Pyramiding Submergence Tolerance and Three Bacterial Blight Resistance Genes in Popular Rice Variety Hasanta through Marker-Assisted Backcross Breeding

Abstract

Flash flooding (FF) along with bacterial blight (BB) outbreak are very destructive for rice production in the rainfed shallow-lowland (RSL) ecosystem. The presence of dynamic Xoo races with varying levels of genetic diversity and virulence renders their management extremely challenging under RSL. In this context, the marker-assisted improvement of plant resistance/tolerance has been proven as one of the most promising strategies towards the development of sustainable cultivars. The present study demonstrates the marker-assisted introgression of the submergence tolerant (Sub1) and three bacterial blight resistant genes (Xa21 + xa13 + xa5) into the genetic background of Hasanta, a long duration popular rice variety in the eastern coastal region of India. The rice genotypes, Swarna Sub1 (carrying Sub1) and IRBB66 (carrying Xa21 + xa13 + Xa7 + xa5 + Xa4) had maximum genetic similarity (0.84 and 0.73, respectively) with Hasanta; recurrent parent (RP) was used as donor. The forward analysis of target genes in F1s, IC1F1s and backcross (BC) generations was performed by linked/genic markers (Sub1bc2; pTA248, xa13prom and RM122), whereas background recovery of RP in each BC and segregating generations was performed utilizing 108 hypervariable SSR markers. Intervened speed breeding (SB) strategy and intensive phenotyping could lead the development of near isogenic lines (NILs) as to the RP in all basic traits. The performance of the near isogenic lines (NILs, BC₂F₃ and BC₂F₄), HS 232-411-391-756-37, HS 232-411-391-809-8, HS 232-411-391-756-18, HS 110-224-197-10-36, HS 232-411-391-809-81, HS 110-224-197-10-41 and HS 232-411-391-809-63 establishes the utility of marker-assisted backcross-breeding (MAB) and SB in accelerated trait introgression. The introgressed lines carrying Sub1 + Xa21 + xa13 + xa5 showed 76% to 91% survival under 14 days of submergence and durable BB resistance (percent disease index-PDI of 2.68 ± 0.26 to 6.22 ± 1.08 and lesion length, LL of 1.29 ± 0.12 to 4.2 ± 0.64 cm). Physiological analysis revealed that improved NILs, carrying Sub1 gene conquered adaptive physiological modulations, had reduced the consumption of soluble sugar and the degradation of total chlorophyll contents (TCC), and an enhanced level of Alcohol Dehydrogenase activity (ADH) and proline accumulation in all submergence regimes. The pyramided lines attained complete product profile of RP, that will contribute to sustainable rice production under RSL, particularly in the coastal region that has substantial acreage under the variety Hasanta.

1. Introduction

Global climate change has affected the agro-ecosystem of the planet significantly in various way [1]. The frequent occurrence of intensive flooding, drought and heat has obstructed cropping patterns and the production of many crops [2]. Submergence due to FF is considered the third most important abiotic constraint of rice production in rainfed shallow lowland (RSL) ecologies, causing substantial yield loss annually [3]. In India, ~16 mha of rice acreage are submergence prone, of that ~90% areas are confined to the eastern region where the rice crop is a major source of livelihood [4]. Rice is a semi-aquatic crop, able to modulate its adaptive patterns and pathways to sustain under a wide range of habitats/niches [5], but, intense and prolonged flooding is fatal for its survivability [6,7,8]. Under submergence condition, the rice canopy faces several challenges for proper growth and survival. Owing to a lower rate of gaseous and light diffusion under water, submerged plants face energy shortage and nutrient deficiency and subsequently perish [9]. Additionally, flooding offers a very conducive environment for the growth of BB and other biotic stresses, which along with water hypoxia/anoxia causes havoc to rice sustainability. Further, climatic patterns predicting a very distressing situation due to severe flooding in future, particularly in coastal regions [10], necessitates step up yield potential in rice by 70% to feed our ever-growing population [11]. The frequent outbreak of BB, sheath blight and the resurgence of minor diseases and pests are other challenges for rice production in RSL [12], demands breeding climate resilient and multiple disease resistance rice cultivars [13,14,15]. Typically, rice plants sustain up to one week of submergence [16,17], but beyond that, usually only tolerant genotypes survive [18]. Tolerant rice genotypes make several adaptive modulations, which enables it to survive under hypoxia/anoxia without major damage [2,4,8,19,20]. Plant growth regulators like ethylene, gibberellic acid (GA) and abscisic acid (ABA), and their successive manipulation, are regulating shoot elongation and leaf senescence in submerged canopies and thus enhances plant survival under flood [21,22,23]. Tolerant genotypes under flooding condition switch-on their alcohol dehydrogenase activity, which regulates judicious energy consumption in plants and enhances plant survivability [6].

Genomic regions responding to adaptive intonations in rice under submergence have been mapped, validated and successfully deployed in several intolerant genotypes [24,25,26,27,28,29,30,31,32]. The Sub1 gene exerts two weeks of submergence tolerance in mapped on chromosome-9, along with other minor QTLs in the Indian rice landrace FR13A [33,34,35,36,37]. FR13A is utilized as a donor of Sub1 in several rice improvement programs [4,9,28]. Popular rice varieties, Ranjit et al. [24], BRRI Dhan52 [25], Aiswarya et al. [27], Swarna et al. [28], CO₃ [30], IR64 [32], Chehrang [32] and CR 1009 [32], etc., have been introgressed with Sub1 through the markers-assisted selection (MAS)/MAB approach. A submergence tolerant version of mega rice variety, Swarna Sub1 [28], has similar agro-morphology as Swarna, yielding a 2-fold or higher yield advantage over parent under 10 or more days’ vegetative stage flooding [8,28]. Recently, two climate smart rice varieties, CR Dhan 801 and CR Dhan 802, carrying dual resilient traits (drought and submergence tolerance), have been developed through MAS, which are working based on the shut-down and shut-on mechanism [29].

Furthermore, BB disease (caused by Xanthomonas oryzae pv. Oryzae; Xoo) is devastating under RSL, causing 20–100% yield loss in rice [38]. Warm temperatures (25–30 °C), high humidity, heavy rainfall and water stagnation coupled with excessive nitrogen application, promote BB outbreak. BB disease also impairs photosynthesis; once synchronizes with FF it causes huge yield and quality loss in rice [4,14,15]. The Xoo inoculum of BB disease enters in the host plant through injured epidermis and perpetuates in the xylem vessels. The pathogenic Xoo races are highly dynamic and diverse in nature, produce a variety of toxic secretions including extracellular polysaccharides, enzymes, iron chelating siderophores and the type III-secretion dependent effectors [39] that compromise the rice plant’s immune response [7]. Rice cultivars with inbuilt resistance are reported substantial in BB disease management [13,40,41,42]. More than 40 genes conferring resistance (R) to BB in rice have been mapped, some of those are successfully deployed into the popular genetic backgrounds [4,13,41,42,43,44,45,46]. Even though, the dynamic nature of Xoo pathotypes and the varied extent of their virulency necessitates stacking multiple R genes for durable resistance [4,13,14,15,41,42,43,47,48].

The above findings highlighted the opportunity to develop additional high-yielding varieties that are adapted to other regions or adverse environments. Improving plant sustainability through the incorporation of resistance/tolerance genes/QTLs is an effective strategy for managing submergence stress and BB disease in rice [2,4,49,50]. Recent advances in biotechnological tools and techniques have facilitated mapping and more importantly the stacking of the desirable genes/QTLs into elite agronomic backgrounds [13,24,49]. Molecular markers enabling the selection of desired traits/types, irrespective of the growth stage and habitats of plants, is simple [44,51]. MAB has been widely accepted as an established tool for accelerative and precise trait improvement in rice [2,4,13,14,24,41,42,44,52,53]. Besides, the utility of speed breeding, which harnesses the modified environment (compact spacing 2.5–5.0 cm and nutritional and physiological stress) to shorten growth duration in plants, was also displayed successfully; we could advance three generations in a year. Hasanta, a medium-long duration (145–150 days) rice variety is very popular among farmers. It has an average productivity of 6.5–7.0 ton/ha and has considerable acreage (>2000 ha) in the coastal region of state Odisha, India (DAC indent, 2021). However, its vulnerability to flooding and bacterial blight disease received severe yield inconsistency under the flash flood situation. This research work was framed to enhance the sustainability of Hasanta under submergence and bacterial blight stress, through the MAB approach.

2. Materials and Methods

2.1. Experimental Materials and Breeding Strategy

We have selected Swarna Sub1 (Sub1 gene) and IRBB66 (Xa21 + xa13 + Xa7 + xa5 + Xa4) as donors (have genetic similarity i.e., 0.84 and 0.73, respectively, with RP) for the marker-aided improvement of submergence tolerant and BB resistance in the popular rice variety, Hasanta (

Table 1. Details of parental lines, their pedigrees, maturity duration and zone of adoption.

Genotype	Pedigree	Special Features
Hasanta	OR 1206-26-2 x OR 1534-129	Medium late duration, semi-dwarf, high yielding with small bold grains, MR to leaf folder, leaf blast, sheath blight and bacterial leaf blast for Odisha
Swarna Sub1	Swarna 3/IR 49830-7-1-2-3	High yielding (45–55 q/ha), semi-dwarf, medium-late (140–145 days) duration, medium slender grains, >65% HRR, tolerant to complete submergence between 15–17 days
IRBB66	IR 24 NIL	Medium duration (135 days), semi-dwarf (95–100 cm), medium slender grain, medium amylose, bacterial blight resistant

and Table S1; Figure 1 and Figure S1). The hybridity of the individual F₁ and IC₁F₁ plants of the cross Hasanta/Swarna Sub1 and Hasanta/IRBB66 was confirmed with the tightly linked DNA markers, Sub1bc2 [2]; pTA248 [54] and xa13prom [13,44,55] and RM122 [2] (

Table 2. Genic and linked markers for FS and recombinant selection (RS).

Gene/QTL	Chr. No.	Marker/Primer	Physical Position (Mb)	Type	Marker/Primer/Sequence	Reference
Sub1	9	Sub1bc2	0.0–4.80	FS	Forward-5′ aaaacaatggttccatacgagac3′ Reverse-5′gcctatcaatgcgtgctctt3′	[2]
		RM8300	1.0	RS	Forward-5′gctagtgcagggttgacaca3′ Reverse-5′ctctggccgtttcatggtat3′
		A203	2.0	RS	Forward-5′cttcttgctcaacgacaacg3′ Reverse-5′aggctccagatgtccatgtc3′
		C173	4.0	RS	Forward-5′aacgccaagaccaacttcc3′ Reverse-5′aggaggctgtccatcaggt3′
xa5	5	RM122	1.65	FS	Forward-5′gcactgcaaccatcaatgaatc3′ Reverse-5′cctaggagaaactagccgtcca3′	[65]
		RM17941	3.40	RS	Forward-5′gcctcgaagaaccagtagaacagc3′ Reverse-5′cttgtcttctcctcctcctgtgc3′
xa13	8	xa13prom	26.81	FS	Forward-5′ggccatggctcagtgtttat3′ Reverse-5′gagctccagctctccaaatg3′	[13,44,55]
		RM23356	24.20	RS	Forward-5′gcctccaacagatctcctatctgg3′ Reverse-5′tttggcgctaatgagagattgg3′
		RM22914	30.90	RS	Forward-5′ccaatcattaacccctgagc3′ Reverse-5′gccttcatgcttcagaagac3′
Xa21	11	pTA248	22.60	FS	Forward-5′agacgcggaagggtggttcccgga3′ Reverse-5′agacgcggtaatcgaaagatgaaa3′	[23]
		RM26969	21.50	RS	Forward-5′ctcacacttgcaacatcctagc3′ Reverse-5′aaggctctagttggtgaagacc3′

). The true hybrids were intercrossed and positive IC₁F₁s were backcrossed with the RP to generate BC₁F₁ seeds. The generation advancement of target gene(s) with maximum RP genome recovery was assessed in every BC generation with linked foreground and 108 background SSR markers (Table S2), followed by robust phenotyping. The molecular data were also subjected for genetic divergence analysis among parents and NIL derivatives by using the DARwin-6.0 software [56]. The best BC₁F₁ plants with maximum RP genome and desirable phenome (days to 50% flowering, DFF; plant height, PH; grain length-breadth ration, L/B ratio; head rice recovery, HRR; and amylose content, AC) were advanced to the next generation. The seven BC₂F₁ plants carried heteroalleles of the targeted genes were selfed to produce BC₂F₂. Further, BC₂F₂ population was subjected to FS, BS and phenotyping, to identify the plants with maximum RP genome and phenome. In each BC and BC₂F₂ generation, desirable plants were advanced adopting single seed descent (SSD) strategy under field rapid generation advance (RGA) to accelerate the development of the NILs. Selection differential (Δd) analysis for the product profile traits, DFF (days), PH (cm), grain L/B ratio, HRR and AC content was performed in BC and segregating generation. The submergence screening of NILs (BC₂F₃ and BC₂F₄) along with parents under the standard evaluation system (SES) [57] were performed at research farm of the ICAR-National Rice Research Institute, India. Biochemical parameters such as ADH [58,59], total soluble sugar content [60,61], total chlorophyll content [62] and proline content (PC) [63] were also analyzed to assess the biochemical changes and their relation to the Sub1 in NILs under flooding. In addition, disease bioassay with eight virulent Xoo type was conducted and percent disease index (PDI) and area under disease progress curve (AUDPC) were calculated to analyze the extent of improvement in the derivatives lines [64].

2.2. PCR and Marker Analysis

The genomic DNA from the leaf sample of each plant (20–22 days old seedling) was extracted and purified using the CTAB method [66]. The PCR reaction was carried out using 15 ng of template DNA, 1x Taq assay buffer, 0.3 mM of MgCl₂, 133.0 µM of dNTPs, 1 U/µL of Taq DNA polymerase (Thermo-scientific, Life Science Products, Mumbai, Maharashtra, India) and 1.25 µM of each primer (Eurofins, Genomics, Hyderabad, India). The PCR was carried out in an Eppendorf Thermo Cycler (Enfield, CT06082, USA) with the following program: (1) initial denaturation at 94 °C for 3 min; (2) 39 cycles for denaturation for 30 s at 94 °C, annealing for 30 s at 56 °C, extension for 1 min at 72 °C; and (3) final extension at 72 °C for 5 min. The amplified products were resolved with 2.5% Metaphor^TM Agarose gel (Typhoon FLA 700, Alpha Innotech, Marlborough, MA 01752, USA) and visualized under a UV light source in photographed gel documentation (Gel-Doc) system (Gel Doc^TM XR, Bio-Rad Laboratories Inc., Portsmouth, NH 03801, USA).

Target traits in F₁, IC₁F₁ and BC generations were traced using trait linked-DNA markers, Sub1bc2 with 0.0 cm distant to Sub1 [2], pTA248 lying 0.2 cm distant to Xa21 [23,67], xa13prom with 0 cm distant to xa13 [13,44,55] and RM122 with 0.4 cm distance to xa5 [65] (Table 2). Moreover, genome recovery of the RP was monitored with 108 polymorphic SSR markers (

Table 3. Brief summary of BC generations RP genome recuperation during the development of Hasanta’s NILs (P1-Hasanta/Swarna Sub1 and P2-Hasanta/IRBB66).

Generation	Total Plants Raised	Gene Positive Plants	Plants Advanced	% RPG Recovery	Selection Criteria
F1s	87 (P1) & 47 (P2)	78 & 38	5 of each P1&P2	*	Hybridity testing with gene linked markers
IC1F1	532	11	10	*	Hybridity testing with gene linked markers
BC1F1	678	8	6	68.43–80.08	FS, BS, phenomics and bioassay
BC2F1	465	7	7	79.65–89.40	FS, BS, phenomics and bioassay
BC2F2	847	13	3	91.35–95.19	FS, BS, phenomics and bioassay
BC2F3	13 families (each 150 plants)	13 families (28 plants)	13 NILs	>93.75	Phenomics and screening/bioassay analysis
BC2F4	13 NILs	13 NILs	13 NILs	>93.75	Phenomics and screening/bioassay analysis

* Not estimated; RPG, recurrent parent genome; number of plants/lines positive for Sub1 + Xa21 + xa13 + xa5; FS, foreground selection; BS, background selection.

and Table S2) that uniformly span entire rice genome [13,34,68,69]. These 108 SSRs were selected from 421 SSRs based on the polymorphism survey between Hasanta and Swarna Sub1. Recombinant analysis was carried out using markers, Sub1-A203, and Sub1-C173 (Sub1); RM26969 (Xa21), RM23356 and RM22914 (xa13) and RM17941 (xa5) flanking the Sub1 and BB resistant genes on chromosome 9, 11, 8 and 5. The molecular data in the BC₂F₂ generation were used to visualize genotype of individual NILs using the Graphical Genotyper (GGT2.0) software [70].

2.3. Screening for Submergence Tolerance

Twenty days old seedlings (BC₂F₃ and BC₂F₄) carrying the homo-quadruplet of target genes (Sub1 + Xa21+ xa13 + xa5) were grown along with parents in a screening tank. Each NIL was transplanted in three rows with 22 plants per row at 20 cm × 15 cm spacing under complete block design with two replications. Subsequently, submergence was imposed for 14 days with 1.5-m water depth. After 14 days of submergence, the water was removed from the tanks and then after 1 week of desubmergence, regeneration was recorded [57].

2.4. Disease Bioassay Analysis

The NILs and each BC generations carrying effective hetero/homo-alleliec combinations of R genes were grown in field condition along with parents and bio-assayed with eight virulent Xoo races (Xa17, Xa7, xa2, Xb7, Xc4, xd1, xa1 and xa5) prevalent in the eastern region of the country. The pathotypes were maintained in peptone sucrose agar (PSA) medium [71] and single spore culture with 10⁸ cfu/mL bacterial Xoo suspension was used for inoculation. The top five leaves of each plant were clipped off and inoculated [53]. Post inoculation, the plants were observed after every 24 h time interval to note the appearance of disease symptoms. The lesion lengths were measured at 14, 21 and 28 days after inoculation (DAI) [72] using a disease score index of 0–9 [73]. The lesion length of <5 cm was considered resistant (R), 5–10 cm was considered moderately resistant (MR), 10–15 cm was moderately susceptible and >15 cm was taken as highly susceptible. The epidemiological parameters, such as PDI and AUDPC, which indicates overtime disease accumulation, were calculated to assess the disease severity [64].

2.5. Speed Breeding and Single Seed Descent (SSD) Strategies for Generation Advancement

Speed breeding (SB) is a suite of techniques which involves the manipulation of environments under which plants are grown, aiming to accelerate flowering and seed set. We have adopted a field rapid generation advance (RGA) along with SSD strategy (compact spacing 2.5–5.0 cm; nutritional and moisture stress, physiological stress-maintained solitary culm), which makes 30–35 days’ flowering duration reduction in rice, and thus accommodates three generations in a year (Figure 2).

2.6. Agro-Morpho Evaluation of NILs

The NILs (BC₂F₃ and BC₂F₄) along with RP and donor parents were evaluated for yield and other agro-morphological traits in a randomized complete block design (RCBD) with three replications. Standard agronomic management practices were followed for raising the rice crop at two locations (ICAR-National Rice Research Institute, Cuttack and Odisha Agricultural University, Bhubaneshwar) in India. The data were recorded on five plants from each of the entries for the characters namely: days to 50% flowering (DFF), days to maturity (DM), plant height (PH), flag leaf length (FLL), flag leaf width (FLW), number of effective tillers per plant (NETPP), panicle length (PL), panicle weight (PW), number of grains per panicle (NGPP), number of chaffs per panicle (NCPP), Spikelets fertility % (SF%), test weight (TW), grain yield per plant (GYPP) and % survival (%S). Further, the lines were also analyzed for grain and cooking quality parameters, such as head rice recovery (HRR) [34], kernel length before cooking (KLBC), kernel breadth before cooking (KBBC), length/breadth ratio (L/B), amylose content (AC) and panel test for palatability trait, as described by [74]. The statistical analysis was performed using the DARwin-6.0, XLSTAT, R Package Version 1.0.7. [75]. The use of plant material comply with relevant institutional, national, and international guidelines and legislation.

3. Results

3.1. Molecular Characterization of Parents and Selection of Donor

Of the total 421 SSRs screened among the 11 rice genotypes (Hasanta, Mrunalini, Swarna Sub1, IRBB66, Swarna Shreya, Upahar, Chehrang Sub1, improved CRMS 31B, improved CRMS 32B, CR Dhan 801 and CRL22), 108 markers (26.03%) showed polymorphism among the recurrent parent (RP) Hasanta and donors (Table S2). The diversity analysis revealed varying degree of genetic relatedness (similarity metrics of 0.66 to 0.84) (Table S1 and Figure S1) among the parents. The genotypes, Swarna Sub1 (carrying Sub1) and IRBB66 (carrying Xa21 + xa13 + Xa7 + xa5 + Xa4) had closest genetic similarity with RP (0.84 and 0.73, respectively). The bioassay analysis of IRBB66 also showed incompatible or HR disease reaction against eight Xoo races (LL of 1.67 ± 0.26 cm to 2.68 ± 0.23 cm) (

Table 4. Disease reaction (after 21 days of inoculation) in improved NILs (BC₂F₃ and BC₂F₄) carrying resistance genes against eight different races of Xoo.

Pyramided Lines (NILs)	Gene Combination	Disease Lesion Length (LL) in cm (Mean ± Standard Error)
		Xa17	Xa7	xa2	xb7	xc4	xd1	xa1	xa5	MLL	Disease Reaction
HS 110-224-197-10-2-2	Sub1 + Xa21 + xa13 + xa5	1.98 ± 0.67	2.25 ± 0.23	2.08 ± 0.19	2.36 ± 0.39	2.8 ± 0.87	2.5 ± 0.13	2.48 ± 0.29	2.32 ± 0.58	2.35	R
HS 110-224-197-10-2-5	Sub1 + Xa21 + xa13 + xa5	2.35 ± 0.33	2.68 ± 0.94	2.12 ± 0.28	2.56 ± 0.13	3.05 ± 0.74	2.26 ± 0.42	2.62 ± 1.09	2.4 ± 0.31	2.51	R
HS 110-224-197-10-2-36	Sub1 + Xa21 + xa13 + xa5	3.12 ± 0.92	2.3 ± 0.54	2.8 ± 0.91	2.9 ± 0.48	2.8 ± 0.76	2.6 ± 0.82	2.55 ± 0.86	2.10 ± 0.74	2.65	R
HS 110-224-197-10-2-41	Sub1 + Xa21 + xa13 + xa5	2.8 ± 0.32	2.08 ± 0.67	2.28 ± 1.18	3.3 ± 0.35	2.7 ± 0.69	2.10 ± 0.39	3.08 ± 1.11	2.20 ± 0.62	2.57	R
HS 110-224-197-10-2-68	Sub1 + Xa21 + xa13 + xa5	2.6 ± 0.46	2.9 ± 0.33	2.4 ± 0.48	2.17 ± 0.43	2.82 ± 0.12	2.62 ± 0.22	2.36 ± 1.00	3.42 ± 0.53	2.66	R
HS 232-411-391-809-63-8-10	Sub1 + Xa21 + xa13 + xa5	1.29 ± 0.12	1.98 ± 0.65	2.11 ± 0.34	3.16 ± 0.54	2.36 ± 0.21	1.85 ± 0.39	3.22 ± 0.64	2.81 ± 0.19	2.35	R
HS 232-411-391-809-63-8-18	Sub1 + Xa21 + xa13 + xa5	2.2 ± 0.92	1.85 ± 0.42	2.14 ± 0.94	1.68 ± 0.85	3.54 ± 0.67	1.75 ± 0.38	3.42 ± 1.20	2.07 ± 0.66	2.33	R
HS 232-411-391-809-63-8-20	Sub1 + Xa21 + xa13 + xa5	3.0 ± 0.59	3.72 ± 0.27	2.26 ± 0.87	2.44 ± 0.72	1.98 ± 0.22	3.40 ± 0.65	3.04 ± 1.22	2.8 ± 0.77	2.83	R
HS 232-411-391-809-63-8-37	Sub1 + Xa21 + xa13 + xa5	1.99 ± 0.32	2.48 ± 0.47	2.33 ± 1.15	3.5 ± 0.28	1.95 ± 1.02	2.61 ± 0.82	2.42 ± 0.36	3.11 ± 0.62	2.55	R
HS 232-411-391-809-63-1	Sub1 + Xa21 + xa13 + xa5	2.1 ± 1.24	3.55 ± 0.75	2.2 ± 0.63	3.02 ± 0.22	3.6 ± 1.24	2.6 ± 0.46	2.24 ± 0.47	3.00 ± 0.56	2.79	R
HS 232-411-391-809-63-8	Sub1 + Xa21 + xa13 + xa5	2.3 ± 0.69	3.2 ± 0.46	2.3 ± 0.53	4.2 ± 0.64	2.82 ± 0.33	2.75 ± 1.12	2.08 ± 0.18	2.98 ± 0.39	2.83	R
HS 232-411-391-809-63-63	Sub1 + Xa21 + xa13 + xa5	3.07 ± 0.62	3.2 ±0.63	3.01 ± 0.45	2.25 ± 0.24	2.44 ± 0.52	2.26 ± 0.37	2.8 ± 0.19	2.09 ± 0.12	2.64	R
HS 232-411-391-809-63-81	Sub1 + Xa21 + xa13 + xa5	2.0 ± 0.33	2.1 ± 1.14	1.68 ± 0.15	1.84 ± 0.42	2.34 ± 0.51	2.44 ± 0.86	2.24 ± 0.47	1.64 ± 0.39	2.04	R
IRBB66	Xa21 + xa13 + xa5 + Xa4	1.7 ± 0.13	1.67 ± 0.26	2.2 ± 1.08	2.15 ± 0.26	2.68 ± 0.23	2.42 ± 0.41	1.9 ± 0.34	1.68 ± 0.21	2.05	R
Swarna Sub1 (donor)	Sub1 + xa21 + Xa13 + Xa5	9.25 ± 1.35	12.5 ± 1.28	11.68 ± 1.54	10.98 ± 0.98	13.74 ± 1.46	12.45 ± 1.28	14.25 ± 1.35	10.80 ± 1.16	11.96	S
Hasanta (recipient)	sub1 + xa21 + Xa13 + Xa5	12.34 ± 1.08	14.82 ± 1.38	10.86 ± 1.25	13.65 ± 1.32	10.87 ± 1.27	9.95 ± 1.74	15.44 ± 1.95	12.87 ± 1.32	12.60	S

R, resistant; MR, moderately resistant; S, susceptible; MLL, mean lesion length (cm).

). Therefore, to avoid undesirable linkage drag and allow a rapid fixation of segregating loci in derivatives, the IRBB66 [76] and Swarna Sub1 [77] were used as donor for Sub1 and R genes of BB disease in the our trait improvement scheme.

3.2. MAB Based Introgression of Sub1 and Three BB Resistance Genes in Hasanta

The F1s (87 and 47 plants) and intercrossed F1s (IC₁F₁s, 532 plants) of Hasanta/Swarna Sub1 and Hasanta/IRBB66 combinations were screened for hybridity using gene linked markers Sub1bc2 (~0.0 cm) [2], pTA-248 (~0.2 cm from Xa21) [23], xa13prom (0.0 cm from xa13) [13,44,55,78] and xa5 (0.4 cm from xa5) [65] (Table 2). The ten IC₁F₁s with confirmed hybridity were crossed with RP to generate BC₁F₁s that were genotyped with foreground markers and also compared with RP for agro-morphological traits. Eight out of the total 678 BC₁F₁ plants were found hetero-alelliec for target genes (Sub1 + Xa21 + xa13 + xa5) with 68.43 to 80.08% of RP genome and desirable phenome (agro-morphology and MR disease reaction, percent disease index (PDI) of 11.82 ± 0.460 to 35.14 ± 0.344, area under disease curve (AUDPC) of 278.34 to 622.35) (Table 3 and Table S3; Figure 3). Six BC₁F₁s carrying >80.0% RP genome and desirable phenome were advanced to BC₂F₁ with 465 seeds (Table 3). Further, seven positive BC₂F₁ plants carrying 80.65 to 89.40% RP genome and had desirable phenome (PDI = 3.82 ± 0.10 to 16.6 ± 0.55, AUDPC = 102.11 to 208.86, MR) were selfed to develop near isogenic lines (NILs) (Table 3 and Table S3; Figure 4). The BS in the BC₁F₁ and BC₂F₁ revealed 22.25% and 7.84% heteroallelism for background SSR markers, respectively, which were further analyzed in BC₂F₂. FS in 847 BC₂F₂ plants could identify 13 plants with fixed target genes Sub1+ Xa21 + xa13 + xa5 (Figure 5 and Table S4). The BS analysis in BC₂F₂ with 108 informative SSR markers revealed recovery of >90.0% RP genome in the plants, HS 110-224-197-10, HS 110-224-197-13, HS 110-224-197-135, HS 110-224-197-263, HS 110-224-197-379, HS 110-224-197-424, HS 232-411-391-603, HS 232-411-391-619, HS 232-411-391-702, HS 232-411-391-735, HS 232-411-391-756, HS 232-411-391-809 and HS 232-411-391-831 (Table 3 and Table S4 and Figure 5, Figures S2 and S3). Thirteen BC₂F₂ plants fixed with target genes and had maximum RP genome were further advanced to BC₂F₄ generation to allow selection of the most desirables submergence tolerant and BB resistant NILs. The submergence screening and disease bioassay analysis in 13 BC₂F₃ NILs confirmed their tolerance to flooding (

Table 5. Comparison of agronomic and grain quality traits of the NILs vis-à-vis parents in the BC₂F₃ and BC2F4 generation (pooled) under stressed (S) and non-stressed (NS) condition.

Trait	Environment	RP	DP	NILs		RUs	CV	LSD
				Mean	Range
DFF	NS	112.6	114.5	112.7	110.2–115.2	−4.34	10.25	2.41
	S	118.5	115.2	117.6	112.5–122.5		8.15	1.83
DM	NS	148.3	146.5	144.7	140.2–148.4	−2.14	8.65	2.33
	S	150.2	146.5	147.8	138.5–155.2		18.32	0.72
PH (cm)	NS	111.45	96.35	112.9	109.5–116.5	2.12	9.08	2.84
	S	108.22	93.12	110.5	106.5–114.5		7.08	4.42
FLL (cm)	NS	24.5	19.3	24.8	22.9–26.6	2.41	8.65	3.02
	S	24.05	18.8	24.2	19.4–28.15		11.24	8.42
FLW (cm)	NS	1.21	1.05	1.2	1.12–1.34	0.83	10.25	0.08
	S	1.19	0.99	1.19	1.13–1.28		8.05	0.25
NETPP	NS	12.55	11.75	11.0	10.05–12.5	13.63	9.40	1.95
	S	5.75	10.95	9.5	8.2–11.7		12.87	1.3
PL (cm)	NS	20.97	21.17	21.5	19.3–24.8	−0.93	8.65	1.7
	S	20.42	16.62	21.7	19.2–24.5		11.62	2.4
PW (g)	NS	10.4	9.55	9.0	7.3–10.3	2.22	10.25	1.84
	S	9.1	8.2	8.8	6.7–9.8		13.16	2.64
SF%	NS	81.2	82.6	81.1	75.8–86.2	1.72	3.90	11.90
	S	77.3	84.9	79.7	76.2–82.2		6.82	6.18
TW	NS	20.5	18.8	20.4	19.3–22.4	−1.47	7.71	2.04
	S	20.4	18.7	20.7	19.1–23.5		11.08	1.24
GY (q/ha)	NS	78.1	81.6	80.9	62.4–89.4	33.12	6.03	1.65
	S	5.5	52.8	54.1	40.13–63.1		12.7	1.40
KL (mm)	NS	4.6	4.5	4.5	4.0–5.1	−2.22	10.2	0.03
	S	4.6	4.5	4.6	4.2–5.1		10.08	0.03
KW (mm)	NS	1.87	1.50	1.77	1.54–1.88	−1.12	7.59	0.2
	S	1.87	1.50	1.79	1.65–1.88		8.02	0.2
KLBR	NS	2.46	3.00	2.56	2.21–3.30	0.0	8.25	0.1
	S	2.47	3.01	2.56	2.34–3.09		5.18	0.09
HRR%	NS	64.3	64.5	56.2	43.9–62.04	−3.38	4.65	0.8
	S	59.8	60.02	58.1	48.2–64.6		4.72	0.6
AC%	NS	23.06	22.2	22.4	20.08–25.6	−3.12	3.65	0.14
	S	22.6	23.08	23.1	21.6–25.1		3.06	0.06
%Survival	NS	86.0	96.0	94.0	88.0–99.0	10.53	6.46	3.93
	S	02.0	89.0	84.1	76.0–91.0		18.45	8.22

Note: RP, recurrent parent (Hasanta); DP, donor parent (Swarna Sub1); Environments (stressed, 14 days submergence and non-stressed, control condition); DFF-days to 50% flowering, DM-days to maturity, PH-plant height, FLL-flag leaf length, NETPP-number of effective tillers per plant, PL-panicle length, PW-panicle weight, NGPP-number of grains per panicle, NCPP-number of chaffs per plant, SF%-spikelets fertility percentage, TW-test weight, GY-grain yield (q/ha), KL-kernel length, KW-kernel breadth, KLBR-kernel length/breadth ratio, HRR-head rice recovery, AC-amylose content, % survival; RUs, relative reduction under drought over non-stressed in % (RUs = (trait under stress—trait under non-stress) × 100/trait under non-stress); CV, coefficient of variation; LSD, least significant difference at 5% level of significance.

) and durable resistance to BB disease (LL of 1.29 ± 0.12 to 4.2 ± 0.64; PDI of 2.68 ± 0.26 to 6.22 ± 1.08) (Table 4 and Table S4; Figure 6).

The phenotypic data of selected positive plants in BC generations were recorded progressing but least selection differential (Δd) for the product profile traits like, days to 50% flowering (DFF) (Δd: 1.35–2.42), plant height (PH) (Δd: 2.08–2.65), grain L/B ratio (Δd: 0.01–0.02), head rice recovery (HRR) (Δd: 0.23–1.54) and amylose content (AC%, Δd: 0.01–0.04) (Table S3). The improved NILs, HS 110-224-197-10-2, HS 110-224-197-10-5, HS 110-224-197-10-36, HS 110-224-197-10-41, HS 110-224-197-10-68, HS 232-411-391-756-10, HS 232-411-391-756-18, HS 232-411-391-756-20, HS 232-411-391-756-37, HS 232-411-391-809-1, HS 232-411-391-809-8, HS 232-411-391-809-63 and HS 232-411-391-809-81 carrying Sub1 and R genes, Xa21 + xa13 + xa5 showed 76% to 91% survival under 14 days submergence (Table 5 and Table S7) and broad spectrum of BB disease resistance (LL of 1.29 ± 0.12 to 4.2 ± 0.64 cm; PDI of 2.55 ± 0.82 to 19.08 ± 0.31) (Table 4 and Table S3; Figure 6). These improved lines were also phenotyped for grain quality, and the results revealed similar quality parameters as of RP with selection differentials (Δd) of 0.02 (Grain L/B ration), Δd = 1.54 (HRR) and same palatability as of RP (Table 5 and Table S5). Furthermore, genetic similarity amongst RP and improved NILs were assessed based on similarity metrics data of 108 SSR markers, which ranged from 0.87 to 0.93 (Figure S2). All 15 genotypes (parents + NILs) could be distinguished into two major clusters, where cluster I-A consisted of only one genotype i.e., Swarna Sub1 with similarity coefficient value of 0.77. Whereas, cluster-II consisted of RP and 13 NILs with maximum similarity coefficient value of 0.93 between Hasanta (RP) and HS 232-411-391-809-8 followed by HS 232-411-391-809-63 (0.92), HS 110-224-197-10-2 and HS 110-224-197-10-41 (0.91). The majority of the NILs were similar to the recipient parent, Hasanta, for the yield, quality and sustainability traits (Table 5, Figure 7). The improved NILs carrying targeted genes (Sub1 + Xa 21+ xa13+ xa5) and >90% RP genome achieved complete product profile as of Hasanta with at par yielding ability (Table 5 and Table S7). The NILs, HS 232-411-391-756-37, HS 232-411-391-809-8, HS 232-411-391-756-18, HS 110-224-197-10-36, HS 232-411-391-809-81, HS 110-224-197-10-41 and HS 232-411-391-809-63 were found to have similar yield, 1000-grain weight (test weight), head rice recovery (HRR), amylose content (AC) and survivability as of RP under 14 days submergence (Table S7). The quality assessment of improved NILs suggested that the introgressed lines had similar quality parameters including grain type, HRR (53.1% to 64.64%) and AC content (21.66% to 25.00%) (Table 5 and Table S7). Besides, sensory evaluation results revealed that there was no significant difference between RP and NILs in respect to palatability (Table S5).

3.3. Genome Introgression on the Carrier and Non-Carrier Chromosomes

The success of the trait improvement strategy relies upon the extent of the RP genome recovery in the resulting products, while retaining originality of the RP. Our results suggested an average of 92.86% RP genome recovery in the pyramided lines, representing >90% genomic segments from the chromosomes 1, 2, 4, 5, 6, 7, 10 and 12 (Figure 8 and Figure S3, Table S4). RP genome of chromosomes 1, 2 and 10 were fully recovered in all NILs. The Sub1 gene located on chromosome 9 was stacked with negligible linkage drag (LD), which is delimited up to 1.0 mb upstream and 1.0 mb downstream with markers A203 and C173, respectively (Figure S4). R genes (xa5, xa13 and Xa21), which are located on chromosomes 5, 8 and 11, were also pyramided with negligible LD from donor IRBB66. The recombinant analysis of xa5 revealed that LD is delimited up to 3.4 Mb downstream with RM17941. Whereas, it was delimited up to 2.6 Mb upstream and 4.1 Mb downstream of xa13 with markers RM23358 and RM22914; and 1.1 Mb upstream of Xa21 with RM26969 marker (Figure 8 and Figure S4). The result of genic marker, Sub1Bc2 (InDels) revealed that Sub1 gene is introgressed successfully in all improved NILs with >90% RP genome (Figure 7). Besides, the intervention of the marker RM122 supported successful introgression of xa5 in all 13 NILs along with >90% RP genome (Figure 8). Likewise, the marker pattern of xa13prom suggested the successful introgression of xa13 in all NILs (1-13) with >80%% RP genome, where HS 232-411-391-809-63 and HS 232-411-391-809-81 were recovered with the whole region of chromosome-8. Moreover, all NILs having Xa21 had >80.0% RP genome with desirable phenotypic traits (Table 5 and Table S7, Figure 9). In BC₂F₂ generation, on an average, 93.52 (86.59%) background markers confirmed homozygosity for RP alleles, 5.31 markers (4.91%) had heterozygosity and 4.69 markers (4.34%) showed homozygosity for donor alleles (Table S4). The pyramids, HS 232-411-391-809-63-8 (95.19%), HS 232-411-391-809-63 (93.75%), HS 110-224-197-10-68 (93.75%), HS 110-224-197-10-2 (93.75%), HS 110-224-197-10-5 (93.27%) and HS232-411-391-809-63-8-20 (93.27%) with all target genes were recovered with substantial RP genome (Table S4, Figure S3) and morphological traits (Table 5 and Table S7, Figures S5 and S6).

3.4. Screening of NILs for Submergence Tolerance and BB Resistance

The results of bioassay analysis in BC₂F₃ and BC₂F₄ NILs suggested BB resistance reactions (LL of 1.29 ± 0.12 cm to 4.2 ± 0.64 cm, PDI of 2.68 ± 0.26 to 6.22 ± 1.08), which remained at par with the extent of resistance in donor parent (Table 4, Figure 6 and Figure S5). All 13 NILs that attained homozygosity for the four targeted genes had 76% to 91% survival (14 days of submergence) and a broad spectrum of BB resistance against eight virulent Xoo pathotypes prevalent in the eastern region of the country. The NILs harbored homo-alleles of Sub1 and three R genes, Xa21+ xa13+ xa5 and 91.35% to 95.19% RP genome had LL in the range of 1.29 ± 0.12 to 4.2 ± 0.64 cm, which corresponded to the resistant category (disease score of 1). HS 232-411-391-756-10 has recorded maximum (91.0%) survivability and BB resistant reaction (Mean LL of 1.29 to 3.22 cm) attained perfect product profile as of RP for the traits, DFF (117 days), TW (20.2 g), HRR (554.60%), AC (22.08%) and grain size (2.51, L/B ratio), followed by HS 232-411-391-809-8 (90.0% survivability, mean LL of 2.08 cm to 4.22 cm; DFF of 116 days; TW of 19.69 g; HRR of 64.2%; AC of 25.0% and L/B ration of 2.51), HS 232-411-391-756-37 and HS 232-411-391-756-18 (89.0% survivability, Mean LL of 1.68 cm to 3.54 cm; DFF of 115 days; TW of 22.2 g; HRR of 64.64%; AC of 25.12% and grain size of 2.51, L/B ratio), HS 232-411-391-809-81 (86.0% survivability under 14 days submergence, mean LL of 1.64 cm to 2.44 cm; DFF of 118 days; TW of 21.62 g; HRR of 59.85%; AC of 22.05% and grain L/B ratio of 2.48) and HS 110-224-197-10-2 (88.0% survivability; mean LLof 1.98 cm to 2.80 cm; DFF of 118 days; TW of 20.1 g; HRR of 53.12%; AC of 23.4% and grain L/B ratio of 2.43) (Table 5 and Table S7 and Figure 6 and Figure 7). The lesion lengths observed on the lines containing Xa21 + xa5 genes varied from 4.38 ± 1.08 cm to 9.22 ± 0.87 cm, while it is ranged from 3.85 ± 0.64 to 6.90 ± 1.24 cm in the NILs carrying xa13 + xa5 gene combination (data not presented).

3.5. Physiological Responses of Sub1 Gene in NILs

The pyramided lines (BC₂F₄) along with parents were evaluated for physiological traits, such as total chlorophyll content, total soluble sugar, ADH activities and proline accumulation under 0, 7, 14 and 21 days of flooding regimes (Figure 10, Figure 11, Figure 12 and Figure 13, Table S6). The analysis of variance (ANOVA) for the RBD is given in

Table 6. ANOVA of physiological traits in parents and NILs (Hasanta/Swarna Sub1//Hasanta/IRBB66) under submergence (0, 7, 14, 21 days) condition.

Source	DF	Mean Sum of Squares
		ADH	TSS	PA	TCC
Replications	2	39.017 **	0.00019 *	0.0023 *	2.424 *
Genotype (A)	14	269.125 **	0.249 **	0.165 **	4.234 **
Treatment (B)	3	26.491 **	0.0622 **	0.0226 **	2.571 **
AxB	42	22.230 **	0.172 **	0.0422 **	3.121 **
Error	42

Note: *, ** significance at 5% and 1% probability level, ADH, Alcohol dehydrogenase; TSS, total soluble sugar; PA, proline accumulation; TCC, total chlorophyll content.

. The variation among the NILs was higher for all physiological response studied in all submergence regimes. The total chlorophyll (Chl a and Chl b) content was measured in the leaf and culm of 60 days old plants after 7, 14 and 21 days of submergence (Figure 10). The result revealed that the maximum chlorophyll content was reported under control condition (ranged from 1.80 to 3.20 mg g⁻¹) and it was highest in Sub1 carrying genotypes. It recorded a decreasing trend in proportion to the duration of submergence in all lines (parent and NILs) and regimes. The lowest value was recorded in RP (1.40 mg g⁻¹) followed by in HS 110-224-197-10-5 (1.80 mg g⁻¹) and HS 232-411-391-756-10 (1.90 mg g⁻¹) after 14 days’ submergence. The result indicates fast depletion of total chlorophyll in intolerant cultivars. Notably, Swarna Sub1 along with HS 110-224-197-10-36, HS 232-411-391-756-37, HS 232-411-391-809-1 recorded comparatively increased level of chlorophyll content after desubmergence (i.e., 21 days).

Furthermore, total soluble sugar (mg g⁻¹ fr. wt.) was recorded maximum in non-submerged leaves in all genotypes, which slowly decreased with increase in submergence period (Figure 11). Under non-submergence (control condition), all genotypes had a high level of soluble sugar content, which showed considerable reduction up to 7 days of submergence then after recorded increasing trend. Tolerant genotypes (NILs and donor) had comparatively slowed increase in soluble sugar with prolonged submergence period (beyond 7 days flooding). The result indicates that the slowed consumption of insoluble sugar during flooding led to submergence tolerance in rice.

The ADH, an enzyme catalyzes anaerobic respiration (ethanolic) was reported increasing trend, recorded maximum (3.60 to 13.20 per min per g fr. wt.) in the lines carrying Sub1 gene even after 14 days of submergence. ADH activities was found highest in the HS 232-411-391-809-1 (13.20 per min per g fr. wt.) followed by HS 232-411-391-809-81 (10.10 per min per g fr. wt.) and HS 110-224-197-10-68 (10.0 per min per g fr. wt.) (Figure 12).

Proline maintains normal osmoregulation in plant tissue under submergence. Our results revealed an increasing trend of proline accumulation under submergence in all improved NILs and donor (Figure 13). The genotypes carrying Sub1 gene showed maximum proline accumulation even beyond 14 days of submergence. The lines, HS 232-411-391-809-1, HS 232-411-391-809-8, HS 110-224-197-10-41 has recorded maximum (0.12 mg g⁻¹ fr. wt.) proline accumulation followed by HS 232-411-391-809-63, HS 232-411-391-756-37 and HS 110-224-197-10-68 (0.11 mg g⁻¹ fr. wt.), which was substantially greater than RP (0.07 mg g⁻¹ fr. wt.).

4. Discussion

A rainfed ecosystem is acquainted with frequent submergence and drought, amongst submergence stress, and is detrimental to rice production in Asian countries, accounting ~600 million USD annual monetary loss [6]. Turbid water along with dense algal growth hinders light and gaseous transmission under submergence and affects the photosynthetic activity, which led plants to die due to starvation [6,74,79]. Submergence stress, along with bacterial blight disease, causes substantial yield and quality reduction in rice [6]. The frequent occurrence of FF and the prevalence of Xoo races with varying levels of genetic diversity and virulence renders their management extremely challenging [6,39,49]. Despite varietal abundancy, the productivity of rice under RSL and a deep water ecosystem remains inconsistent and low [24]. Prolonged submergence creates very conducive environments to grow several biotic (bacterial blight, sheath blight, sheath rot etc.) and other abiotic (salinity) stresses, which threatens rice sustainability in a rainfed ecology [59,79]. Enhancing the resistance level in the host plant presents a standard practice to mitigate the risks of biotic and abiotic stresses, and is ecofriendly [2,4,13,24,41,42,76,80,81,82,83]. Evidence suggests that stacking tolerant/multiple R genes resulting in quantitative complementation or synergistic response, improves the resistance/tolerant level of plants [2,39,81,84]. In recent years, advances in genomic tools [34,80,84,85] have made significant contributions to the trait improvement in plant breeding. In this context, the marker-assisted improvement of plant resistance/tolerance has been proven as one of the most promising strategies for sustainable enhancement in crop plants [2,4,13,24,42,76,81,82,83].

The present study demonstrates the utility of MAB based introgression of the submergence tolerant (Sub1) and bacterial blight resistant genes (Xa21 + xa13 + xa5) into the background of Hasanta, a popular long duration rice in the eastern coastal region of India. MAB coupled with robust phenomics and speed breeding strategies led to fast and precise introgression of four genes, with perfect product profile of RP in two BC generation [2,39,81]. The variety Swarna Sub1 (carrying Sub1 gene) having >02 week flooding tolerance [2,28] and IRBB66 (NIL of IR 24, carrying five R genes, Xa21 + xa13 + Xa7 + xa5 + Xa4) has a high level of resistance against hyper-virulent Xoo pathotypes (Table 4) [86]. In addition, both genotypes, Swarna Sub1 and IRBB66, had maximum genetic proximity with RP (0.84 and 0.73 similarity coefficient, respectively) (Table S1 and Figure S1) and were used donor to avoid linkage drag and accelerative recovery of RP genome in the derivatives [39,81]. The F1s with a hetero-alleliec combination of target genes (Sub1 + Xa21+ Xa7 + Xa4) showed submergence tolerant and BB resistant reaction owing to the presence of Sub1 and R genes in functional complementarity. Whereas, BC progenies (Bc₁F₁s, Bc₂F₁s) with effective combination of Sub1 and Xa21 gene had complete submergence tolerant and moderately R reaction (Table S3) is fully corroborated with previous findings [2,39,81]. The improved lines did not show any linkage drag from the donors (Table 5, Tables S7 and S8), which might be due to the close genetic similarity among donor and RP genotypes. Besides, recombinant analysis delimited the linkage drags below threshold level, which on the other hand helped in the precise introgression of target genes [2,81]. Notably, selection differentials for most of the desirable traits changed progressively throughout the BC and segregating generations. The sensory panel test revealed no substantial differences for palatability in NILs and RP, which validated the successful recovery of all major gene(s) responsible for quality traits in Hasanta. The targeted product profile in NILs was attained since most of the traits considered in the study were attributed to a number of small effect genes/QTLs. The adoption of limited backcrosses in this study was found to have substantial edge over the burden of more backcrosses as our rapid backcross scheme (coupled with speed breeding strategy) led the accelerated accumulation of desirable genes (minor) in the derivatives. Thus, the inclusion of genetically close parents in MAS not only reduces the number of breeding generations, but it can also contribute to enhanced response to selection for important traits in later stage of the population [42,87,88]. Stepwise BS analysis coupled with robust phenotyping led to the fast recovery of RP genomes in early generation [2,39,42,49,76,82]. The majority of the NILs carrying Sub1 and three R genes (Sub1 + Xa21 + xa13 + xa5) had similar agro-morphology (duration, grain, yield and quality parameters) as to the RP with least selection differential and >0.90 similarity index (Table 5 and Table S3, Figures S2 and S6) and at par tolerance/resistance with the donor, Swarna Sub1 and IRBB66 (Table 5) indicates the utility of MAB in trait introgression [2,4,13,24,41,42,49,76,80,81,82,83,89]. Phenotyping in combination with MAS in BC generations was proven equally important as this strategy helped fast-tracking the transfer of genomic regions of functional relevance. Whereas, SSR markers employed in the BS usually target the non-coding and heterochromatic regions and therefore may not be suitable to quantify the recovery of functional part of the genome [42,81].

Being a semi aquatic plant, rice is able to make several modulations to sustain under flood adversity [6]. The results of the physiological analysis for total soluble sugar content, total chlorophyll content, ADH activities and proline accumulation under submergence revealed the considerable impact of Sub1 introgression in the NILs (Table S6, Figure 10, Figure 11, Figure 12 and Figure 13). The delayed degradation of the total chlorophyll content under complete flooding helps the plant to sustain longer [6,90]. SUB1A delays dark-induced senescence through the conservation of carbohydrate reserves and chlorophyll in the photosynthetic tissue [91,92], which helps in post submergence fast recovery [36]. Our result revealed comparatively slowed degradation in total chlorophyll content in NILs and donor genotypes carrying Sub1 is fully corroborated with previous findings [93,94,95]. Introgression or over expression of SUB1A-1 conferred significant submergence tolerance in the susceptible cultivars viz., Swarna and IR64 lines that lack SUB1A-1 or have the SUB1A-2 allele, but, due to a point mutation within the coding region SUB1A-2 allele is non-functional [32,36,96,97].

Under submergence, tolerant plants are capable of restricting their growth, and thus conserve ~25 to 50% more nonstructural carbohydrate, which helps in faster post submergence recovery [6,89,98,99,100]. The slowed release of non-structural sugar or total soluble sugar in submerged canopy indicates its judicious consumption of stored sugar, which helps prolonged survivability and post submergence fast recovery [8,89,101]. We have reported in our study that lines carrying the Sub1 gene had showed a slowed release of soluble sugar even beyond two weeks of submergence and followed ‘quiescence strategies’ of submergence tolerant [6,39,101]; whereas intolerant lines showed rapid increment in the non-structural sugar after 1 week of submergence. Contrariwise, growth regulators like ethylene, abscisic acid (ABA) and gibberellins (GA) promotes internode elongation and help plants to get exposed and survive [79]. The increased activity of hydrolase enzymes like ADH, α-amylase etc. facilitates energy to submerged canopy through anaerobic respiration [6,91]. The results of ADH activities revealed that lines carrying Sub1 had progressive ADH activity during submergence [44,102], which helped in the reduction of aldehyde production, and thus increases tolerance under hypoxia/anoxia in rice [30]. The increased accumulation of proline content in stressed plant is also an adaptive mechanism, which help to maintain osmoregulation in the submerged condition [103,104]. NILs that harbored Sub1 gene showed an increasing trend in proline accumulation under submergence, and further validated the impact of Sub1 gene.

Furthermore, BB bioassay of NILs carrying three R genes confirmed the successful introgression of the R genes, and the lines manifested incompatible disease response against all virulent Xoo pathotypes considered in the study [2,4,15,39,42,49]. The improved lines with two or more effective R gene combinations showed resistance levels comparable to that of the donor, which validated the efficacy of the introgression strategy that followed [2,4,15,39,42,49].

The success of this study has again validated the utility of marker assisted gene introgression with more precision and succession [13,14,41,42,53,65,73,86,105,106,107,108]. We could have achieved exactly the same product profile of RP in derivatives with 2 weeks of flooding tolerance and the broad spectrum of BB resistance. This research is fully corroborated with the results of improved Tapaswini, improved Lalat, Swarna Sub1, Ranjit Sub1 and Improved Rajalaxmi, improved Pusa RH10 [41,109,110]. The application of markers to recuperate full genome of RP in end product is again validated in this research, ~100 markers are found to be enough to retain originality of RP in MAB strategy, which is also fully corroborated with previous study [13,42,49]. The results of this study opened the path for the introgression of multiple genes in suitable genetic background with more than 95% originality very quickly and precisely.

5. Conclusions

Genomics-aided trait improvement to combat submergence stress due to FF and BB disease is an environmentally-sound and economically-viable strategy to achieve sustainable rice production under RSL worldwide. The prevalence of genetically diverse virulent Xoo strains over agro-climatic zone renders this disease extremely challenging to manage. The results of this study revealed that Sub1 along with R genes (Xa21 + xa13 + xa5) in combination could impart submergence tolerance and broad spectrum BB resistance along with ~10-fold yield enhancement. We demonstrated the utility of speed breeding strategies along with MAS in quick and precise stacking of Sub1 and R genes into the background of the popular rice variety, Hasanta.