2) in the jejunum and zonula occludens-1 (ZO-1), ZO-2, occludin, and claudin-1 in the ileum. In addition, microbiota measurement suggested an increase in Lactobacillus content and a decrease in Escherichia coli with higher (p < 0.05) concentrations of acetic acid, propionic acid, butyric acid, and total volatile fatty acids in the caecal and colonic digesta of piglets in the liquid feeding group. In conclusion, the diet in the liquid feeding group was able to increase palatability, improve nutrient digestibility, and modulate metabolism, which resulted in higher feed efficiency and better growth performance in the piglets.

1. Introduction

China began to ban feed antibiotics in 2020, and there was an urgent need for a new type of antibiotics-free feed in pig production to ensure the growth performance of piglets, improve intestinal health, and alleviate diarrhoea in piglets.

The use of microbial fermentation to conserve or improve the nutritional characteristics of food is not new. For thousands of years, fermented foods and beverages have contributed significantly to the diets of humans and animals. One of the biggest advantages of fermented food is their beneficial effects on gut health. The fermented feed can be divided into solid fermented feed, liquid fermented feed, fermented single feed, fermented mixed feed, single strain fermented feed, multi-strain fermented feed, etc. In the previous study, it was found that fermented feed with compound probiotics and enzyme preparation could promote the growth performance of piglets by improving the digestion, absorption, and intake of nutrients [1]. Using BS12 fermented feed, Zhang et al. found that fermented feed significantly improved ADG and ADFI in piglets, but had no significant effect on feed/gain (F/G) or diarrhoea rate [2]. However, the fermentation process is uncontrollable, and the fermentation effect varies greatly among different batches, which leads to differences in feeding effects and the instability of nutrition levels.

Because the feed form of liquid feeding is similar to that of breast milk, it relieves the stress caused by the abrupt diet of piglets after weaning, and can significantly increase feed intake. Brooks et al. found that, compared to solid feed, the liquid diet could effectively reduce weaning stress, significantly increase ADFI and ADG, and reduce the diarrhoea rate of weaned piglets [3]. Russell and other studies also found that feeding liquid feed after weaning could significantly improve the growth performance of piglets and significantly reduce the diarrhoea rate [4]. In addition, due to the imperfect development of the digestive system, piglets fed solid feed directly after weaning experience damage to their intestinal function and intestinal health. Deprez et al. found that feeding a liquid feed after weaning promoted the development of intestinal morphology, increased the height of intestinal villi, and reduced the depth of the crypt, thus improving the intestinal health of piglets [5]. However, liquid feeding also has disadvantages: (1) hygiene while keeping the feed fresh, which is challenging because microbes are everywhere; (2) difficulty in ensuring the uniformity of feed; (3) the problem of residue and pollution. At present, most of the studies on the effects of liquid feeding on weaned piglets are only related to increasing feed intake and improving growth performance, and there are few studies on the intestinal health of weaned piglets. Studies are needed as to whether liquid feeding can improve the growth performance of weaned piglets and alleviate the dietary stress.

When feed is mixed with water, naturally occurring lactic acid bacteria and yeasts proliferate and produce lactic acid, acetic acid, and ethanol, which reduce the pH of the mixture [6]. This reduction in pH impedes pathogenic organisms from developing in the feed [7]. In addition, when this low-pH mixture is fed to pigs, it reduces the pH in the stomach, preventing the proliferation of pathogens along the GIT [6]. Feed fermentation may be modulated by the inclusion of feed additives, such as carbohydrolitic enzymes and/or prebiotics. Therefore, it is worth further studying the effects of the combination of the two techniques of microbial fermentation and liquid feeding. Because of the instability of liquid fermentation, solid-state fermentation feed combined with liquid feeding was used to explore its effects on the growth performance and intestinal health of weaned piglets. In this context, the present study was designed to investigate whether the fermentation strategy with liquid feeding can improve the growth performance of piglets and maintain the beneficial effects on gastrointestinal ecology.

2. Materials and Methods

The animals were raised on commercial farms according to standard practices. Chemical analyses were carried out in the laboratory of Sichuan Agricultural University. The Ethical Commission of Sichuan Agricultural University approved the experimental protocol (SAU20200106), and the animals were handled and killed humanely following the guidelines established by this commission.

2.1. Experimental Design and Animal Management

A total of 198 (24 ± 1 days) piglets (Duroc × Landrace × Yorkshire), half male and half female, with body weights (BW) of 8.70 ± 0.45 kg were randomly allotted into three treatments with six repetitions (pens) according to their initial body weight and sex, with 11 piglets per pen (4.0 × 3.0 m). Piglets were assigned to the control group (standard dry feed, CON), the antibiotic group (fed a dry basic diet with 75 mg/kg chlorotetracycline and 50 mg/kg kitasamycin, AB), and the fermentation group (liquid feeding of fermented diet, LFD). The experiment period was 42 days.

All weaned piglets were fed diets four times per day at 0800, 1200, 1600, and 2000 h. Water was provided ad libitum to the weaned piglets. The results of growth performance, such as average daily gain (ADG), average daily feed intake (ADFI), and feed conversion (F/G) were calculated. All pigs were checked daily for general health and diarrhoea during the experimental period. The occurrence of diarrhoea was recorded every day by the same person. The incidence of diarrhoea was calculated as follows: Diarrhoea incidence (%) = (total number of pigs per pen with diarrhoea)/(number of pigs per pen × test period) × 100.

2.2. Experimental Diet

The basal diet was formulated to meet or exceed the nutrient requirements recommended by the National Research Council (2012) [8]. The ingredients and nutrient compositions of the basal diet are presented in

Table 1. Diet composition and chemical composition. (air-dried basis, %).

Items	Days 1–14	Days 15–42
Raw materials composition
Extruded corn	18.48	30.28
Corn	29.16	30.01
Soy protein concentrate	10.00	4.00
Low-protein whey powder	10.00	4.00
Whey protein concentrate	4.00	0.00
Extruded soybean	4.00	10.00
Soybean meal	5.00	10.00
Soybean oil	0.00	1.80
Coconut oil	4.00	0.00
Fish meal	5.00	4.00
Sucrose	3.00	2.00
Glucose	5.00	1.00
NaCl	0.40	0.40
Chloride choline	0.12	0.12
Limestone	0.70	0.86
Dicalcium phosphate	0.42	0.52
Vitamin premix 1	0.10	0.05
Mineral premix 2	0.20	0.20
L-Lys·HCl	0.20	0.50
L-Thr	0.10	0.13
DL-Met	0.10	0.10
D-Trp	0.02	0.03
Total	100.00	100.00
Nutrition level
DE, MCal/Kg	3.62	3.54
CP, %	20.73	19.58
Ca, %	0.80	0.81
TP, %	0.58	0.59
AP, %	0.40	0.41
D-Lys, %	1.37	1.37
D-Met, %	0.44	0.48
D-Cys, %	0.31	0.26
D-Met+Cys, %	0.75	0.75
D-Thr, %	0.90	0.80
D-Trp, %	0.29	0.23

¹ The premix provides the following per kg diet: VA 9000 IU; VD3 3000 IU; VE 20.0 IU; VK3 3.0 mg; VB1 1.5 mg; VB2 4.0 mg; VB6 3.0 mg; VB12 0.2 mg; nicotinic acid 30.0 mg; D-pantothenic acid 15.0 mg; folic acid 0.75 mg; biotin 0.1 mg; ² The premix provides the following per kg per diet: Fe 100.0 mg; Cu 6.0 mg; Zn 100.0 mg; Mn 4.0 mg; I 0.14 mg; Se 0.3 mg.

.

The composition and proportion of each ingredient of the fermented diet were consistent with the basal diet. Briefly, mixtures of the fermentation substrate were composed of expanded maize, maize, soybean meal, expanded soybean, sucrose, and oil. Then the mixed substrates were mixed with water at a ratio of 1:0.5 (wt/wt); enzymes (protease 16,000 U/kg, amylase 24,000 U/kg, lipase 80,000 U/kg, Yiduoli Co., Ltd., Guandong, China; phytase 5000 U/kg, ROVABIO, ADISSEO Co., France) were added and fermented with Pediococcus pentosaceus (CGMCC1.12961), Lactobacillus plantarum (CGMCC1.12934), and Aspergillus niger (CGMCC3.4304) obtained from the China General Microbiological Culture Collection Centre (Beijing, China) in a sealed fermentation vat at 26–30 °C for 24 h. After fermentation, the range of pH (CON, 6.13–6.21, LFD, 4.12–4.46), the range of lactic acid content (CON, 5.15–11.69, LFD, 45.90–69.16, mmol/kg), and the range of acid-soluble protein content (CON, 1.25–1.31, LFD, 2.66–3.17, %) were measured. The composition of the fermented diet was consistent with fermented feed and unfermented ingredients. The fermented substrate was added water (feed/water ratio 1:0.5), then enzymes and the strains, and finally fermented. After fermentation, the unfermented ingredients and the fermented feed were mixed evenly. Then, the fermented diet was mixed with 2 L of water per kg of feed. Therefore, the feed–water ratio of the LFD group was 1:2.5. The CON and AB feed were in dry form. In addition, water was provided ad libitum to all weaned piglets.

3. Sample Collections

3.1. Feed Sample Collection

After the preparation of the test diet, 500 g of basic diet was collected in a sample bag in strict accordance with the principle of quartering sampling, then sealed and stored at −20 °C. For fermented feed, 50–100 g were taken per day and analysed for routine nutrient determination of the feed.

3.2. Faecal Sample Collection

Fresh faecal samples were collected immediately after defecation and then placed in individual plastic bags from days 11 to 14 and from days 39 to 42 during the trial. After each collection of faeces, 10 mL of a 10% H₂SO₄ solution was added to each 100 g of wet faecal sample for fixation of excreta nitrogen. All feed and faecal samples were stored at −20 °C until analysis was performed.

3.3. Blood Sample Collection

On the 15th and 43rd day of the experiment, prior to the morning feeding and following overnight fasting, two weaned pigs with the average body weight in each pen were chosen and bled for 10 mL. Blood samples were collected from the precaval vein into nonheparinised vacuum tubes. For example, after centrifugation (3500× g for 15 min at 4 °C), serum samples were collected and stored at −20 °C for serum parameter analysis.

3.4. Tissue Sample Collection

On the 44th day of the experiment, one piglet weighing close to the average body weight from each repeat was euthanized with an intravenous injection of pentobarbital sodium (200 mg/kg BW) and then slaughtered by exsanguination protocols approved by the Sichuan Agricultural University Animal Care Advisory Committee. The abdomen was immediately opened to take out the small intestine, which was then cut into three segments—duodenum, jejunum, and ileum—according to the description presented in our previous study by Zheng et al. [9]. The jejunum and ileum were emptied, carefully flushed with saline, and placed on an ice-cold surface; the mucosa of the jejunum and ileum were scraped with a glass slide and then snap-frozen in liquid nitrogen and stored at −80 °C for the determination of the gene expression of tight junction proteins. Additionally, the digesta from the middle caecum and middle colon was collected and stored at −80 °C for measurement of microbial flora and volatile fatty acids.

4. Chemical Analysis

4.1. Measurement of Apparent Digestibility of Nutrients

Faeces from days 11–14 and days 39–42 from each pen were mixed thoroughly and dried at 65 °C for 72 h, after which they were ground to pass through a 40-mesh screen. The apparent total tract digestibility (ATTD) of the nutrients was measured using acid insoluble ash (AIA) as a digestibility indicator. The AIA in the diet and faecal samples was determined by a method described by the Chinese National Standard (GB/T 23742). All samples were analysed for dry matter (DM), crude protein (CP), ether extract (EE), and ash. Gross energy was determined using an automatic adiabatic bomb calorimeter (Parr Instrument Co., Moline, IL, USA).

4.2. Measurement of Serum Indexes

Serum total protein (TP), albumin (ALB), glucose (GLU), urea nitrogen (UN), alanine transaminase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) were assayed using an automatic biochemical instrument (Biochemical Analytical Instrument, Beckman CX4, Beckman Coulter Inc., Brea, CA, USA). Serum diamine oxidase (DAO), D-lactate (D-LA), IGF-1, cortisol, tumour necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-10 (IL-10), immunoglobulin A (IgA), immunoglobulin M (IgM), and immunoglobulin G (IgG) were assayed using commercially available porcine-specific ELISA kits (Beijing Chenglin Biotechnology Co., Ltd., China).

4.3. Measurement of Antioxidant Indexes of the Jejunum

Total antioxidant capacity (T-AOC), catalase (CAT), glutathione peroxidase (GPx), superoxide dismutase (SOD) activities, as well as malondialdehyde (MDA) in serum and jejunal mucosa, were determined through enzymatic colorimetric methods according to commercial SOD, GPx, CAT, and MDA assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

4.4. Measurement of Intestinal Permeability

Serum DAO activity and D-lactic acid content were measured with an ELISA kit (Beijing Chenglin Biotechnology Co., Ltd., China) in accordance with the kit instructions.

4.5. Microbial Metabolites Analysis

The volatile fatty acid of caecal and colonic digesta samples was analysed in duplicate by gas–liquid chromatography (VARIAN CP-3800, USA) according to the method described by Luo et al. [10].

4.6. Gene Expression in Intestinal Mucosa

Total RNA was extracted from jejunal mucosa using TRIzol reagent (TaKaRa, Dalian, China). Meanwhile, the concentration and purity of total RNA were assayed by a spectrophotometer (NanoDrop, Gene Company Limited, Guangzhou, China) at 260 and 280 nm following the manufacturer’s guidelines. Reverse transcription using the Prime Script RT reagent kit (TaKaRa, Dalian, China) was carried out following the manufacturer’s instructions. Specific primers for zonula occludens-1 (ZO-1), zonula occludens-2 (ZO-2), occludin (OCLN), and claudin-1 (CLDN-1) were designed and purchased from Invitrogen (Shanghai, China); these are listed in

Table 2. Primer Sequences for RT-PCR.

Items 1	Primer and Probe Sequences (5′-3′) 2	Annealing Temperature (°C)	Product Length
β-actin	F: TCCATCGTCCACCGCAAATG R: TTCAGGAGGCTGGCATGAGG	57.0	114
ZO-1	F: CAGCCCCCGTACATGGAGA R: GCGCAGACGGTGTTCATAGTT	60.0	114
ZO-2	F: ATTCGGACCCATAGCAGACATAG R:GCGTCTCTTGGTTCTGTTTTAGC	60.0	110
OCLN	F: CTACTCGTCCAACGGGAAAG R: ACGCCTCCAAGTTACCACTG	62.0	158
CLDN-1	F: TCTTAGTTGCCACAGCATGG R: CCAGTGAAGAGAGCCTGACC	60.0	114

¹ZO-1 = zonula occludens-1, ZO-2 = zonula occludens-2, OCLN = occludin, CLDN-1= claudin-1. ² F = forward primer; R = reverse primer.

. The real-time PCR reactions were performed on a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using SYBR Green PCR reagents (TaKaRa, Dalian, China). A melting curve analysis was generated, following each real-time quantitative PCR assay, to check and verify the specificity and purity of all PCR products. The housekeeping gene β-actin was used as an internal control for normalization. The target gene mRNA expression level was calculated using the 2^−ΔΔCt method.

4.7. DNA Extraction and Quantification of Intestinal Microflora

Microbial genomic DNA in the caecal and colonic digesta was extracted using the EZNA Stool DNA kit (Omega Bio-Tek, Doraville, CA, USA) in accordance with the manufacturer’s instructions. The fluorescent quantitative primers and probes (

Table 3. Primer sequences and probes of caecal and colonic digesta used for real-time PCR.

Items	Primer and Probe Sequences (5′-3′) 1	Annealing Temperature (°C)	Product Length
Total bacteria	F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG	60	200
Lactobacillus spp.	F: ACTCCTACGGGAGGCAGCAG R: CAACAGTTACTCTGACACCCGTTCTTC P:AAGAAGGGTTTCGGCTCGTAAAACTCTGTT	57.5	126
Escherichia coli	F: CATGCCGCGTGTATGAAGAA R: CGGGTAACGTCAATGAGCAAA P: AGGTATTAACTTTACTCCCTTCCTC	59.0	96

¹ F = forward primer; R = reverse primer; P = probe.

) for total bacteria, Escherichia coli, and Lactobacillus were commercially synthesized by Invitrogen (Shanghai, China).

Quantitative real-time PCR was performed with a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). For the quantification of Lactobacillus and Escherichia coli, real-time PCR was conducted in a volume of 20 μL, whereas total bacteria were run in a volume of 25 μL. Copies per sample were calculated with the threshold cycle (CT) values and the standard curve from the previous work by Qi et al. [11].

4.8. Calculation and Statistical Analysis

The ATTD of the nutrients was calculated using the following formula: ATTD (%) = {1 − [(A1 × F2)/(A2 × F1)] × 100, where A1 = AIA content in diet (% DM), A2 = AIA content in faeces (% DM), F1 = nutrient content in diet (% DM), and F2 = nutrient content of faeces (% DM).

Animal performance, nutrient digestibility, the determination of antioxidant enzyme activity in serum and jejunum mucosa gene expression, microbial counts, and VFA data were subjected to analysis of variance using the GLM procedure of SAS for a complete randomized block design, with “pen” as the experimental unit (N = 6). Data were expressed as a mean with the standard error.

5. Results

5.1. Growth Performance

The results of growth performance and diarrhoea incidence are shown in

Table 4. Effects of liquid feeding of fermented diet on growth performance and diarrhoea of weaned piglets ¹.

Items 5	CON 2	AB 3	LFD 4	SEM	p-Value
Initial body weight, kg	8.70	8.69	8.71	0.45	1.000
14d body weight, kg	10.34	10.83	11.04	0.55	0.657
28d body weight, kg	14.71	15.78	17.27	0.86	0.139
42d body weight, kg	23.02 b	24.21 b	27.78 a	1.14	0.026
Days 1–14
ADG, g	117.35 b	152.88 a	166.53 a	9.65	0.007
ADFI, g	252.48 b	276.50 ab	302.91 a	9.86	0.009
F/G	2.22 a	1.83 b	1.84 b	0.12	0.061
Diarrhoea rate, %	11.04	8.81	9.63	0.88	0.230
Days 15–28
ADG, g	312.21 b	353.44 b	445.47 a	26.84	0.010
ADFI, g	527.68 b	587.90 ab	652.08 a	35.64	0.078
F/G	1.70 a	1.68 a	1.47 b	0.05	0.013
Diarrhoea rate, %	9.72	5.89	6.39	1.62	0.225
Days 29–42
ADG, g	593.78 b	602.49 b	750.34 a	27.31	0.002
ADFI, g	839.44 b	902.95 b	1101.86 a	39.45	0.001
F/G	1.42	1.50	1.47	0.04	0.491
Diarrhoea rate, %	8.34	5.69	4.55	1.31	0.143
Days 1–28
ADG, g	214.78 b	253.16 b	306.00 a	16.72	0.006
ADFI, g	390.08 b	432.21 ab	477.49 a	22.04	0.042
F/G	1.82 a	1.72 a	1.57 b	0.04	0.001
Diarrhoea rate, %	10.38	7.35	8.01	1.09	0.155
Days 1–42
ADG, g	341.11 b	369.60 b	454.11 a	18.76	0.002
ADFI, g	539.87 b	589.12 b	685.61 a	27.15	0.006
F/G	1.59	1.59	1.51	0.03	0.192
Diarrhoea rate, %	9.70	6.80	6.85	1.07	0.123

^a,b Indicates statistical significance (p < 0.05) in a row between the three treatments; ¹ n = 6 for CON, AB and LFD groups; ² CON = standard dry feed (control group); ³ AB = CON + Antibiotics group; ⁴ LFD = liquid feeding with fermented diet group; ⁵ BW = body weight, ADG = average daily gain; ADFI = average daily feed intake; F/G = feed to gain ratio (feed efficiency).

. Compared to the CON group, AB increased (p < 0.05) ADG and reduced (p < 0.05) F/G for days 1–14. LFD increased (p < 0.05) BW at day 43 and ADG and ADFI for days 1–14, days 15–28, days 29–42, days 1–28, and days 1–42, but reduced (p < 0.05) F/G for days 15–28.

Compared to the AB group, the LFD increased (p < 0.05) the ADG and ADFI for days 29–42 and days 1–42, and the ADG at days 1–28 and days 15–28, but reduced (p < 0.05) F/G for days 15–28 and days 1–28 compared to the AB group.

The diarrhoea rate of piglets in the CON group was numerically higher than that of the other two groups. There was no significant difference among the three groups.

5.2. Nutrient Digestibility

The ATTD results are summarized in

Table 5. Effects of liquid feeding of fermented diet on the apparent total tract digestibility (ATTD) of nutrients in weaned piglets ¹.

Items, % 5	CON 2	AB 3	LFD 4	SEM	p-Value
Days 1–14
DM	83.60	82.93	83.05	0.40	00.466
CP	74.99 b	74.33 b	80.72 a	0.75	<0.0001
EE	60.00 b	59.90 b	68.81 a	1.50	0.001
Ash	50.05 b	48.84 b	59.11 a	1.72	0.001
CF	32.92 a	26.30 b	38.92 a	1.99	0.002
GE	83.25 b	82.78 b	86.92 a	0.36	<0.0001
Ca	47.36 b	45.12 b	64.94 a	2.36	<0.0001
P	35.96 b	34.82 b	65.32 a	2.69	<0.0001
Days 15–42
DM	80.24 b	81.79 a	82.36 a	0.41	0.007
CP	71.92c	75.44 b	84.40 a	0.66	<0.0001
EE	68.66 b	70.45 b	74.61 a	0.74	0.000
Ash	41.35 b	43.53 b	61.78 a	1.36	<0.0001
CF	34.66 b	40.71 ab	45.24 a	2.36	0.021
GE	80.68c	82.24 b	87.81 a	0.42	<0.0001
Ca	45.63 b	43.20 b	64.96 a	1.36	<0.0001
P	31.08c	38.32 b	75.54 a	2.07	<0.0001

^a,b Indicates statistical significance (p < 0.05) in a row between the three treatments; ¹ n = 6 for CON, AB and LFD groups; ² CON = standard dry feed (control group); ³ AB = CON + Antibiotics group; ⁴ LFD = liquid feeding with fermented diet group; ⁵ DM = dry matter; CP = crude protein; EE = ether extract (fat); CF = crude fibre; GE = gross energy; Ca = calcium; P = phosphorus.

. Compared to the CON group, the AB improved (p < 0.05) the ATTD of dry matter, crude protein, phosphorus, and total energy for days 15–42 and reduced (p < 0.05) the ATTD of crude fibre for days 1–14. The LFD improved (p < 0.05) the ATTD of crude protein, crude fat, crude ash, total energy, calcium, and phosphorus at each stage, and dry matter and crude fibre for days 15–42.

Compared to the AB group, LFD improved (p < 0.05) the ATTD of crude protein, crude fat, crude ash, total energy, calcium, phosphorus, and crude fibre at 1–14 days, and crude protein, crude fat, crude ash, total energy, calcium, and phosphorus at 15–42 days.

5.3. Physiochemical Parameters in Serum

As shown in

Table 6. Effects of liquid feeding of fermented diet on serum biochemical indices of weaned piglets ¹.

Items 5	CON 2	AB 3	LFD 4	SEM	p-Value
Day 14
TP, g/L	45.55 b	48.38 a	48.56 a	0.86	0.046
ALB, g/L	30.50	31.50	31.98	0.63	0.269
GLU, mmol/L	4.44 b	5.72 a	6.02 a	0.34	0.011
UN, mmol/L	3.51 a	3.03 ab	2.03 b	0.37	0.034
ALT, U/mL	28.93 ab	25.17 b	33.34 a	2.17	0.055
AST, U/mL	23.77 ab	20.55 b	26.55 a	1.47	0.036
ALP, U/mL	42.08	36.14	42.79	2.32	0.117
IGF-1, µg/L	8.56	9.08	9.08	0.34	0.475
Cortisol, µg/L	148.64	144.14	132.68	6.38	0.223
Day 42
TP, g/L	52.50	54.67	55.07	1.27	0.334
ALB, g/L	32.40	33.85	35.85	1.52	0.301
GLU, mmol/L	4.61	5.40	5.14	0.35	0.294
UN, mmol/L	2.94 a	2.87 a	2.24 b	0.19	0.037
ALT, U/mL	36.28	35.61	44.23	3.26	0.149
AST, U/mL	29.01	27.98	32.34	2.02	0.309
ALP, U/mL	39.77	34.11	40.38	2.18	0.114
IGF-1, µg/L	12.03	12.46	13.49	0.74	0.380
Cortisol, µg/L	175.31	169.24	168.96	9.11	0.858

^a,b Indicates statistical significance (p < 0.05) in a row between the three treatments; ¹ n = 6 for CON, AB and LFD groups; ² CON = standard dry feed (control group); ³ AB = CON + Antibiotics group; ⁴ LFD = liquid feeding with fermented diet group; ⁵ TP = total protein; ALB = albumin; UN = urea nitrogen; GLU = glucose; ALT = alanine transaminase; AST = aspartate aminotransferase; ALP = alkaline phosphatase; IGF = insulin-like growth factor.

, compared to the CON group, serum TP and GLU concentrations of the piglets in the AB group and in the LFD group were increased (p < 0.05) on day 14, while UN concentration was reduced (p < 0.05) on day 14 and day 42 in the LFD group.

5.4. Antioxidant Capacity

The effects of LFD on serum antioxidant indices of weaned piglets are shown in

Table 7. Effects of liquid feeding of fermented diet on serum antioxidant indices of weaned piglets ¹.

Items 5	CON 2	AB 3	LFD 4	SEM	p-Value
Day 14
T-AOC, U/mL	2.08 b	2.56 ab	2.93 a	0.21	0.034
CAT, U/mL	8.60	12.25	12.46	1.19	0.064
GPx, U/mL	420.67 b	512.06 ab	529.01 a	33.97	0.084
SOD, U/mL	153.59 b	200.79 a	173.95 ab	10.25	0.018
MDA, nmol /mL	2.93 a	2.65 ab	2.47 b	0.14	0.087
Day 42
T-AOC, U/mL	1.80 b	2.00 b	2.50 a	0.14	0.009
CAT, U/mL	5.71	5.76	7.08	0.55	0.175
GPx, U/mL	467.48 b	574.20 a	602.00 a	25.21	0.005
SOD, U/mL	242.47	239.08	236.48	10.32	0.919
MDA, nmol /mL	2.94	2.95	2.83	0.21	0.899

^a,b Indicates statistical significance (p < 0.05) in a row between the three treatments; ¹ n = 6 for CON, AB and LFD groups; ² CON = standard dry feed (control group); ³ AB = CON + Antibiotics group; ⁴ LFD = liquid feeding with fermented diet group; ⁵ T-AOC = total antioxidant capacity; CAT = catalase; GPx = glutathione peroxidase; SOD = superoxide dismutase; MDA = malondialdehyde.

. The activities of SOD on day 14 and GPx on day 42 in the serum were increased (p < 0.05) in the AB group compared to the CON group. The LFD group increased (p < 0.05) the serum T-AOC level and GPx activity on day 14 and day 42, and reduced (p < 0.05) the serum MDA concentration on day 14. Compared to the AB group, the serum T-AOC level was increased (p < 0.05) on day 42 in the LFD group.

The LFD group increased (p < 0.05) CAT activity in jejunal mucosa compared to the CON group and the AB group, and reduced (p < 0.05) the SOD activity compared to the AB group (

Table 8. Effects of liquid feeding of fermented diet on antioxidant indices in jejunal mucosa of weaned piglets ¹.

Items 5	CON 2	AB 3	LFD 4	SEM	p-Value
T-AOC, U/mg prot	0.64	0.59	0.74	0.09	0.495
CAT, U/mg prot	10.23 b	9.63 b	14.08 a	0.90	0.006
GPx, U/mg prot	46.65	51.00	42.30	3.14	0.182
SOD, U/mg prot	13.31 ab	14.35 a	11.91 b	0.74	0.097
MDA, nmol/mg prot	0.50	0.58	0.43	0.08	0.445

^a,b Indicates statistical significance (p < 0.05) in a row between the three treatments; ¹ n = 6 for CON, AB and LFD groups; ² CON = standard dry feed (control group); ³ AB = CON + Antibiotics group; ⁴ LFD = liquid feeding with fermented diet group; ⁵ T-AOC = total antioxidant capacity; CAT = catalase; GPx = glutathione peroxidase; SOD = superoxide dismutase; MDA = malondialdehyde.

).

5.5. Serum Immune Index

The effects of liquid feeding of fermented diet on the serum immune index of weaned piglets are shown in Figure 1.

The concentrations of IgM on day 42 (23.49 vs. 22.39, µg/mL) in the serum were increased (p < 0.05), and the serum concentrations of IL-10 on day 14 (115.09 vs. 116.38, ng/L) and IL-6 on day 42 (362.50 vs. 436.30, ng/L) were reduced (p < 0.05) in the AB group, compared to the CON group.

The LFD group increased (p < 0.05) serum IL-10 concentration on day 14 (127.12 vs. 116.38, ng/L) and day 42 (142.18 vs. 111.47, ng/L), increased (p < 0.05) the concentration of IgA on day 14 (28.96 vs. 25.92, µg/mL) and IgM on day 42 (27.51 vs. 22.39, µg/mL), and reduced (p < 0.05) IL-6 on day 14 (282.86 vs. 347.02, ng/L) and day 42 (379.38 vs. 436.30, ng/L), compared to the CON group.

5.6. DAO Activity and D-Lactate Concentration

Compared to the CON group, the LFD decreased (p < 0.05) D-lactate concentration and the activity of diamine oxidase on day 14 (D-LA, 712.72 vs. 841.22, μg/L; DAO, 156.50 vs. 175.79, IU /L) and day 42 (D-LA, 681.76 vs. 800.77, μg/L; DAO, 157.31 vs. 174.85, IU/L) in the serum of weaned pigs (Figure 2).

5.7. Gene Expression of Tight Junction Proteins

The mRNA expression levels of tight junction proteins in the jejunal and ileal mucosa of weaned pigs are shown in Figure 3.

Compared to the CON group, the relative mRNA expressions of ZO-2 (1.97 vs. 1.00) in the jejunal mucosa and ZO-1 (3.35 vs. 1.00), ZO-2 (2.36 vs. 1.00), OCLN (2.29 vs. 1.00), and CLDN-1 (2.64 vs. 1.00) in the ileal mucosa were upregulated (p < 0.05) in the LFD group. Compared to the AB group, the relative expressions of ZO-2 (1.97 vs. 1.18) in the jejunal mucosa and ZO-2 (2.36 vs. 0.95), OCLN (2.29 vs. 0.95), and CLDN-1 (2.64 vs. 1.39) in the ileal mucosa were increased (p < 0.05) in the LFD group.

5.8. Intestinal Microbiota

The microbiota composition of the digesta is presented in Figure 4.

Compared with the CON group, LFD increased (p < 0.05) the number of Lactobacillus spp. in the caecal digesta (5.29 vs. 4.61, log cfu/g) and reduced (p < 0.05) the number of Escherichia coli in the caecal (7.62 vs. 9.39, log cfu/g) and colonic digesta (7.70 vs. 9.59, log cfu/g).

Compared to the AB group, the LFD increased (p < 0.05) the number of Lactobacillus spp. in the caecal digesta (5.29 vs. 4.76, log cfu/g) and reduced (p < 0.05) the number of Escherichia coli in the caecal (7.62 vs. 9.35, log cfu/g) and colonic digesta (7.70 vs. 9.45, log cfu/g).

5.9. Microbial Metabolites

The VFAs in the caecal and colonic digesta were measured (Figure 5). Compared to the CON group, theLFD significantly increased (p < 0.05) the AA, PA, BA, and TVFA concentrations in the caecal digesta (AA, 30.93 vs. 22.13, μmol/g; PA, 12.35 vs. 7.58, μmol/g; BA, 5.79 vs. 2.78, μmol/g; TVFA, 49.86 vs. 33.65, μmol/g), and colonic digesta (AA, 31.79 vs. 21.10, μmol/g; PA, 12.51 vs. 7.50, μmol/g; BA, 5.76 vs. 3.00, μmol/g; TVFA 51.30 vs. 33.26, μmol/g).

Compared to the AB group, the LFD significantly increased (p < 0.05) the AA, PA, BA, and TVFA concentrations in the caecal digesta (AA, 30.93 vs. 21.68, μmol/g; PA, 12.35 vs. 8.06, μmol/g; BA, 5.79 vs. 3.14, μmol/g; TVFA, 49.86 vs. 34.51, μmol/g) and colonic digesta (AA, 31.79 vs. 22.40, μmol/g; PA, 12.51 vs. 8.30, μmol/g; BA, 5.76 vs. 3.46, μmol/g; TVFA 51.30 vs. 36.06, μmol/g).

6. Discussion

6.1. Growth Performance

The results from the present study showed that the combination and addition of digestive enzymes and bacteria fermentation with liquid feeding improved the BW, ADG, ADFI, and FCR of weaned piglets. The performance results from the present study are superior to those gathered in the meta-analysis by Xu et al. [12], where an ADG improvement of 20.9 g/d was reported for weaned piglets fed liquid fermented feed, compared to the 113 g/d observed in the present experiment. The possible mechanism by which LFD improves the performance of piglets is as follows: (1) LFD improves feed digestibility. On the one hand, fermentation promotes protein digestibility, increases the ratio of small-to-large peptides, and reduces the content of anti-nutritional factors, such as trypsin and protein inhibitors [2,13,14,15,16,17]. On the other hand, fermentation increases short-chain fatty acid levels and starch digestibility while reducing the content of fibre, non-starch polysaccharides, and anti-nutritional factors [18,19,20]. These beneficial effects may have been further enhanced by the co-addition of exogenous enzymes to the fermentation substrate. On the contrary, the use of antibiotics in the present study did not seem to improve nutrient digestibility, which is supported by the results presented by Waititu et al. [21] after testing Aureomycin and tiamulin on weaned piglets. (2) Liquid feeding increases feed palatability, as suggested by increased feed intake, which has been previously reported by Jiang et al. [22] and Canibe et al. [23].

Therefore, the present results suggest the success of a feeding strategy that considers a combination approach of (1) fermented feed additives with functional features and (2) fermented feed ingredients, which reduce the content of dietary anti-nutritional factors and improve feed efficiency as a result [24,25,26,27].

6.2. Intestinal Barrier Function, Antioxidant Capacity, and Immune Function

Fermented liquid feed improves piglet health by affecting gut health. It mainly includes three aspects: (1) enhancing the intestinal barrier function, (2) enhancing the body’s antioxidant capacity, and (3) enhancing the body’s immunity.

First, the intestinal barrier is mainly formed by a layer of epithelial cells associated with tight junctions, as well as the primary digestive and absorptive sites of nutrients. Therefore, the integrity of the intestinal barrier is fundamental to the proper functioning of the epithelial cells and to preventing the entry of pathogenic bacteria that cause inflammation [28,29]. However, the stress associated with early weaning in pigs leads to impaired mucosal barrier function and increased intestinal permeability [30,31,32]. Tight junction proteins are the principal determinants of endothelial and epithelial paracellular barrier functions [33,34]. Tight junction proteins, such as OCLN, ZO-1 and ZO-2, play a critical role in maintaining intestinal barrier integrity, which efficiently prevents the paracellular diffusion of intestinal bacteria and other antigens across the epithelium [35]. Our present study showed that liquid feeding increased the mRNA expression of tight-junction proteins in weaned piglets during the early weaning period. These results were consistent with the previous study by Wijtten et al. [30], which reported that adequate FI levels after weaning prevented the loss of intestinal tight protein junctions.

The measurement of intestinal permeability by testing the plasma concentrations of diamine oxidase activity and D-lactate was a reliable, standard method to investigate the function of the intestinal mucosa barrier [36,37]. When intestinal epithelial cells are injured, the adhesion of leukocytes and damage to intestinal endotheliocytes increase the concentration of D-lactate and the activity of diamine oxidase [38,39]. In the present study, liquid feeding reduced intestinal permeability by lowering the serum activity of diamine oxidase and the concentration of D-lactate during the early weaning period. These results were in line with the previous report by Spreeuwenberg et al. [40], which showed that intestinal barrier permeability was compromised in weaned pigs with low FIs at weaning, and that higher FIs could improve intestinal barrier permeability. The improved intestinal mucosa permeability was associated with low diarrhoea incidence, increased nutrient absorption, and a lower cost of immunity, thus resulting in an improved postweaning growth rate [41,42]. Liquid feeding has been reported to decrease diarrhoea incidence in weanling pigs and improve intestinal health [3], which was consistent with our results. Therefore, the upregulation of tight-junction proteins and improved intestinal mucosa permeability were associated with decreased diarrhoea rate and cortisol levels, which subsequently improved the ADG and intestinal health of weaned pigs.

In this experiment, we assessed other generally accepted biomarkers of gut integrity and intestinal barrier permeability, such as DAO and D-LA in serum, and the relative expression of tight junction-related genes in jejunal and ileal mucosa. The observed reduction in serum DAO and D-LA concentrations, as well as the upregulation of genes coding for the main families of tight-junction proteins (claudins, occludins, and zonulae occludens) in the jejunal and/or ileal mucosa of the LFD-fed pigs, suggested improved gut integrity, which has already been observed after feeding fermented feed to pigs. The improved gut integrity could result in a better digestive and absorptive capacity, which contributes to the increased nutrient digestibility of these pigs, and which may have partially contributed to their better growth performance. The effects on the microbial composition and fermentation profiles described above were not detected in the pigs that were fed the AB treatment, which is in contrast with the results obtained by Schokker et al. [43] when investigating the effects of early-life exposure to antibiotics on the diversity of the gut microbiota.

Secondly, feeding fermented feed has also been reported to have pharmacodynamic properties and beneficial effects on the oxidative stress status of pigs [14,44,45]. The latter statement is supported by the effect of the LFD treatment on the levels of several oxidative stress biomarkers in the serum and/or jejunal mucosa observed in the present study. The increased catalase, glutathione peroxidase, and superoxide dismutase activities, as well as the total antioxidant capacity in the serum and/or jejunal mucosa after feeding the LFD for 14 and/or 42 days, together with the reduced levels of malondialdehyde in the serum of these pigs, indicate that the LFD treatment improved the oxidative stress status of these pigs.

Thirdly, immune function has also been reported to be influenced by feed fermentation, as indicated by an increase in both immunoglobulin and cytokine release induced by fermented feed fed to pigs [44,46]. The release of such molecules is a sign of an anti-inflammatory response triggered by the immune system. In the present study, several immunity-related biomarkers were positively influenced by the LFD treatment. This immunomodulation could be associated with the promotion of a well-balanced gut microbiota observed in this group of pigs, as a proper gut microbiota composition can stimulate the immune system in an anti-inflammatory manner [47]. Physiological or psychological stresses caused by the weaning process can compromise the gut microbiota and result in intestinal dysfunction. Probiotics are the most widely used strategy in such situations to restore the gut microbial balance [47]. The results from this study suggest that feeding liquid feed fermented with a combination of exogenous enzymes and bacteria may be a suitable strategy to promote a well-balanced gut microbiota and boost the immune system of weaned pigs.

6.3. Intestinal Microflora and Microbial Metabolites

Fermented feed may also affect performance by improving the intestinal microbiota and metabolic efficiency of the pigs. In this regard, feed fermentation could result in decreased pH of the feed, which may help inhibit the growth of harmful microorganisms and sustain intestinal microbial balance, as suggested by the shift in the balance between Lactobacillus spp. and Escherichia coli in the caecal digesta (in favour of Lactobacillus spp.) that was promoted by the LFD treatment. This is in line with previous results reported by Plumed-Ferrer and von Wright [48]. Reduced concentrations of coliforms and Escherichia coli in the digesta after feeding pigs with fermented liquid feed have also been reported by Kim et al. [25]. The authors associated this microbial change with a reduction of diarrhoea incidence, which decreased by 29.38% in the present trial. Changes in gut microbiota composition have been previously correlated with changes in the production of beneficial volatile fatty acids after feeding fermented feed to pigs [16]. This agrees with the increased concentrations of TVFA, PA, BA, and AA observed in the caecal and colonic digesta of the LFD-fed piglets. The latter authors associated this change in the fermentation profile with an improved intestinal architecture/morphology, as indicated by the increased intestinal villus height and villus height-to-crypt depth ratio. Unfortunately, these parameters related to intestinal morphology were not measured in our trial.

7. Conclusions

Fermenting feed with a combination of exogenous enzymes and bacteria positively affected the average daily gain, feed intake, and gain-to-feed ratio of weaned piglets. Fermented feed ingredients elicited their growth-promoting effects by increasing nutrients and energy digestibility, thus improving animal health through beneficial gut microbial and structural changes and by regulating redox status. Overall, the results support this strategy as a sustainable alternative to the use of antibiotics as growth promoters.