Novel Multiplex Droplet Digital PCR Assays to Monitor Minimal Residual Disease in Chronic Myeloid Leukemia Patients Showing Atypical BCR-ABL1 Transcripts
Abstract
:1. Introduction
2. Experimental Section
2.1. Cohort of Patients
2.2. Standard Molecular Analysis
2.3. ddPCR Molecular Analysis
3. Results
3.1. ddPCR Assays Assessment
3.2. BCR–ABL1 Evaluation in Patients
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Moore, F.R.; Rempfer, C.B.; Press, R.D. Quantitative BCR-ABL1 RQ-PCR fusion transcript monitoring in chronic myelogenous leukemia. Methods Mol. Biol. 2013, 999, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Chasseriau, J.; Rivet, J.; Bilan, F.; Chomel, J.C.; Guilhot, F.; Bourmeyster, N.; Kitzis, A. Characterization of the different BCR-ABL transcripts with a single multiplex RT-PCR. J. Mol. Diagn. 2004, 6, 343–347. [Google Scholar] [CrossRef] [Green Version]
- Mobius, S.; Schenk, T.; Himsel, D.; Maier, J.; Franke, G.N.; Saussele, S.; Pott, C.; Andrikovics, H.; Meggyesi, N.; Machova-Polakova, K.; et al. Results of the European survey on the assessment of deep molecular response in chronic phase CML patients during tyrosine kinase inhibitor therapy (EUREKA registry). J. Cancer Res. Clin. Oncol. 2019, 145, 1645–1650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hughes, T.P.; Ross, D.M. Moving treatment-free remission into mainstream clinical practice in CML. Blood 2016, 128, 17–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hochhaus, A.; Saussele, S.; Rosti, G.; Mahon, F.X.; Janssen, J.; Hjorth-Hansen, H.; Richter, J.; Buske, C.; Committee, E.G. Chronic myeloid leukaemia: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann. Oncol. 2017, 28, iv41–iv51. [Google Scholar] [CrossRef] [PubMed]
- Dragani, M.; Fava, C.; Rege-Cambrin, G.; Andreani, G.; Crisà, E.; Caocci, G.; Aguzzi, C.; Gottardi, E.; Daraio, F. Treatment free remission in CML patients harbouring atypical BCR-ABL1 transcripts. In Proceedings of the European Hematology Association (EHA), Amsterdam, The Netherlands, 13–16 June 2019. [Google Scholar]
- Diral, E.; Le Coutre, P.; Gottardi, E.M.; Elena, C.; Bergamaschi, M.; Assouline, S.; Di Bona, E.; Petiti, J.; Stagno, F.; Iurlo, A.; et al. Increased tumour burden over a 36 month period in chronic myeloid leukemia patients following imatinib discontinuation: Role of digital PCR. Blood 2019, 134, 29. [Google Scholar] [CrossRef]
- Bernardi, S.; Malagola, M.; Zanaglio, C.; Polverelli, N.; Dereli Eke, E.; D’Adda, M.; Farina, M.; Bucelli, C.; Scaffidi, L.; Toffoletti, E.; et al. Digital PCR improves the quantitation of DMR and the selection of CML candidates to TKIs discontinuation. Cancer Med. 2019, 8, 2041–2055. [Google Scholar] [CrossRef] [PubMed]
- Cilloni, D.; Petiti, J.; Rosso, V.; Andreani, G.; Dragani, M.; Fava, C.; Saglio, G. Digital PCR in myeloid malignancies: Ready to replace quantitative PCR? Int. J. Mol. Sci. 2019, 20, 2249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Dongen, J.J.; Macintyre, E.A.; Gabert, J.A.; Delabesse, E.; Rossi, V.; Saglio, G.; Gottardi, E.; Rambaldi, A.; Dotti, G.; Griesinger, F.; et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 concerted action: Investigation of minimal residual disease in acute leukemia. Leukemia 1999, 13, 1901–1928. [Google Scholar] [CrossRef] [PubMed]
- Ballestrero, A.; Cirmena, G.; Dominietto, A.; Garuti, A.; Rocco, I.; Cea, M.; Moran, E.; Nencioni, A.; Miglino, M.; Raiola, A.M.; et al. Peripheral blood vs. bone marrow for molecular monitoring of BCR-ABL1 levels in chronic myelogenous leukemia, a retrospective analysis in allogeneic bone marrow recipients. Int. J. Lab. Hematol. 2010, 32, 387–391. [Google Scholar] [CrossRef] [PubMed]
- Stock, W.; Yu, D.; Karrison, T.; Sher, D.; Stone, R.M.; Larson, R.A.; Bloomfield, C.D. Quantitative real-time RT-PCR monitoring of BCR-ABL in chronic myelogenous leukemia shows lack of agreement in blood and bone marrow samples. Int. J. Oncol. 2006, 28, 1099–1103. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, S.G.; Guilhot, F.; Larson, R.A.; Gathmann, I.; Baccarani, M.; Cervantes, F.; Cornelissen, J.J.; Fischer, T.; Hochhaus, A.; Hughes, T.; et al. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N. Engl. J. Med. 2003, 348, 994–1004. [Google Scholar] [CrossRef] [Green Version]
- Jabbour, E.; Kantarjian, H. Chronic myeloid leukemia: 2018 update on diagnosis, therapy and monitoring. Am. J. Hematol. 2018, 93, 442–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primers/Probes | Sequences 5′-3′ | Final PCR Concentrations (nM) |
---|---|---|
e13 forward | TCGTGTGTGAAACTCCAGACTGT | 900 |
e14 forward | CCACTGGATTTAAGCAGAGTTCAA | 900 |
a3 reverse | CTTCACACCATTCCCCATTG | 900 |
a3 probe (FAM™-MGB) | TGAAAAGCTCCGGGTCT | 250 |
e19 forward | CACTGAAGGCAGCCTTCGA | 900 |
a2 reverse | GAGGCTCAAAGTCAGATGCTACTG | 900 |
a2 probe (FAM™-MGB) | TCAAAGCCCTTCAGCG | 250 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Petiti, J.; Lo Iacono, M.; Dragani, M.; Pironi, L.; Fantino, C.; Rapanotti, M.C.; Quarantelli, F.; Izzo, B.; Divona, M.; Rege-Cambrin, G.; et al. Novel Multiplex Droplet Digital PCR Assays to Monitor Minimal Residual Disease in Chronic Myeloid Leukemia Patients Showing Atypical BCR-ABL1 Transcripts. J. Clin. Med. 2020, 9, 1457. https://doi.org/10.3390/jcm9051457
Petiti J, Lo Iacono M, Dragani M, Pironi L, Fantino C, Rapanotti MC, Quarantelli F, Izzo B, Divona M, Rege-Cambrin G, et al. Novel Multiplex Droplet Digital PCR Assays to Monitor Minimal Residual Disease in Chronic Myeloid Leukemia Patients Showing Atypical BCR-ABL1 Transcripts. Journal of Clinical Medicine. 2020; 9(5):1457. https://doi.org/10.3390/jcm9051457
Chicago/Turabian StylePetiti, Jessica, Marco Lo Iacono, Matteo Dragani, Lucrezia Pironi, Cristina Fantino, Maria Cristina Rapanotti, Fabrizio Quarantelli, Barbara Izzo, Mariadomenica Divona, Giovanna Rege-Cambrin, and et al. 2020. "Novel Multiplex Droplet Digital PCR Assays to Monitor Minimal Residual Disease in Chronic Myeloid Leukemia Patients Showing Atypical BCR-ABL1 Transcripts" Journal of Clinical Medicine 9, no. 5: 1457. https://doi.org/10.3390/jcm9051457
APA StylePetiti, J., Lo Iacono, M., Dragani, M., Pironi, L., Fantino, C., Rapanotti, M. C., Quarantelli, F., Izzo, B., Divona, M., Rege-Cambrin, G., Saglio, G., Gottardi, E. M., Cilloni, D., & Fava, C. (2020). Novel Multiplex Droplet Digital PCR Assays to Monitor Minimal Residual Disease in Chronic Myeloid Leukemia Patients Showing Atypical BCR-ABL1 Transcripts. Journal of Clinical Medicine, 9(5), 1457. https://doi.org/10.3390/jcm9051457